Your browser is old and dusty. Try Google Chrome!

Details for slr6045

ORF slr6045
Accession NP_942488.1
Symbol
Category
Definition
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_441098.1_3 Reverse -148 -167 -6.98037 0.285
NP_443027.1_4 Forward -385 -375 10.6981 0.119
NP_443027.1_4 Forward -258 -248 6.37155 0.283
NP_441675.1_4 Forward -295 -276 6.78429 0.236
NP_442062.1_3 Reverse -151 -170 -0.787193 0.25
NP_442062.1_3 Forward -167 -148 -2.95047 0.273
NP_441859.1_3 Forward -384 -365 6.1935 0.182
NP_441434.1_1 Forward -241 -227 11.4707 0.233
NP_441738.1_2 Reverse -314 -321 11.8385 0.0469
NP_440209.1_1 Reverse -374 -382 2.08437 0.286
NP_441770.1_5 Forward -264 -245 4.71934 0.213
NP_443018.1_3 Forward -255 -248 10.2655 0.107
NP_441077.1_2 Reverse -150 -169 9.11906 0.182
NP_440184.1_7 Reverse -87 -106 15.6107 0.222
NP_442690.1_1 Forward -167 -148 -11.5053 0.23
NP_441916.1_7 Reverse -247 -257 1.06167 0.294
NP_440345.1_5 Reverse -301 -315 15.5754 0.263
NP_442941.1_5 Forward -221 -207 18.1536 0.135
NP_442281.1_1 Forward -261 -247 8.75042 0.0764
NP_441556.1_6 Reverse -227 -245 13.1497 0.296
NP_442982.1_5 Reverse -213 -232 0.0977854 0.246
NP_443049.1_6 Forward -384 -374 12.7145 0.238
NP_442215.1_2 Reverse -238 -254 -7.51295 0.297
NP_442933.1_3 Forward -319 -300 15.4215 0.267
NP_442554.1_8 Forward -255 -245 4.3066 0.189
NP_442554.1_9 Forward -363 -344 17.0775 0.178
NP_442142.1_4 Reverse -244 -257 3.16532 0.265
NP_443004.2_2 Forward -97 -78 16.1751 0.221
NP_442719.1_2 Forward -225 -207 -7.94636 0.239
NP_441911.1_10 Reverse -345 -364 9.42666 0.231
NP_442739.1_2 Forward -73 -54 12.0953 0.246
NP_442724.1_1 Reverse -211 -221 15.9097 0.278
NP_441878.1_4 Forward -335 -316 4.52268 0.271
NP_441036.1_8 Forward -233 -223 10.9931 0.144
NP_441433.1_8 Forward -255 -236 -2.36049 0.268
NP_441739.1_2 Forward -217 -201 8.31764 0.193
NP_441116.1_9 Forward -321 -307 11.7993 0.268
NP_441819.1_5 Forward -155 -136 11.6018 0.261
NP_442347.1_2 Reverse -375 -384 5.01461 0.244
NP_442998.1_5 Forward -220 -210 9.32148 0.243
NP_440695.1_5 Reverse -83 -102 2.45773 0.256
NP_442993.1_1 Reverse -247 -263 -10.3645 0.217
NP_441340.1_9 Reverse -154 -164 7.29115 0.289
NP_440586.1_8 Forward -382 -375 12.6251 0.0546
NP_440586.1_8 Forward -255 -248 9.08521 0.178
NP_440267.1_2 Forward -261 -247 8.3571 0.166
NP_441877.1_9 Reverse -90 -107 3.38209 0.284
NP_441877.1_9 Forward -88 -71 1.90713 0.292
NP_442262.1_10 Forward -255 -248 9.18389 0.211
NP_442917.1_1 Reverse -148 -167 17.2065 0.0439
NP_442529.1_4 Forward -241 -222 8.35759 0.277
NP_440297.1_9 Forward -255 -245 -0.41329 0.283
YP_680420.1_10 Forward -199 -180 16.7157 0.274
NP_442578.1_7 Forward -382 -375 12.6255 0.0418
NP_440673.1_3 Reverse -376 -383 11.7405 0.0653
NP_441052.1_2 Forward -256 -246 1.94665 0.221
NP_441052.1_2 Reverse -17 -27 1.55333 0.238
NP_442219.1_8 Reverse -206 -225 7.39404 0.267
NP_442219.1_9 Reverse -375 -384 5.40793 0.166
NP_441719.1_4 Forward -382 -375 3.77569 0.285
NP_441004.1_1 Forward -268 -249 -16.2252 0.283
NP_442366.1_3 Reverse -246 -264 -4.30741 0.268
NP_442366.1_3 Forward -233 -215 -4.60241 0.274
NP_442694.1_4 Reverse -252 -261 11.3078 0.277
NP_442515.1_1 Forward -27 -13 2.2612 0.14
NP_442689.1_8 Forward -163 -146 -7.33598 0.292
NP_441124.1_5 Reverse -153 -163 10.8118 0.283
NP_440431.1_3 Reverse -143 -162 -9.73531 0.256
NP_442006.1_2 Forward -299 -282 -17.8574 0.283
NP_442443.1_4 Reverse -263 -273 13.7459 0.229
NP_441706.1_1 Reverse -80 -99 2.75272 0.117
NP_442346.1_5 Reverse -246 -256 4.40493 0.29
NP_440025.1_3 Forward -222 -208 13.5152 0.24
NP_440219.1_1 Forward -100 -81 12.555 0.271
NP_441017.1_6 Forward -260 -246 12.0937 0.227
NP_441541.1_1 Forward -274 -256 -1.52589 0.239
NP_441541.1_1 Forward -317 -299 -2.86277 0.264
NP_440833.1_6 Forward -219 -205 12.192 0.2
NP_441617.1_6 Forward -93 -74 -7.86702 0.296
NP_442138.1_5 Reverse -348 -367 10.9142 0.276
NP_440868.1_4 Reverse -370 -382 -0.74767 0.282
NP_442479.1_9 Forward -165 -146 -2.65548 0.221
NP_440905.1_1 Forward -361 -343 10.3439 0.179
NP_441848.1_4 Forward -270 -254 13.2802 0.195
NP_441084.1_6 Forward -258 -244 13.3194 0.135
NP_441811.1_8 Reverse -368 -382 12.586 0.207
NP_442786.1_2 Reverse -148 -167 17.1404 0.0875
NP_442837.1_3 Reverse -375 -382 9.87221 0.106
NP_440505.1_3 Forward -323 -313 4.3066 0.3
NP_440505.1_7 Reverse -319 -338 2.65439 0.23
NP_442532.1_1 Reverse -386 -400 9.14183 0.284
NP_440914.1_1 Reverse -217 -227 6.07773 0.297
NP_441699.1_7 Reverse -256 -275 2.06362 0.266
NP_442931.1_10 Reverse -148 -167 14.5516 0.0543
NP_442533.1_6 Reverse -247 -256 4.81794 0.172
NP_441028.1_6 Reverse -291 -301 5.19112 0.265
NP_441527.1_4 Forward -296 -277 -9.1199 0.255
NP_441527.1_4 Forward -262 -243 -9.88384 0.262
NP_439903.1_6 Reverse -362 -381 0.0970122 0.271
NP_442794.1_1 Reverse -308 -320 4.07055 0.279
NP_440082.1_5 Forward -172 -153 17.425 0.256
NP_440935.1_6 Reverse -228 -245 6.54559 0.267
NP_440935.1_6 Forward -169 -152 6.06813 0.276
NP_441421.1_6 Forward -106 -89 10.8427 0.279
NP_442930.1_1 Forward -218 -208 9.616 0.28
NP_440987.1_4 Reverse -156 -175 10.4225 0.15
NP_442680.1_5 Reverse -344 -363 8.37591 0.169
NP_442582.1_3 Reverse -147 -161 16.7227 0.127
NP_443000.1_7 Forward -385 -375 3.81494 0.226
NP_441635.1_1 Forward -93 -74 10.074 0.236
NP_441207.1_7 Reverse -156 -170 10.514 0.262
NP_440641.1_7 Forward -308 -289 9.93088 0.227
NP_440804.1_7 Forward -317 -300 6.23297 0.291
NP_442116.1_6 Forward -161 -144 5.3042 0.299
NP_440591.1_3 Forward -41 -23 -2.24246 0.209
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

ACATTAACTTTAAATATAGCGATCAAGACAAACACTATACTGCCCTTCTTTCTACTCAGGTACCAGGGGATTATAAACTGGCGATTTTAAGTGATATTAACGGCGAAAAAGTCAATGGAAGATTCAGTTTTAGCTTTTGAAAAAAGCCATGGACATTAAGAAAATATCTGAGTTCGACTTTGTCCAAATTCCCTAAAACTCAAACGAGAGAGTGAAGGTTCTAGATGCATTGCTTTAAGATTTTCTTAACATTGCTGTCAAACAGTGACGCTTGAAAAGTCAGAAACATTACTCTGAAGGAACTTTAGAATAATCGCTAAGGTTTTTCAAATGGATAAAGTCAGGCTAGAGTAGGTCTTTCTTCATAAACTCTTGGTGATAAACCGAATTAGATGTACTA

CDS

ATGCTCTTAACCAGTATGGATCAAAACGAGTGGGTCATATTTGCAGAATTACAGCGTTCAGACTTTGAGTTGATTGTTTCAATCCTATCTGACCACTTCCCCCGTCTGGAATGGGGTTCACAGTGCGATGACTGGATTTGGATTTATCGCCGGGACTACAAGTTAGAGATTGACTCTTTTTCGTCCATGGAGCTGGAAGTGAAGGCCCAAAGGAAAGCCTATGGTTTAGCCCAGGAAGTTTTGTCCCTGTTGCCGCCTTCAGTATTTATTGACGTTTTTGAATGTCCCAAGTTGGATTTCACTCGCTGA

Protein

No sequence available