Your browser is old and dusty. Try Google Chrome!

Details for slr6044

ORF slr6044
Accession NP_942487.1
Symbol
Category
Definition
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_442711.1_1 Reverse -39 -53 11.5043 0.242
NP_441061.1_2 Reverse -295 -309 3.8345 0.159
NP_441061.1_2 Forward -167 -153 1.37622 0.191
NP_441418.1_6 Forward -210 -191 -19.0768 0.0844
NP_441418.1_6 Forward -168 -149 -19.1751 0.0854
NP_440815.1_5 Forward -168 -149 8.84924 0.232
NP_442291.1_5 Forward -169 -153 2.91013 0.117
NP_442291.1_5 Reverse -158 -174 2.61514 0.121
NP_442291.1_7 Reverse -290 -304 13.8643 0.211
NP_440897.1_6 Reverse -159 -178 -4.32786 0.273
NP_441453.1_4 Reverse -159 -167 7.19758 0.0757
NP_441453.1_4 Forward -210 -202 6.80426 0.121
NP_441453.1_4 Forward -168 -160 6.70593 0.121
NP_441453.1_4 Reverse -201 -209 6.11594 0.121
NP_442151.1_6 Forward -210 -196 16.6175 0.0139
NP_441818.1_1 Forward -309 -298 10.1862 0.232
NP_441818.1_1 Forward -167 -156 9.00628 0.267
NP_441818.1_9 Reverse -40 -59 1.0811 0.191
NP_441818.1_9 Forward -168 -149 -7.4737 0.272
NP_441818.1_9 Forward -203 -184 -9.047 0.287
NP_440226.1_1 Forward -168 -149 10.5209 0.0617
NP_440996.1_5 Forward -24 -15 15.4627 0.195
NP_440637.1_4 Forward -167 -148 2.16274 0.299
NP_442173.1_1 Reverse -202 -210 12.0158 0.0316
NP_442173.1_1 Reverse -160 -168 5.82095 0.2
NP_442173.1_1 Forward -167 -159 5.72262 0.203
NP_442173.1_1 Forward -209 -201 4.83764 0.241
NP_442752.1_4 Forward -210 -203 13.8055 0.0199
NP_442752.1_4 Forward -168 -161 13.8055 0.0199
NP_442752.1_4 Forward -151 -144 5.44732 0.202
NP_443027.1_4 Forward -170 -160 7.25653 0.24
NP_442975.1_10 Reverse -155 -169 11.307 0.0508
NP_442975.1_10 Reverse -197 -211 3.04726 0.263
NP_440784.1_7 Forward -209 -202 6.23397 0.241
NP_440784.1_7 Reverse -160 -167 6.23397 0.241
NP_440784.1_7 Reverse -202 -209 6.13563 0.241
NP_440784.1_7 Forward -167 -160 6.13563 0.241
NP_442909.1_7 Reverse -196 -210 5.21053 0.296
NP_440061.1_9 Reverse -157 -171 10.6187 0.124
NP_440061.1_9 Reverse -298 -312 6.0955 0.261
NP_441476.1_6 Forward -246 -227 13.0766 0.286
NP_442062.1_8 Forward -168 -158 7.84651 0.0871
NP_442062.1_8 Reverse -159 -169 7.64985 0.0911
NP_440304.1_4 Reverse -299 -309 5.48657 0.206
NP_442242.1_4 Forward -167 -160 12.4288 0.0393
NP_440044.1_8 Forward -209 -190 3.6377 0.126
NP_440044.1_8 Forward -167 -148 2.94938 0.142
NP_441200.1_4 Reverse -222 -241 8.06259 0.258
NP_441208.1_1 Reverse -130 -149 -6.88371 0.296
NP_441208.1_9 Reverse -64 -78 7.57108 0.221
NP_440370.1_10 Reverse -58 -77 8.16093 0.243
NP_442110.1_7 Forward -210 -196 12.9793 0.0586
NP_442110.1_7 Reverse -159 -173 0.88457 0.245
NP_440856.1_7 Forward -204 -185 -9.047 0.282
NP_441083.1_5 Reverse -201 -211 17.7779 0.00336
NP_441083.1_5 Reverse -159 -169 11.0914 0.0166
NP_441083.1_5 Forward -168 -158 10.6981 0.0184
NP_441083.1_5 Forward -210 -200 8.04317 0.046
NP_441434.1_1 Reverse -1 -15 8.79688 0.252
NP_441738.1_2 Reverse -203 -210 15.28 0.0102
NP_441738.1_2 Reverse -161 -168 15.28 0.0102
NP_441738.1_2 Reverse -144 -151 10.2652 0.101
NP_440209.1_1 Forward -168 -160 14.8674 0.012
NP_440209.1_1 Forward -210 -202 8.57422 0.0425
NP_440209.1_1 Reverse -159 -167 8.57422 0.0425
NP_440209.1_1 Reverse -201 -209 5.52596 0.0821
NP_442889.1_10 Reverse -9 -28 13.4052 0.179
NP_440056.1_9 Forward -157 -138 12.6039 0.295
NP_441713.1_1 Forward -157 -138 2.85105 0.0572
NP_440178.1_7 Reverse -158 -177 -13.6686 0.141
NP_440178.1_7 Forward -169 -150 -15.7335 0.163
NP_442570.1_3 Forward -312 -293 13.0775 0.078
NP_441716.1_1 Forward -168 -154 8.84938 0.13
NP_442111.1_3 Forward -326 -313 13.1442 0.262
NP_442111.1_4 Reverse -200 -214 14.3559 0.0307
NP_442111.1_4 Reverse -158 -172 5.21113 0.172
NP_441624.1_7 Forward -315 -301 6.29277 0.286
NP_440343.1_9 Forward -220 -201 6.78429 0.293
NP_440906.1_5 Forward -167 -160 12.0355 0.0724
NP_440906.1_5 Reverse -160 -167 12.0355 0.0724
NP_440906.1_5 Forward -209 -202 6.23397 0.234
NP_440906.1_5 Reverse -202 -209 6.13563 0.241
NP_440747.1_10 Forward -171 -159 16.7552 0.0019
NP_440747.1_10 Forward -213 -201 7.11881 0.00789
NP_440747.1_10 Reverse -156 -168 -2.22263 0.026
NP_440747.1_10 Reverse -198 -210 -12.1541 0.227
NP_440747.1_10 Forward -312 -300 -12.2524 0.254
NP_441130.1_10 Reverse -199 -213 5.99778 0.207
NP_441486.1_1 Reverse -156 -170 4.52282 0.0432
NP_441486.1_1 Forward -171 -157 -5.9986 0.272
NP_440403.1_10 Reverse -192 -211 1.37609 0.291
NP_440842.1_10 Reverse -292 -306 13.3726 0.251
NP_441014.1_10 Forward -169 -150 7.66846 0.144
NP_442848.1_1 Reverse -153 -167 -3.147 0.263
NP_442848.1_4 Forward -305 -291 6.29277 0.284
NP_442848.1_5 Reverse -353 -371 -3.32411 0.291
NP_441012.1_4 Reverse -297 -310 8.37742 0.272
NP_443018.1_3 Reverse -202 -209 11.7405 0.0655
NP_443018.1_3 Reverse -68 -75 8.39725 0.147
NP_443018.1_3 Forward -209 -202 5.44732 0.193
NP_443018.1_3 Forward -167 -160 5.34899 0.212
NP_443018.1_3 Reverse -160 -167 5.34899 0.212
NP_441634.1_8 Forward -212 -198 5.30946 0.114
NP_441634.1_8 Reverse -37 -51 -1.37704 0.288
NP_441634.1_8 Reverse -181 -195 -2.55701 0.295
NP_441634.1_8 Forward -170 -156 -4.62196 0.295
NP_440376.1_1 Forward -168 -159 9.73449 0.0365
NP_440376.1_1 Reverse -159 -168 9.73449 0.0365
NP_440376.1_1 Forward -210 -201 5.99792 0.111
NP_440376.1_1 Reverse -201 -210 -0.196935 0.285
NP_442687.1_7 Forward -169 -159 7.35486 0.134
NP_441077.1_6 Forward -27 -11 9.74316 0.167
NP_441846.1_10 Forward -203 -184 -14.9469 0.241
NP_440642.1_10 Forward -305 -291 3.63724 0.269
NP_441013.1_2 Forward -179 -161 4.05072 0.226
NP_441013.1_2 Forward -314 -296 -4.50408 0.299
NP_441950.1_7 Forward -371 -352 -7.76869 0.283
NP_442296.1_5 Reverse -297 -316 11.7008 0.15
NP_442658.1_1 Reverse -299 -309 8.14104 0.199
NP_442782.1_2 Reverse -295 -309 1.37622 0.281
NP_440656.1_8 Reverse -148 -167 -4.03212 0.198
NP_441414.1_9 Reverse -159 -178 -0.590531 0.0929
NP_440800.1_7 Forward -326 -312 10.3243 0.294
NP_441478.1_10 Forward -243 -225 5.52492 0.277
NP_442937.1_5 Forward -395 -376 7.37428 0.254
NP_442937.1_5 Forward -308 -289 5.99764 0.293
NP_441958.1_5 Forward -169 -159 2.7333 0.0378
NP_441958.1_5 Reverse -158 -168 2.53664 0.0409
NP_441958.1_5 Forward -211 -201 0.865012 0.12
NP_441127.1_1 Reverse -129 -143 8.55439 0.29
NP_442836.1_5 Forward -174 -155 0.884433 0.294
NP_443001.1_7 Forward -309 -290 2.3594 0.279
NP_439990.1_5 Forward -173 -160 11.7207 0.128
NP_439990.1_5 Reverse -34 -47 6.4108 0.239
NP_442690.1_1 Reverse -15 -34 -16.5201 0.289
NP_441580.1_6 Reverse -190 -209 3.83436 0.117
NP_441580.1_6 Forward -59 -40 -9.14533 0.286
NP_440153.1_5 Reverse -160 -174 1.67122 0.245
NP_440369.1_5 Reverse -294 -313 10.4225 0.27
NP_442064.1_4 Forward -220 -201 6.09517 0.257
NP_442064.1_4 Forward -314 -295 5.30853 0.271
NP_442051.1_5 Forward -200 -181 9.53756 0.29
NP_443055.1_6 Reverse -151 -169 0.116744 0.249
NP_443055.1_6 Reverse -193 -211 -0.276578 0.256
NP_440993.1_3 Reverse -191 -210 1.27698 0.232
NP_440993.1_4 Reverse -243 -260 3.0871 0.294
NP_440827.1_3 Reverse -196 -215 12.1925 0.26
NP_440827.1_3 Reverse -289 -308 11.4058 0.268
NP_442210.1_5 Forward -257 -238 12.3892 0.212
NP_441348.1_3 Reverse -196 -215 6.09597 0.291
NP_441099.1_5 Reverse -191 -210 9.3409 0.0328
NP_441099.1_5 Reverse -149 -168 -6.98204 0.168
NP_441099.1_5 Forward -178 -159 -9.63698 0.229
NP_442002.1_9 Reverse -311 -318 11.1505 0.185
NP_441294.1_7 Reverse -155 -169 12.9942 0.0767
NP_441294.1_7 Reverse -197 -211 12.5142 0.0944
NP_441646.1_1 Forward -316 -297 -1.37718 0.284
NP_441646.1_7 Forward -309 -295 13.5693 0.28
NP_442438.1_10 Forward -173 -159 9.14437 0.0692
NP_442438.1_10 Reverse -235 -249 -1.08205 0.291
NP_440147.1_4 Forward -212 -199 7.00078 0.0778
NP_440147.1_4 Reverse -157 -170 0.0192843 0.268
NP_440147.1_4 Forward -71 -58 -0.472371 0.287
NP_440147.1_4 Forward -170 -157 -0.767364 0.299
NP_441175.1_7 Reverse -159 -178 10.1275 0.175
NP_441550.1_8 Forward -212 -202 13.8442 0.0207
NP_441550.1_8 Reverse -199 -209 12.1726 0.0361
NP_441550.1_8 Forward -170 -160 5.78111 0.23
NP_440465.1_10 Reverse -231 -250 4.42435 0.228
NP_441041.1_4 Reverse -159 -178 -0.885524 0.0986
NP_441041.1_4 Reverse -201 -220 -11.8986 0.254
NP_441041.1_4 Reverse -67 -86 -12.9802 0.278
NP_440569.1_10 Reverse -168 -187 6.06331 0.236
NP_441725.1_4 Forward -296 -282 5.50552 0.278
NP_441725.1_5 Forward -309 -299 7.15819 0.103
NP_441725.1_5 Forward -167 -157 1.455 0.135
NP_439966.1_7 Reverse -199 -209 14.5325 0.0203
NP_439966.1_7 Reverse -157 -167 6.86274 0.163
NP_439966.1_7 Forward -212 -202 5.58445 0.216
NP_439966.1_7 Forward -170 -160 5.48612 0.22
NP_442941.1_3 Forward -167 -157 10.1081 0.024
NP_442941.1_3 Reverse -160 -170 9.51814 0.0306
NP_442941.1_3 Reverse -202 -212 9.41981 0.0319
NP_440289.1_1 Reverse -382 -399 16.4174 0.289
NP_440289.1_2 Reverse -156 -169 3.5592 0.0767
NP_440289.1_2 Reverse -198 -211 1.39592 0.128
NP_440983.1_5 Forward -246 -227 -2.85214 0.232
NP_440260.1_8 Forward -313 -295 -1.94747 0.242
NP_441514.1_6 Reverse -211 -218 14.2971 0.248
NP_442281.1_1 Reverse -296 -310 9.14375 0.0736
NP_442281.1_1 Reverse -154 -168 8.55376 0.0798
NP_442281.1_1 Forward -173 -159 6.78381 0.115
NP_442281.1_1 Reverse -196 -210 4.8172 0.18
NP_442575.1_8 Reverse -222 -241 -3.3438 0.251
NP_442256.1_2 Reverse -199 -217 -1.94747 0.188
NP_442256.1_2 Forward -170 -152 -9.81395 0.292
NP_001035871.2_7 Reverse -167 -177 17.6796 0.105
NP_440437.1_1 Forward -174 -155 6.09597 0.0788
NP_439983.1_7 Reverse -39 -57 13.7855 0.2
NP_442049.1_6 Forward -218 -199 6.98095 0.215
NP_442288.1_4 Reverse -1 -15 19.2055 0.158
NP_441556.1_4 Reverse -231 -250 11.4512 0.247
NP_442982.1_5 Reverse -290 -309 0.884433 0.233
NP_440375.1_8 Reverse -160 -179 -0.39387 0.266
NP_443030.1_4 Reverse -294 -313 2.0644 0.209
NP_441644.1_6 Reverse -201 -211 14.4342 0.0126
NP_441644.1_6 Forward -168 -158 13.0576 0.0244
NP_441644.1_6 Reverse -159 -169 8.53436 0.0982
NP_441644.1_6 Reverse -240 -250 7.15773 0.133
NP_441644.1_6 Forward -210 -200 4.01116 0.253
NP_443049.1_6 Forward -211 -201 14.4711 0.114
NP_443049.1_6 Reverse -169 -179 11.0554 0.282
NP_442215.1_2 Forward -312 -296 3.99177 0.0889
NP_442215.1_2 Reverse -157 -173 -2.69473 0.202
NP_442215.1_2 Reverse -199 -215 -6.03799 0.263
NP_442215.1_2 Reverse -213 -229 -6.82463 0.28
NP_442177.1_6 Reverse -36 -55 11.1109 0.233
NP_440253.1_2 Forward -168 -150 -2.14413 0.261
NP_440253.1_2 Forward -210 -192 -3.6191 0.297
NP_440929.1_8 Reverse -159 -168 9.73449 0.0257
NP_440929.1_8 Forward -168 -159 9.4395 0.0326
NP_440929.1_8 Reverse -201 -210 7.07956 0.0713
NP_442933.1_1 Forward -30 -11 6.15881 0.278
NP_442933.1_10 Forward -168 -159 13.9627 0.0192
NP_442933.1_10 Reverse -159 -168 8.1612 0.0885
NP_441751.2_8 Forward -167 -153 -4.22864 0.166
NP_442926.1_3 Reverse -223 -242 11.5042 0.119
NP_442554.1_8 Reverse -160 -170 6.46988 0.117
NP_442554.1_8 Forward -167 -157 6.37155 0.12
NP_442554.1_8 Reverse -202 -212 6.37155 0.12
NP_442554.1_8 Forward -209 -199 6.17489 0.125
NP_442554.1_8 Forward -75 -65 3.12662 0.239
NP_442554.1_8 Forward -314 -304 1.94665 0.288
NP_441762.1_7 Forward -211 -199 -4.9759 0.185
NP_442142.1_4 Reverse -156 -169 14.4733 0.0311
NP_442142.1_4 Reverse -198 -211 6.31189 0.169
NP_442142.1_4 Reverse -333 -346 4.54195 0.217
NP_442142.1_4 Forward -171 -158 3.7553 0.246
NP_442292.1_1 Reverse -160 -169 8.75118 0.0306
NP_442292.1_1 Reverse -202 -211 8.65285 0.0335
NP_442292.1_1 Forward -167 -158 8.65285 0.0335
NP_442292.1_1 Forward -209 -200 -0.0986038 0.239
NP_442476.1_6 Reverse -202 -216 1.47456 0.214
NP_440895.1_6 Forward -216 -203 9.45906 0.22
NP_441711.1_4 Reverse -150 -169 5.11266 0.182
NP_441523.1_6 Reverse -296 -315 3.14605 0.277
NP_443009.1_5 Reverse -141 -152 7.72798 0.122
NP_443009.1_5 Reverse -300 -311 7.53132 0.126
NP_443009.1_5 Reverse -158 -169 5.95804 0.18
NP_441715.1_4 Reverse -160 -170 7.64985 0.108
NP_441715.1_4 Reverse -202 -212 7.55152 0.108
NP_441715.1_4 Forward -167 -157 4.99491 0.24
NP_441715.1_9 Reverse -295 -309 16.7159 0.261
NP_443034.1_3 Reverse -168 -187 12.2908 0.237
NP_441198.1_8 Reverse -299 -309 10.9275 0.232
NP_441468.1_1 Forward -209 -202 6.13563 0.209
NP_441468.1_1 Reverse -160 -167 6.13563 0.209
NP_441468.1_1 Reverse -202 -209 6.0373 0.223
NP_441468.1_1 Forward -167 -160 6.0373 0.223
NP_441015.1_10 Reverse -229 -248 -3.14714 0.185
NP_441015.1_10 Forward -215 -196 -5.60541 0.228
NP_441673.1_1 Reverse -159 -168 11.1111 0.0121
NP_441673.1_1 Forward -168 -159 11.0128 0.018
NP_441673.1_1 Forward -210 -201 1.37636 0.114
NP_441673.1_1 Reverse -201 -210 1.1797 0.163
NP_441731.1_3 Forward -218 -199 -5.11376 0.284
NP_441826.1_2 Forward -174 -160 4.71948 0.0999
NP_441826.1_2 Reverse -195 -209 4.52282 0.102
NP_441826.1_2 Forward -216 -202 -2.75368 0.275
NP_441826.1_2 Reverse -295 -309 -4.03198 0.291
NP_441826.1_2 Reverse -237 -251 -4.22864 0.293
NP_441826.1_5 Reverse -120 -139 5.99764 0.225
NP_441393.1_2 Forward -207 -188 10.8286 0.293
NP_442868.1_6 Forward -212 -202 9.51814 0.0447
NP_442868.1_6 Forward -170 -160 9.41981 0.0485
NP_442868.1_6 Reverse -199 -209 7.35486 0.0808
NP_442868.1_6 Reverse -157 -167 0.176696 0.247
NP_441612.1_2 Reverse -135 -145 8.35566 0.219
NP_442227.1_2 Reverse -184 -203 -1.18052 0.262
NP_442808.1_1 Reverse -200 -210 9.616 0.0481
NP_442808.1_1 Reverse -158 -168 7.35439 0.0814
NP_442808.1_1 Forward -77 -67 4.89613 0.185
NP_442808.1_1 Forward -180 -170 1.35624 0.287
NP_440145.1_3 Forward -178 -159 6.78429 0.0507
NP_440145.1_3 Forward -220 -201 -3.04881 0.185
NP_442820.1_4 Reverse -196 -213 12.8219 0.265
NP_442542.1_2 Reverse -199 -212 4.54251 0.3
NP_442050.1_1 Reverse -294 -313 8.35759 0.251
NP_442050.1_1 Forward -199 -180 7.17762 0.275
NP_442050.1_5 Reverse -199 -209 12.4676 0.0617
NP_442050.1_5 Reverse -157 -167 7.15773 0.27
NP_441114.1_3 Forward -308 -299 7.57121 0.231
NP_440558.1_2 Reverse -291 -310 4.71934 0.149
NP_440558.1_2 Reverse -297 -316 2.55606 0.167
NP_440558.1_2 Forward -313 -294 -1.57384 0.215
NP_442789.1_4 Reverse -241 -260 -2.16383 0.233
NP_442789.1_4 Forward -167 -148 -5.40875 0.269
NP_442789.1_4 Reverse -238 -257 -7.76869 0.299
NP_441518.1_3 Reverse -149 -168 4.62101 0.05
NP_441878.1_6 Reverse -293 -303 1.06167 0.116
NP_441878.1_6 Reverse -158 -168 0.668351 0.139
NP_441878.1_6 Forward -169 -159 0.57002 0.14
NP_441878.1_6 Reverse -300 -310 -7.49312 0.231
NP_441036.1_8 Reverse -158 -168 6.76487 0.215
NP_441557.1_5 Reverse -159 -168 10.2261 0.0144
NP_441557.1_5 Forward -168 -159 10.1278 0.0188
NP_441557.1_5 Forward -210 -201 1.08137 0.0794
NP_441557.1_5 Reverse -201 -210 0.589713 0.134
NP_441445.1_1 Reverse -150 -169 -0.590531 0.297
NP_441590.1_1 Reverse -191 -210 11.0125 0.256
NP_442066.2_4 Reverse -201 -220 -7.86702 0.289
NP_440084.1_8 Reverse -10 -24 10.8977 0.259
NP_440084.1_8 Reverse -11 -25 10.7067 0.265
NP_442183.1_1 Forward -168 -154 6.98109 0.153
NP_442183.1_1 Forward -210 -196 4.42448 0.261
NP_440676.1_3 Forward -98 -79 12.1925 0.252
NP_441467.1_9 Forward -377 -363 13.2743 0.27
NP_442347.1_2 Reverse -202 -211 10.3245 0.058
NP_442347.1_2 Reverse -160 -169 3.93297 0.284
NP_442965.1_2 Reverse -295 -314 0.392778 0.2
NP_440151.1_5 Forward -315 -296 5.211 0.262
NP_442738.1_5 Forward -260 -241 12.0942 0.199
NP_441633.1_3 Forward -212 -199 -6.2739 0.242
NP_441633.1_3 Forward -170 -157 -6.47056 0.253
NP_442764.1_3 Reverse -300 -310 15.418 0.295
NP_440136.1_2 Forward -209 -202 6.23397 0.171
NP_440136.1_2 Reverse -160 -167 6.23397 0.171
NP_440136.1_2 Reverse -202 -209 6.13563 0.193
NP_440136.1_2 Forward -167 -160 6.13563 0.193
NP_442590.1_10 Forward -249 -230 6.4893 0.244
NP_442998.1_5 Reverse -310 -320 12.9597 0.158
NP_442998.1_10 Reverse -203 -210 15.5754 0.0102
NP_442998.1_10 Reverse -161 -168 15.5754 0.0102
NP_442998.1_10 Forward -166 -159 5.74231 0.255
NP_440299.1_1 Forward -172 -159 16.4399 0.0101
NP_440299.1_1 Forward -214 -201 2.18201 0.294
NP_441007.1_10 Reverse -196 -209 -0.964025 0.296
NP_442333.2_5 Reverse -284 -303 -7.67036 0.232
NP_440256.1_1 Forward -171 -152 6.4893 0.0296
NP_440256.1_1 Forward -213 -194 -0.0988766 0.0893
NP_440256.1_1 Reverse -156 -175 -8.55534 0.263
NP_441559.1_8 Forward -314 -300 5.40779 0.0923
NP_441559.1_8 Forward -315 -301 -0.0987402 0.172
NP_441559.1_8 Forward -173 -159 -6.88358 0.281
NP_440915.1_6 Forward -214 -200 9.04604 0.047
NP_440915.1_6 Forward -172 -158 1.76955 0.131
NP_440915.1_6 Forward -313 -299 -3.04867 0.29
NP_442866.1_1 Forward -315 -296 -6.88371 0.261
NP_440748.1_5 Reverse -297 -316 4.916 0.195
NP_440702.1_2 Reverse -37 -56 -8.26035 0.29
NP_441494.1_4 Reverse -226 -244 13.5888 0.289
NP_440677.1_6 Reverse -291 -310 8.45592 0.277
NP_442386.1_9 Reverse -200 -209 11.9957 0.0754
NP_441340.1_5 Forward -209 -202 13.5105 0.0314
NP_441340.1_5 Forward -167 -160 6.13563 0.175
NP_441340.1_5 Reverse -160 -167 5.93897 0.198
NP_441340.1_5 Reverse -202 -209 5.84064 0.208
NP_442327.1_3 Reverse -4 -23 5.68135 0.276
NP_442484.1_2 Reverse -190 -209 7.96426 0.144
NP_440146.1_2 Reverse -228 -242 13.3726 0.278
NP_442240.1_2 Reverse -160 -179 -9.63698 0.137
NP_440586.1_8 Forward -167 -160 11.4451 0.0645
NP_440586.1_8 Reverse -202 -209 9.47853 0.146
NP_440586.1_8 Reverse -68 -75 7.21693 0.27
NP_440586.1_8 Forward -209 -202 5.74197 0.283
NP_442251.1_6 Reverse -160 -167 12.0355 0.0627
NP_440192.1_4 Forward -68 -49 10.6589 0.237
NP_440684.1_9 Forward -368 -354 10.521 0.195
NP_441262.1_3 Forward -210 -203 14.7888 0.0223
NP_441262.1_3 Forward -168 -161 14.7888 0.0223
NP_440027.1_3 Reverse -201 -219 4.34495 0.262
NP_440027.1_8 Reverse -198 -217 8.06178 0.249
NP_443051.1_1 Forward -211 -202 7.47288 0.0571
NP_443051.1_1 Forward -169 -160 0.786375 0.125
NP_443051.1_1 Reverse -158 -167 0.688044 0.134
NP_440451.1_10 Reverse -160 -179 7.76679 0.283
NP_439937.1_8 Reverse -229 -248 -4.13045 0.278
NP_439937.1_9 Forward -53 -36 -12.7448 0.276
NP_442294.1_5 Forward -347 -337 16.7946 0.285
NP_440408.1_7 Reverse -294 -313 7.37428 0.29
NP_439943.1_2 Reverse -304 -323 12.0942 0.251
NP_440372.1_2 Forward -209 -202 13.8055 0.0214
NP_440372.1_2 Forward -167 -160 6.72562 0.0929
NP_440372.1_2 Reverse -160 -167 6.62729 0.151
NP_440372.1_2 Reverse -202 -209 6.52896 0.188
NP_442783.1_10 Reverse -197 -207 16.6958 0.149
NP_441803.1_2 Forward -215 -196 4.52268 0.177
NP_439977.1_5 Forward -316 -297 4.12936 0.155
NP_441572.1_7 Reverse -295 -314 5.11266 0.0892
NP_441572.1_7 Reverse -195 -214 -3.73712 0.219
NP_442384.1_10 Reverse -159 -172 17.4239 0.00585
NP_442384.1_10 Reverse -201 -214 8.77074 0.0608
NP_442384.1_10 Forward -249 -236 3.75586 0.179
NP_442384.1_10 Reverse -67 -80 0.510939 0.289
NP_441877.1_9 Reverse -12 -29 3.57876 0.284
NP_441018.1_7 Forward -373 -354 10.5209 0.202
NP_442790.1_4 Forward -219 -200 -8.94866 0.176
NP_442262.1_10 Reverse -202 -209 13.2155 0.0213
NP_442262.1_10 Reverse -68 -75 10.7572 0.124
NP_441689.1_5 Reverse -157 -167 6.0761 0.197
NP_440163.1_10 Reverse -36 -46 8.23984 0.282
NP_440344.1_10 Reverse -194 -211 1.02215 0.0322
NP_440344.1_10 Reverse -152 -169 -2.3211 0.0643
NP_440282.1_10 Reverse -296 -315 -7.96535 0.257
NP_440531.1_6 Reverse -151 -170 0.58944 0.19
NP_441898.1_2 Reverse -266 -285 15.8299 0.212
NP_442693.1_7 Reverse -293 -312 10.1275 0.227
NP_442556.1_10 Forward -92 -73 13.6054 0.211
NP_440297.1_9 Forward -309 -299 7.05986 0.15
NP_440297.1_9 Forward -314 -304 -0.0199663 0.282
NP_440297.1_9 Forward -167 -157 -0.511621 0.289
NP_440350.1_2 Forward -265 -246 5.30933 0.287
NP_442187.1_3 Forward -211 -201 15.6147 0.105
NP_442280.1_10 Forward -313 -295 10.1296 0.223
NP_442280.1_10 Forward -220 -202 5.55182 0.283
NP_440650.1_6 Reverse -266 -285 7.7676 0.258
NP_440999.1_9 Reverse -197 -211 4.03116 0.119
NP_440999.1_9 Forward -52 -38 3.24451 0.133
NP_440999.1_9 Forward -172 -158 0.294584 0.189
NP_440888.1_2 Reverse -201 -215 13.8636 0.0231
NP_440888.1_2 Reverse -159 -173 8.3571 0.163
NP_440888.1_2 Forward -168 -154 5.60385 0.272
NP_442147.1_6 Forward -78 -64 14.7486 0.281
NP_440491.1_1 Reverse -156 -175 10.1331 0.198
NP_440491.1_1 Forward -213 -194 7.30684 0.273
NP_442277.1_7 Reverse -4 -20 -1.23459 0.268
NP_442033.1_10 Reverse -199 -218 -7.08038 0.186
NP_440575.1_8 Forward -325 -306 -0.4922 0.193
NP_441543.1_2 Forward -167 -158 7.47288 0.117
NP_441543.1_2 Reverse -160 -169 7.17789 0.131
NP_441543.1_2 Reverse -202 -211 7.07956 0.131
NP_442845.1_2 Forward -216 -202 6.09611 0.217
NP_442845.1_2 Reverse -159 -173 3.93283 0.272
NP_441834.1_1 Reverse -230 -249 13.8641 0.267
NP_441319.1_5 Forward -209 -190 9.43923 0.27
NP_441918.1_10 Forward -215 -197 20.2753 0.0511
NP_442710.1_7 Reverse -7 -26 -1.55227 0.221
NP_441469.1_8 Reverse -300 -309 9.4395 0.227
NP_443064.1_6 Reverse -159 -169 11.5004 0.13
NP_442337.1_8 Forward -375 -356 -1.37718 0.28
NP_442578.1_7 Forward -209 -202 6.0373 0.18
NP_442578.1_7 Forward -167 -160 5.93897 0.183
NP_441462.1_2 Forward -210 -200 7.55152 0.0543
NP_441462.1_2 Forward -168 -158 2.14332 0.0801
NP_441462.1_2 Reverse -159 -169 1.84832 0.081
NP_441462.1_2 Forward -249 -239 -0.904945 0.265
NP_441462.1_2 Forward -76 -66 -1.19994 0.291
NP_443062.1_1 Reverse -201 -219 15.4689 0.0378
NP_443062.1_1 Reverse -159 -177 6.30325 0.204
NP_443062.1_1 Forward -356 -338 5.91323 0.215
NP_443062.1_1 Forward -179 -161 5.91323 0.215
NP_443062.1_1 Forward -168 -150 4.84065 0.247
NP_443062.1_1 Forward -76 -58 4.84065 0.247
NP_443062.1_6 Reverse -31 -50 2.26107 0.258
NP_442204.1_1 Forward -214 -203 11.5634 0.0565
NP_442204.1_1 Forward -172 -161 11.5634 0.0565
NP_442204.1_1 Reverse -63 -74 0.0586712 0.284
NP_442204.1_5 Forward -366 -347 2.75272 0.206
NP_441560.1_3 Reverse -222 -240 11.2289 0.264
NP_440255.1_2 Forward -338 -320 17.4237 0.291
NP_440516.1_6 Forward -303 -289 7.57046 0.27
NP_440516.1_8 Forward -210 -201 18.9776 0.00442
NP_440516.1_8 Forward -168 -159 15.6344 0.00582
NP_440516.1_8 Reverse -159 -168 7.47288 0.0581
NP_440516.1_8 Reverse -201 -210 5.01461 0.118
NP_441785.1_1 Forward -168 -154 11.3809 0.3
NP_442428.1_5 Forward -209 -202 6.13563 0.209
NP_442428.1_5 Reverse -160 -167 6.13563 0.209
NP_442428.1_5 Reverse -202 -209 6.0373 0.212
NP_442428.1_5 Forward -167 -160 6.0373 0.212
NP_441443.1_10 Forward -308 -290 -0.0799167 0.293
NP_442120.1_10 Forward -315 -296 -15.9302 0.296
NP_440673.1_3 Reverse -203 -210 12.4288 0.0426
NP_440673.1_3 Reverse -161 -168 12.4288 0.0426
NP_441052.1_2 Reverse -201 -211 10.6981 0.0285
NP_441052.1_2 Forward -168 -158 10.3048 0.0289
NP_441052.1_2 Reverse -159 -169 10.2065 0.0295
NP_441052.1_2 Forward -210 -200 0.668351 0.256
NP_442219.1_9 Forward -209 -200 8.65285 0.0681
NP_442219.1_9 Reverse -160 -169 8.06287 0.0696
NP_442219.1_9 Reverse -202 -211 7.96454 0.0696
NP_442219.1_9 Forward -167 -158 7.96454 0.0696
NP_440436.1_4 Forward -167 -158 13.9623 0.0193
NP_440436.1_4 Reverse -160 -169 13.9623 0.0193
NP_440436.1_4 Reverse -202 -211 7.57079 0.124
NP_441884.1_9 Forward -213 -194 -21.7317 0.261
NP_442412.1_5 Reverse -281 -300 7.27595 0.281
NP_441719.1_4 Forward -209 -202 6.82395 0.0855
NP_441719.1_4 Forward -167 -160 6.72562 0.093
NP_441719.1_4 Reverse -160 -167 6.62729 0.151
NP_441719.1_4 Reverse -202 -209 6.52896 0.188
NP_441004.1_1 Reverse -295 -314 -14.7502 0.27
NP_441004.1_2 Reverse -284 -303 0.491109 0.234
NP_441004.1_2 Reverse -290 -309 -4.52377 0.291
NP_441004.1_4 Reverse -292 -302 9.51814 0.259
NP_441004.1_5 Reverse -39 -53 6.88276 0.296
NP_442813.1_2 Reverse -172 -191 -3.44213 0.273
NP_442366.1_3 Forward -77 -59 -2.24246 0.224
NP_442366.1_3 Forward -169 -151 -5.19239 0.284
NP_439949.1_7 Reverse -310 -324 13.0776 0.257
NP_439949.1_7 Forward -154 -140 10.1277 0.293
NP_442873.1_9 Reverse -191 -210 4.52188 0.287
NP_441115.1_4 Reverse -346 -364 8.3765 0.25
NP_441851.1_2 Reverse -305 -324 5.70265 0.181
NP_441851.1_10 Forward -169 -159 6.07655 0.187
NP_441851.1_10 Reverse -158 -168 6.07655 0.187
NP_441851.1_10 Forward -152 -142 5.97822 0.19
NP_441851.1_10 Reverse -300 -310 4.20827 0.282
NP_442622.1_8 Forward -168 -150 -19.1554 0.296
NP_442515.1_1 Reverse -356 -370 0.982901 0.174
NP_442515.1_1 Forward -250 -236 0.982901 0.174
NP_442515.1_1 Forward -169 -155 -0.393733 0.222
NP_441396.1_5 Reverse -34 -43 9.24284 0.21
NP_440593.1_3 Forward -308 -289 10.7175 0.107
NP_440593.1_3 Reverse -196 -215 6.29264 0.112
NP_441540.1_4 Forward -29 -10 17.5205 0.191
NP_440165.1_5 Reverse -200 -219 -7.57203 0.27
NP_441046.1_2 Reverse -229 -248 0.884433 0.262
NP_441046.1_2 Reverse -312 -331 -1.96717 0.294
NP_441349.1_10 Forward -220 -201 -7.37537 0.248
NP_441349.1_10 Reverse -149 -168 -8.85033 0.279
NP_441349.1_10 Forward -178 -159 -8.94866 0.28
NP_441661.1_3 Forward -194 -177 -5.07437 0.251
NP_441409.1_6 Forward -174 -155 -10.9153 0.213
NP_441409.1_8 Reverse -363 -382 10.6799 0.215
NP_440432.1_9 Forward -167 -152 -0.216765 0.164
NP_442843.1_1 Reverse -295 -314 -8.35868 0.255
NP_442843.1_1 Reverse -222 -241 -11.1119 0.286
NP_442843.1_1 Reverse -223 -242 -11.5053 0.291
NP_442843.1_1 Forward -167 -148 -11.8986 0.295
NP_439960.1_10 Forward -217 -199 6.01734 0.144
NP_441477.1_5 Forward -301 -282 6.19431 0.291
NP_441124.1_5 Reverse -174 -184 12.0532 0.239
NP_440431.1_3 Reverse -299 -318 -10.4236 0.275
NP_440588.1_2 Forward -252 -233 0.982764 0.141
NP_443047.1_7 Forward -167 -148 5.211 0.245
NP_442243.1_1 Forward -174 -156 12.1131 0.112
NP_442243.1_1 Forward -216 -198 5.52492 0.18
NP_442243.1_1 Reverse -288 -306 -1.75153 0.279
NP_441570.1_1 Forward -168 -150 18.2104 0.00322
NP_441570.1_1 Reverse -159 -177 0.21581 0.0403
NP_441570.1_1 Forward -210 -192 -9.81395 0.15
NP_441570.1_1 Reverse -295 -313 -17.8771 0.295
NP_440078.1_10 Reverse -159 -178 10.8159 0.169
NP_441078.1_4 Reverse -159 -168 9.93116 0.0203
NP_441078.1_4 Forward -168 -159 9.83282 0.0226
NP_441078.1_4 Forward -210 -201 0.196389 0.205
NP_441078.1_4 Reverse -201 -210 -0.000272808 0.205
NP_442348.1_2 Forward -151 -142 15.7327 0.119
NP_440526.1_3 Forward -167 -156 8.61296 0.118
NP_440526.1_3 Reverse -143 -154 6.35136 0.205
NP_440526.1_3 Reverse -160 -171 5.17139 0.253
NP_440526.1_3 Forward -209 -198 1.53316 0.267
NP_441432.1_8 Forward -211 -202 14.0611 0.0258
NP_441432.1_8 Forward -169 -160 7.17789 0.102
NP_441432.1_8 Reverse -158 -167 7.07956 0.105
NP_441432.1_8 Forward -310 -301 2.65466 0.292
NP_442320.1_8 Reverse -195 -209 4.32615 0.0511
NP_442320.1_8 Reverse -153 -167 1.86788 0.0817
NP_442320.1_8 Forward -216 -202 -4.52363 0.171
NP_441732.1_2 Forward -214 -198 -16.3627 0.165
NP_441732.1_2 Forward -172 -156 -16.5594 0.174
NP_442447.1_1 Reverse -88 -107 8.25926 0.258
NP_440497.1_2 Forward -167 -148 4.22769 0.293
NP_440290.1_1 Forward -28 -19 16.6071 0.24
NP_440760.1_1 Reverse -159 -178 -13.3736 0.102
NP_442797.1_7 Forward -311 -293 0.412472 0.274
NP_442274.1_7 Reverse -38 -52 18.2892 0.219
NP_440199.1_10 Reverse -156 -166 7.05986 0.242
NP_440578.1_10 Forward -224 -205 13.1758 0.246
NP_440913.1_1 Forward -170 -152 14.3755 0.118
NP_440913.1_1 Forward -212 -194 6.80398 0.221
NP_442727.1_1 Forward -376 -362 16.1259 0.195
NP_442727.1_1 Forward -162 -148 14.2576 0.236
NP_440713.1_4 Forward -220 -201 6.68596 0.187
NP_442489.1_7 Reverse -159 -168 10.6195 0.00984
NP_442489.1_7 Forward -168 -159 10.3245 0.0193
NP_442489.1_7 Forward -210 -201 0.688044 0.152
NP_442489.1_7 Reverse -201 -210 0.688044 0.152
NP_442489.1_7 Reverse -67 -76 -1.47524 0.203
NP_441452.1_1 Forward -135 -116 12.6841 0.292
NP_440559.1_1 Reverse -160 -169 14.1594 0.0317
NP_440559.1_1 Forward -167 -158 7.96454 0.0739
NP_440559.1_1 Reverse -202 -211 7.76787 0.0918
NP_440559.1_1 Forward -209 -200 6.48957 0.134
NP_441659.2_8 Forward -168 -158 14.828 0.00801
NP_441659.2_8 Reverse -159 -169 8.63316 0.0405
NP_441659.2_8 Reverse -201 -211 5.48657 0.106
NP_441659.2_8 Forward -76 -66 -0.314959 0.298
NP_441022.1_1 Forward -323 -314 13.7524 0.188
NP_442913.1_10 Forward -177 -158 0.982764 0.148
NP_441040.1_2 Forward -218 -199 -15.5368 0.286
NP_439956.1_7 Forward -315 -296 6.29264 0.257
NP_442346.1_5 Forward -169 -159 15.3197 0.00738
NP_442346.1_5 Reverse -158 -168 6.96153 0.187
NP_442346.1_10 Forward -227 -208 5.70265 0.168
NP_440831.1_1 Forward -309 -290 9.3409 0.29
NP_441786.1_3 Reverse -166 -185 16.4207 0.108
NP_441710.1_9 Forward -175 -156 16.9115 0.0992
NP_441923.1_8 Forward -311 -297 12.1926 0.286
NP_440486.1_7 Forward -313 -295 20.3737 0.12
NP_440486.1_9 Forward -178 -164 17.8958 0.116
NP_440459.1_2 Forward -212 -195 13.0185 0.131
NP_440459.1_2 Reverse -199 -216 11.4452 0.175
NP_440459.1_2 Reverse -157 -174 9.28195 0.23
NP_440010.1_4 Reverse -149 -168 -1.18128 0.267
NP_442603.1_7 Reverse -201 -215 14.9452 0.0563
NP_442603.1_7 Forward -210 -196 13.9619 0.0758
NP_442603.1_7 Reverse -159 -173 10.2254 0.132
NP_441833.1_4 Reverse -160 -167 14.1004 0.0258
NP_441833.1_4 Reverse -202 -209 6.52896 0.0924
NP_441833.1_4 Forward -209 -202 6.23397 0.163
NP_441833.1_4 Forward -167 -160 6.13563 0.198
NP_441329.1_3 Reverse -22 -32 11.5325 0.295
NP_441895.1_10 Reverse -36 -55 -27.6315 0.282
NP_442162.1_9 Forward -209 -202 12.9205 0.0282
NP_442162.1_9 Reverse -202 -209 12.9205 0.0282
NP_442162.1_9 Reverse -160 -167 6.62729 0.142
NP_442162.1_9 Forward -167 -160 6.52896 0.178
NP_440671.1_4 Forward -216 -202 8.75105 0.191
NP_440224.1_1 Forward -221 -202 1.37609 0.132
NP_440772.1_8 Reverse -153 -172 9.24257 0.253
NP_440772.1_8 Forward -185 -166 8.25926 0.259
NP_442140.1_3 Reverse -202 -212 8.23984 0.122
NP_442140.1_3 Forward -209 -199 6.07655 0.184
NP_442723.1_1 Forward -183 -164 3.24359 0.278
NP_440875.1_9 Reverse -203 -213 8.37203 0.233
NP_440875.1_9 Reverse -161 -171 8.37203 0.233
NP_440875.1_9 Reverse -303 -313 7.78801 0.255
NP_441813.1_5 Forward -212 -202 8.4365 0.0432
NP_441813.1_5 Forward -170 -160 8.33817 0.047
NP_441813.1_5 Reverse -157 -167 6.37155 0.0947
NP_441813.1_5 Reverse -199 -209 5.5849 0.118
NP_440594.1_6 Forward -150 -131 5.2102 0.286
NP_442028.1_1 Reverse -13 -26 7.31916 0.292
NP_442089.1_6 Forward -236 -217 4.52268 0.262
NP_440590.1_4 Forward -209 -196 10.934 0.0235
NP_440590.1_4 Reverse -160 -173 9.95071 0.0327
NP_440590.1_4 Reverse -202 -215 3.16588 0.0756
NP_440590.1_4 Reverse -61 -74 -2.24233 0.239
NP_440567.1_1 Forward -209 -195 9.2427 0.0471
NP_442497.1_10 Reverse -160 -169 0.688044 0.141
NP_442497.1_10 Reverse -202 -211 0.589713 0.153
NP_442497.1_10 Forward -167 -158 0.589713 0.153
NP_440821.1_4 Reverse -157 -167 8.53483 0.0468
NP_440821.1_4 Reverse -199 -209 5.78156 0.106
NP_440821.1_4 Forward -212 -202 -0.314959 0.251
NP_440821.1_4 Forward -170 -160 -0.41329 0.257
NP_441239.1_9 Reverse -199 -211 5.54551 0.217
NP_441239.1_9 Forward -312 -300 5.44718 0.221
NP_440400.1_1 Forward -58 -39 0.883656 0.263
NP_440400.1_1 Forward -330 -311 0.392004 0.277
NP_441892.1_1 Reverse -150 -167 -1.73112 0.212
NP_442082.1_2 Reverse -147 -166 7.96345 0.234
NP_442270.1_9 Reverse -148 -167 -11.6036 0.275
NP_441769.1_1 Forward -56 -37 14.8474 0.188
NP_441541.1_1 Reverse -13 -31 -0.28449 0.237
NP_440833.1_6 Reverse -86 -100 7.57046 0.278
NP_441936.1_1 Forward -298 -279 12.0942 0.289
NP_441567.1_4 Forward -95 -76 5.80098 0.281
NP_442138.1_1 Forward -312 -293 -0.29631 0.298
NP_442138.1_10 Forward -168 -149 0.294447 0.14
NP_441782.1_10 Forward -299 -285 14.8818 0.273
NP_442809.1_6 Reverse -300 -319 16.4207 0.0809
NP_442809.1_6 Reverse -354 -373 0.196116 0.295
NP_440546.1_4 Forward -210 -200 12.1791 0.0679
NP_440546.1_4 Forward -168 -158 8.00989 0.209
NP_442041.1_2 Forward -304 -286 16.3421 0.157
NP_441230.1_6 Reverse -277 -296 9.93088 0.282
NP_440462.1_4 Reverse -39 -53 5.89945 0.29
NP_440462.1_6 Reverse -199 -209 6.37155 0.118
NP_440868.1_4 Forward -214 -202 5.44718 0.0977
NP_440868.1_10 Reverse -200 -218 18.0137 0.142
NP_440401.1_9 Forward -45 -38 12.6251 0.287
NP_441582.1_5 Forward -54 -35 4.62021 0.223
NP_441474.1_1 Reverse -149 -168 4.32522 0.221
NP_441474.1_1 Forward -244 -225 -3.44288 0.299
NP_442402.1_4 Reverse -321 -340 -8.75273 0.284
NP_441848.1_7 Forward -241 -222 -2.65624 0.27
NP_440696.1_3 Forward -314 -296 -2.83245 0.279
NP_442039.1_4 Forward -209 -202 11.6422 0.0747
NP_441811.1_8 Reverse -37 -51 6.29277 0.28
NP_440825.1_6 Reverse -312 -331 8.84924 0.285
NP_442696.1_1 Reverse -118 -132 19.7641 0.233
NP_442837.1_3 Reverse -160 -167 6.13563 0.25
NP_442837.1_3 Forward -209 -202 6.0373 0.25
NP_442837.1_3 Reverse -202 -209 6.0373 0.25
NP_442837.1_3 Forward -167 -160 5.93897 0.265
NP_441760.1_7 Forward -319 -301 7.09898 0.297
NP_440160.1_2 Reverse -300 -319 -7.08038 0.283
NP_440160.1_2 Reverse -294 -313 -7.57203 0.286
NP_442053.1_1 Reverse -201 -210 14.4544 0.0114
NP_442053.1_1 Reverse -159 -168 9.34117 0.0666
NP_442053.1_1 Forward -168 -159 8.55452 0.0784
NP_442053.1_1 Forward -210 -201 7.86621 0.0863
NP_440505.1_3 Forward -170 -160 17.0896 0.00449
NP_440505.1_3 Forward -212 -202 16.7946 0.00614
NP_440505.1_3 Reverse -157 -167 6.56821 0.176
NP_442532.1_1 Reverse -1 -15 14.8753 0.215
NP_440914.1_1 Reverse -159 -169 16.032 0.00231
NP_440914.1_1 Reverse -201 -211 13.1043 0.0386
NP_440914.1_1 Forward -210 -200 12.1284 0.0654
NP_440914.1_1 Forward -168 -158 7.83437 0.219
NP_442101.1_10 Forward -176 -157 -7.08038 0.209
NP_442533.1_6 Reverse -159 -168 7.66954 0.0897
NP_442533.1_6 Forward -168 -159 7.37455 0.0898
NP_442533.1_6 Reverse -201 -210 4.42462 0.179
NP_442533.1_6 Forward -303 -294 4.22796 0.186
NP_442533.1_6 Reverse -67 -76 3.53964 0.21
NP_442533.1_6 Reverse -240 -249 2.16301 0.27
NP_442232.1_3 Forward -155 -136 -11.7019 0.282
NP_442322.1_4 Forward -243 -226 -0.0601847 0.21
NP_443016.1_10 Forward -219 -200 9.63589 0.267
NP_441482.1_7 Forward -174 -160 -0.983719 0.0612
NP_441482.1_7 Forward -216 -202 -10.4235 0.209
NP_439944.1_9 Forward -167 -157 17.0896 0.00667
NP_441697.1_5 Forward -24 -5 2.43462 0.178
NP_441697.1_5 Forward -26 -7 -1.76702 0.206
NP_441697.1_5 Forward -25 -6 -6.63711 0.232
NP_441028.1_6 Forward -143 -133 5.38779 0.255
NP_441028.1_6 Forward -81 -71 4.89613 0.275
NP_440116.1_8 Forward -209 -190 16.5191 0.0133
NP_440116.1_8 Reverse -160 -179 -8.35868 0.253
NP_441527.1_4 Reverse -381 -400 -10.2658 0.268
NP_440115.1_6 Forward -213 -203 16.008 0.0325
NP_440115.1_6 Forward -171 -161 16.008 0.0325
NP_440007.1_9 Forward -214 -200 13.6676 0.163
NP_440007.1_9 Reverse -297 -311 6.09611 0.234
NP_441680.1_4 Reverse -296 -315 0.884433 0.246
NP_441059.1_2 Reverse -218 -237 -6.49039 0.265
NP_441961.1_4 Forward -312 -293 5.211 0.27
NP_441602.1_3 Reverse -266 -285 3.83436 0.168
NP_441602.1_3 Forward -209 -190 -4.13045 0.261
NP_441972.1_5 Forward -209 -190 -8.16202 0.258
NP_441972.1_7 Forward -298 -279 15.3382 0.254
NP_441106.1_1 Reverse -158 -167 6.29291 0.0927
NP_441420.1_1 Forward -211 -192 -5.21209 0.292
NP_440646.1_1 Forward -200 -181 1.86774 0.213
NP_442588.1_6 Reverse -162 -181 -1.08219 0.268
NP_441286.1_1 Forward -169 -157 18.8202 0.00418
NP_441286.1_1 Forward -211 -199 11.2487 0.013
NP_441286.1_1 Reverse -158 -170 3.18557 0.0485
NP_441286.1_1 Forward -250 -238 -5.17256 0.192
NP_441286.1_1 Reverse -200 -212 -6.15587 0.251
NP_440670.1_8 Reverse -159 -168 16.5193 0.00214
NP_440670.1_8 Forward -168 -159 9.4395 0.0559
NP_440670.1_8 Forward -210 -201 8.75118 0.0606
NP_440670.1_8 Reverse -201 -210 6.19458 0.124
NP_441930.1_2 Reverse -300 -310 13.0581 0.248
NP_440886.1_7 Reverse -200 -210 6.66608 0.115
NP_440886.1_7 Forward -169 -159 4.01116 0.255
NP_440083.1_9 Reverse -307 -326 11.2603 0.281
NP_442614.1_2 Forward -210 -196 6.19444 0.291
NP_442072.1_9 Forward -211 -193 -22.4986 0.241
NP_442072.1_9 Reverse -158 -176 -23.2853 0.288
NP_442264.1_2 Reverse -155 -172 5.34871 0.277
NP_441021.1_1 Forward -242 -223 -10.3253 0.234
NP_442459.1_8 Reverse -235 -254 8.75091 0.259
NP_441463.1_1 Reverse -43 -61 10.3439 0.273
NP_441463.1_3 Reverse -149 -168 5.89931 0.0683
NP_441463.1_3 Reverse -245 -264 -5.9004 0.235
NP_440501.1_2 Reverse -40 -59 10.7175 0.215
NP_441626.1_2 Forward -209 -202 12.2322 0.0511
NP_441626.1_2 Forward -167 -160 6.0373 0.212
NP_441626.1_2 Reverse -160 -167 6.0373 0.212
NP_441626.1_2 Reverse -202 -209 5.93897 0.231
NP_442365.1_7 Forward -172 -153 -1.86883 0.196
NP_442794.1_1 Forward -214 -202 10.2654 0.0721
NP_442794.1_1 Forward -172 -160 10.1671 0.0721
NP_442794.1_1 Reverse -245 -257 3.18557 0.286
NP_442794.1_1 Reverse -197 -209 2.49725 0.288
NP_440387.1_1 Reverse -159 -175 -6.03799 0.262
NP_440855.1_5 Forward -311 -292 4.81688 0.285
NP_441431.1_2 Reverse -291 -305 7.86545 0.231
NP_441488.1_7 Reverse -132 -151 2.16274 0.274
NP_441488.1_8 Forward -215 -201 19.0751 0.0356
NP_441993.1_1 Reverse -195 -214 4.57804 0.217
NP_441993.1_1 Forward -309 -290 3.01872 0.244
NP_440358.1_8 Reverse -171 -190 -1.96717 0.29
NP_442437.1_3 Reverse -161 -180 20.3531 0.083
NP_442323.1_7 Forward -215 -196 1.6703 0.278
NP_440754.1_2 Forward -392 -373 18.0924 0.243
NP_440766.1_4 Forward -214 -200 3.34284 0.15
NP_441421.1_6 Forward -28 -11 11.9886 0.277
NP_441237.1_6 Forward -303 -286 2.30045 0.291
NP_441237.1_9 Forward -209 -199 11.7798 0.156
NP_442867.1_8 Reverse -280 -299 4.32602 0.284
NP_440457.1_1 Forward -214 -202 9.87208 0.092
NP_440457.1_1 Forward -172 -160 0.530633 0.25
NP_440798.1_6 Forward -75 -62 0.215946 0.278
NP_440801.1_9 Forward -317 -303 15.3562 0.227
NP_440801.1_10 Forward -214 -195 5.11266 0.289
NP_441984.1_3 Reverse -283 -301 4.83737 0.3
NP_440054.1_4 Reverse -339 -358 10.9142 0.232
NP_441436.1_2 Reverse -159 -178 -6.58872 0.296
NP_442509.1_9 Forward -249 -239 8.43603 0.192
NP_442509.1_9 Reverse -159 -169 8.04271 0.192
NP_442514.1_5 Reverse -286 -305 0.293673 0.178
NP_440554.1_4 Reverse -202 -212 5.97822 0.128
NP_442737.1_5 Forward -169 -150 15.4968 0.166
NP_441885.1_5 Forward -168 -158 11.3864 0.00668
NP_441885.1_5 Reverse -159 -169 11.1898 0.00775
NP_441885.1_5 Forward -210 -200 9.51814 0.0206
NP_441885.1_5 Forward -363 -353 4.40493 0.0736
NP_441885.1_5 Reverse -201 -211 1.25834 0.11
NP_441885.1_5 Forward -69 -59 -0.609952 0.215
NP_440478.1_4 Forward -214 -195 17.994 0.072
NP_440478.1_4 Reverse -197 -216 15.6341 0.141
NP_442341.1_7 Forward -211 -197 7.17775 0.11
NP_442341.1_7 Reverse -158 -172 2.06454 0.271
NP_442341.1_9 Forward -312 -298 5.60385 0.263
NP_441756.1_5 Reverse -197 -216 -3.83545 0.29
NP_442395.2_4 Reverse -200 -219 2.6536 0.22
NP_440423.1_6 Reverse -151 -170 -6.58872 0.138
NP_443000.1_7 Forward -212 -202 10.2065 0.0355
NP_443000.1_7 Forward -170 -160 10.1081 0.0376
NP_443000.1_7 Reverse -157 -167 7.35486 0.0859
NP_440275.1_3 Forward -212 -202 12.5664 0.0316
NP_440275.1_3 Forward -170 -160 5.48657 0.145
NP_440275.1_3 Reverse -157 -167 5.28991 0.158
NP_440091.1_1 Reverse -155 -167 14.592 0.0245
NP_442275.1_1 Reverse -284 -303 2.55606 0.284
NP_440175.1_7 Forward -169 -151 12.6812 0.208
NP_440149.1_8 Forward -168 -149 -2.85214 0.176
NP_441875.1_3 Reverse -293 -312 19.2715 0.225
NP_441105.1_3 Forward -221 -202 1.67108 0.111
NP_441105.1_3 Forward -320 -301 -7.27704 0.25
NP_440216.1_1 Reverse -159 -173 -0.197071 0.0284
NP_440216.1_1 Reverse -201 -215 -2.85201 0.0608
NP_440216.1_1 Forward -168 -154 -11.7018 0.212
NP_440216.1_1 Forward -76 -62 -12.5868 0.288
NP_440216.1_9 Reverse -308 -317 8.25953 0.286
NP_440172.1_1 Forward -210 -200 6.27322 0.107
NP_440172.1_1 Reverse -159 -169 5.48657 0.143
NP_440172.1_1 Forward -168 -158 5.19158 0.149
NP_440172.1_1 Reverse -201 -211 2.24165 0.279
NP_440249.1_2 Forward -325 -315 16.4008 0.194
NP_442015.1_10 Forward -172 -159 18.3088 0.00686
NP_442015.1_10 Forward -256 -243 3.5592 0.179
NP_442015.1_10 Forward -214 -201 1.88757 0.204
NP_441226.1_7 Forward -209 -202 12.7234 0.0312
NP_441226.1_7 Reverse -202 -209 11.5435 0.0757
NP_441111.1_7 Reverse -160 -168 8.96754 0.0463
NP_441111.1_7 Reverse -202 -210 8.86921 0.0589
NP_441111.1_7 Forward -167 -159 8.86921 0.0589
NP_441766.1_2 Reverse -201 -210 14.7494 0.00772
NP_441766.1_2 Reverse -159 -168 7.86621 0.0703
NP_441766.1_2 Forward -168 -159 7.66954 0.0723
NP_442417.1_5 Reverse -201 -215 6.48943 0.219
NP_440416.1_9 Forward -259 -240 -15.5368 0.193
NP_440416.1_9 Forward -217 -198 -18.2901 0.256
NP_443052.1_9 Reverse -190 -209 -6.09707 0.276
NP_440820.2_4 Reverse -130 -149 12.2908 0.123
NP_442116.1_6 Forward -34 -17 15.8083 0.129
NP_442116.1_6 Forward -35 -18 7.02305 0.266
NP_442116.1_6 Reverse -18 -35 5.49518 0.296
NP_442403.1_8 Forward -262 -243 1.0811 0.241
NP_442154.1_1 Forward -224 -206 -17.4838 0.257
NP_440261.1_5 Reverse -160 -173 -2.93064 0.0983
NP_440261.1_5 Reverse -202 -215 -3.02898 0.108
NP_440988.1_10 Reverse -199 -213 14.6769 0.131
NP_440988.1_10 Reverse -205 -219 8.09365 0.205
NP_440988.1_10 Reverse -157 -171 5.77014 0.24
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

TTGCTTCTTTGGTGGGTTTTATAACTCTCTTTGGTGTGGCTGTCCGTAATGGCTTATTGCTGGTGGATAACTACAATCAAAAATTTGCCCTGGCATTGCCCTTGGCCCAGGTAGTCCAGGAAGGTTCCCAGGAACGATTAGTCGCCATTTTGATGACCGCCCTCACTTCCGCCCTTGGTATGCTTCCCCTGGCGATCGGGACTGGAGCCGGGAAGGAAATTCTCCAACCCCTGGCGATCGTCATTTTGGGGGGATTGTTTACCTCCACCGCTTTAACTCTACTGGTATTACCAGCTTTATATGCTCAATTTGGACGGTTTTTACGTCCATCGGCTAGCGTTACTACTCCAGCATCAACCCCCATTAATGTTCTGACAAAAGTTTAAATTTTAATTTATTT

CDS

ATGAAGTTCTCAATCCCCACCAATCCTGTTATCCTTCTACTCATAGTTTTTCTGCTCAATGCCTGTGGTAATCAAACTTCGCCAACAGATATTTCCGTTAGTCCGACCCCGACTCCTACCGTTTCTCCTACAGAAAATGTTGAGGAGAATAAAACTGAATCCCATGGAGGCCAGGGAGGACAGGTAATTGAAATGGGGGATTACCATTTAGAATTACTTTCCATTAAAGAAGCTGGCGGTTTCCATCTTGACTTTTACCTACAAAAAGGAGTTGACCATAGCCCCATTACTAATGCCATTGTGACCGGTAAAGTTCAATTACCCGATGGTACTCAACAAGACATTAACTTTAAATATAGCGATCAAGACAAACACTATACTGCCCTTCTTTCTACTCAGGTACCAGGGGATTATAAACTGGCGATTTTAAGTGATATTAACGGCGAAAAAGTCAATGGAAGATTCAGTTTTAGCTTTTGA

Protein

No sequence available