Your browser is old and dusty. Try Google Chrome!

Details for slr6042

ORF slr6042
Accession NP_942485.1
Symbol
Category
Definition
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_442711.1_1 Reverse -166 -180 15.4376 0.104
NP_441061.1_2 Forward -192 -178 8.55439 0.0865
NP_441061.1_2 Forward -174 -160 6.48943 0.117
NP_441061.1_2 Reverse -201 -215 5.99778 0.126
NP_441061.1_2 Reverse -178 -192 0.687908 0.202
NP_441061.1_2 Forward -180 -166 0.196253 0.215
NP_441061.1_2 Forward -186 -172 -1.08205 0.249
NP_441061.1_2 Reverse -367 -381 -2.26202 0.287
NP_440795.1_7 Forward -174 -167 14.6904 0.0123
NP_440795.1_7 Reverse -167 -174 14.6904 0.0123
NP_441418.1_6 Reverse -166 -185 -18.7818 0.0837
NP_441418.1_6 Forward -187 -168 -21.1417 0.139
NP_441418.1_6 Forward -175 -156 -21.24 0.143
NP_440897.1_6 Reverse -223 -242 0.883656 0.175
NP_441453.1_1 Reverse -159 -177 3.8533 0.263
NP_441453.1_4 Reverse -166 -174 16.539 0.00633
NP_441453.1_4 Forward -175 -167 16.539 0.00633
NP_442151.1_6 Forward -187 -173 9.43936 0.148
NP_442151.1_6 Reverse -166 -180 7.17775 0.206
NP_442151.1_6 Forward -175 -161 6.6861 0.224
NP_441818.1_1 Forward -174 -163 9.69459 0.232
NP_440226.1_1 Reverse -166 -185 5.80098 0.145
NP_440226.1_1 Forward -175 -156 5.70265 0.148
NP_442655.1_1 Reverse -161 -180 -1.18052 0.261
NP_442173.1_1 Forward -174 -166 15.4574 0.00633
NP_442173.1_1 Reverse -167 -175 15.4574 0.00633
NP_442752.1_4 Forward -175 -168 13.8055 0.0199
NP_442752.1_4 Reverse -166 -173 13.8055 0.0199
NP_442752.1_4 Forward -209 -202 9.47889 0.109
NP_443027.1_4 Reverse -164 -174 14.828 0.0437
NP_443027.1_4 Forward -177 -167 13.2547 0.0521
NP_443027.1_4 Forward -315 -305 6.17489 0.289
NP_441812.1_3 Forward -176 -162 7.9644 0.254
NP_442975.1_10 Reverse -162 -176 13.7653 0.0459
NP_441675.1_4 Reverse -238 -257 2.94938 0.286
NP_440784.1_7 Forward -174 -167 15.9687 0.0123
NP_440784.1_7 Reverse -167 -174 15.9687 0.0123
NP_440061.1_9 Reverse -164 -178 10.2254 0.126
NP_441476.1_5 Reverse -173 -192 0.884433 0.19
NP_442062.1_8 Forward -175 -165 19.4496 0.000558
NP_442062.1_8 Reverse -166 -176 10.3048 0.0493
NP_442062.1_8 Forward -187 -177 3.12662 0.285
NP_440761.1_4 Reverse -161 -180 -4.42544 0.132
NP_441859.1_3 Reverse -165 -184 3.04693 0.25
NP_440304.1_4 Forward -177 -167 10.8948 0.051
NP_440304.1_4 Reverse -164 -174 10.8948 0.051
NP_440304.1_4 Reverse -176 -186 5.97822 0.185
NP_442242.1_4 Forward -174 -167 14.3954 0.0124
NP_442242.1_4 Reverse -167 -174 14.3954 0.0124
NP_441781.1_7 Forward -193 -174 3.83436 0.188
NP_439918.1_2 Forward -198 -179 6.68596 0.154
NP_441200.1_8 Reverse -176 -195 15.7056 0.289
NP_441208.1_9 Forward -178 -164 6.09611 0.253
NP_442110.1_7 Reverse -166 -180 12.0943 0.0586
NP_442110.1_7 Forward -193 -179 -0.492064 0.291
NP_440273.1_3 Forward -204 -185 9.93088 0.19
NP_440856.1_4 Forward -182 -163 13.2741 0.0346
NP_441083.1_5 Forward -175 -165 11.3864 0.0159
NP_441083.1_5 Reverse -166 -176 11.2881 0.0159
NP_442827.1_8 Reverse -158 -177 -1.27961 0.245
NP_441434.1_3 Reverse -182 -201 -2.0655 0.262
NP_441738.1_2 Forward -173 -166 15.28 0.0102
NP_441738.1_2 Reverse -168 -175 15.28 0.0102
NP_440209.1_1 Reverse -166 -174 18.1123 0.00295
NP_440209.1_1 Forward -175 -167 18.1123 0.00295
NP_442889.1_1 Forward -193 -174 7.86593 0.108
NP_442889.1_8 Reverse -163 -177 4.03056 0.27
NP_441713.1_1 Forward -181 -162 -8.16202 0.145
NP_441713.1_1 Reverse -160 -179 -14.9469 0.26
NP_442570.1_3 Forward -195 -176 -2.36049 0.212
NP_442570.1_3 Reverse -175 -194 -6.98204 0.265
NP_442462.1_2 Reverse -77 -96 10.0292 0.172
NP_441792.1_5 Reverse -274 -290 11.5633 0.19
NP_442111.1_4 Reverse -165 -179 13.4709 0.0383
NP_442111.1_4 Reverse -233 -247 2.5562 0.271
NP_440343.1_3 Reverse -191 -209 18.4062 0.0832
NP_440906.1_5 Forward -174 -167 15.8704 0.0124
NP_440906.1_5 Reverse -167 -174 15.8704 0.0124
NP_440747.1_10 Forward -178 -166 17.1486 0.000663
NP_440747.1_10 Reverse -163 -175 -2.02597 0.0196
NP_440747.1_10 Forward -190 -178 -2.91095 0.0732
NP_440747.1_10 Reverse -197 -209 -12.4491 0.282
NP_441130.1_10 Reverse -164 -178 10.521 0.112
NP_441854.1_10 Reverse -164 -183 0.982764 0.282
NP_442973.1_5 Reverse -295 -314 11.7992 0.226
NP_441486.1_1 Reverse -163 -177 4.91614 0.0399
NP_441486.1_1 Forward -178 -164 -6.39192 0.294
NP_442634.1_4 Forward -177 -163 7.07942 0.0479
NP_442634.1_4 Reverse -164 -178 -1.18038 0.149
NP_442634.1_4 Forward -290 -276 -5.90027 0.284
NP_441014.1_8 Reverse -153 -172 -9.83364 0.299
NP_442848.1_1 Forward -145 -131 0.589577 0.263
NP_441012.1_4 Reverse -180 -193 9.2624 0.272
NP_443018.1_3 Forward -174 -167 14.8871 0.0123
NP_443018.1_3 Reverse -167 -174 14.8871 0.0123
NP_443018.1_3 Forward -186 -179 10.7572 0.0907
NP_443018.1_3 Reverse -179 -186 4.56234 0.241
NP_441316.1_7 Reverse -164 -179 6.46974 0.107
NP_441634.1_8 Forward -177 -163 5.30946 0.114
NP_440376.1_1 Forward -175 -166 19.4693 0.000692
NP_440376.1_1 Reverse -166 -175 19.4693 0.000692
NP_440376.1_1 Forward -209 -200 0.688044 0.262
NP_441588.1_4 Forward -173 -163 6.96153 0.178
NP_442687.1_7 Reverse -165 -175 15.8113 0.0125
NP_442687.1_7 Forward -176 -166 9.02648 0.0994
NP_442687.1_7 Forward -347 -337 4.3066 0.255
NP_441846.1_10 Forward -210 -191 -22.42 0.259
NP_441846.1_10 Forward -217 -198 -23.5016 0.289
NP_442088.1_5 Reverse -43 -62 17.3057 0.225
NP_442583.1_8 Reverse -167 -186 18.584 0.0979
NP_440642.1_10 Reverse -341 -355 5.50552 0.241
NP_441422.1_7 Reverse -164 -181 -1.73112 0.194
NP_440533.1_9 Reverse -166 -185 7.57094 0.185
NP_442296.1_9 Forward -352 -333 -3.63879 0.256
NP_441763.1_10 Reverse -155 -174 16.5182 0.0904
NP_441763.1_10 Forward -186 -167 5.30853 0.291
NP_442658.1_1 Reverse -164 -174 15.9091 0.00966
NP_442658.1_1 Forward -177 -167 14.2375 0.0237
NP_442658.1_1 Reverse -176 -186 12.3692 0.0569
NP_442782.1_2 Reverse -166 -180 11.111 0.173
NP_442782.1_2 Reverse -178 -192 3.34284 0.265
NP_442544.1_6 Forward -182 -163 -8.35868 0.298
NP_441414.1_9 Forward -175 -156 -3.44213 0.136
NP_441317.1_4 Forward -256 -242 10.8963 0.27
NP_441958.1_5 Forward -176 -166 21.2195 0.000805
NP_441958.1_5 Reverse -165 -175 12.2714 0.00183
NP_440203.1_5 Forward -184 -174 14.3359 0.0886
NP_439990.1_5 Forward -180 -167 10.7374 0.128
NP_439990.1_5 Reverse -161 -174 6.70579 0.223
NP_442911.1_2 Forward -197 -178 -1.57384 0.0871
NP_442911.1_2 Reverse -156 -175 -1.67217 0.0886
NP_442911.1_2 Forward -185 -166 -2.55715 0.0995
NP_441580.1_6 Forward -186 -167 3.93269 0.117
NP_440993.1_3 Forward -185 -166 5.70185 0.149
NP_440993.1_4 Forward -187 -170 2.69378 0.298
NP_440138.1_6 Reverse -179 -198 11.2084 0.145
NP_440138.1_6 Forward -380 -361 0.883656 0.291
NP_441099.1_5 Forward -185 -166 10.4225 0.0295
NP_442002.1_1 Forward -298 -280 2.18243 0.173
NP_442002.1_1 Forward -218 -200 -8.83064 0.272
NP_442002.1_9 Reverse -165 -172 10.7572 0.185
NP_440809.1_9 Forward -184 -166 -7.94566 0.225
NP_441294.1_7 Forward -172 -158 10.9784 0.161
NP_441646.1_1 Reverse -171 -190 2.16274 0.221
NP_441646.1_1 Forward -193 -174 -1.08219 0.278
NP_442438.1_10 Forward -180 -166 2.75286 0.168
NP_442438.1_10 Reverse -161 -175 1.57289 0.191
NP_442413.1_6 Reverse -180 -198 17.6204 0.119
NP_441000.1_6 Forward -176 -162 -3.34366 0.221
NP_441000.1_6 Reverse -165 -179 -4.03198 0.225
NP_440147.1_4 Reverse -164 -177 10.4424 0.0355
NP_440147.1_4 Forward -177 -164 8.9674 0.0448
NP_440147.1_4 Reverse -71 -84 4.14919 0.171
NP_440147.1_4 Reverse -176 -189 -0.767364 0.299
NP_441550.1_8 Forward -177 -167 15.8108 0.0132
NP_441550.1_8 Reverse -164 -174 6.0761 0.214
NP_441916.1_7 Reverse -166 -176 18.9579 0.00144
NP_441916.1_7 Forward -175 -165 18.4663 0.00144
NP_441916.1_10 Forward -354 -335 4.12936 0.223
NP_440465.1_10 Reverse -222 -241 1.76941 0.275
NP_441041.1_4 Reverse -166 -185 10.8159 0.0272
NP_441041.1_4 Forward -145 -126 -8.94866 0.209
NP_441041.1_4 Reverse -280 -299 -10.817 0.237
NP_441041.1_4 Forward -175 -156 -10.9153 0.238
NP_441041.1_7 Forward -178 -166 13.3454 0.0485
NP_441041.1_7 Reverse -163 -175 10.916 0.0864
NP_442396.1_5 Reverse -162 -175 6.90245 0.215
NP_442004.1_6 Reverse -166 -180 7.27608 0.161
NP_441725.1_4 Forward -180 -166 22.025 0.00544
NP_441725.1_5 Forward -174 -164 11.2881 0.0247
NP_441725.1_5 Forward -186 -176 7.64985 0.0904
NP_441725.1_5 Reverse -167 -177 1.94665 0.115
NP_439966.1_7 Reverse -164 -174 18.4657 0.00473
NP_439966.1_7 Forward -177 -167 14.3359 0.0203
NP_439966.1_7 Reverse -198 -208 4.69947 0.263
NP_439966.1_9 Reverse -164 -173 0.983037 0.253
NP_442941.1_3 Reverse -167 -177 19.2529 0.00262
NP_442941.1_3 Forward -174 -164 11.4848 0.0116
NP_442941.1_5 Reverse -121 -135 15.1934 0.27
NP_440289.1_2 Reverse -163 -176 14.5723 0.0107
NP_440289.1_2 Forward -178 -165 -3.52063 0.267
NP_440260.1_8 Forward -292 -274 -5.09406 0.273
NP_440260.1_8 Forward -202 -184 -6.76569 0.295
NP_442281.1_1 Forward -180 -166 15.2402 0.0132
NP_442281.1_1 Reverse -173 -187 12.0937 0.0409
NP_442281.1_1 Reverse -161 -175 11.012 0.0511
NP_442281.1_1 Reverse -275 -289 5.21053 0.166
NP_440018.1_3 Reverse -82 -101 7.66927 0.209
NP_440437.1_1 Forward -181 -162 -2.45882 0.219
NP_440647.1_9 Forward -177 -159 4.9357 0.23
NP_442012.1_1 Forward -240 -221 0.196116 0.244
NP_441556.1_4 Reverse -169 -188 13.2829 0.201
NP_441556.1_4 Forward -184 -165 9.61947 0.297
NP_440498.1_1 Forward -184 -166 1.59244 0.204
NP_440453.1_7 Forward -176 -157 14.6508 0.238
NP_441644.1_6 Reverse -166 -176 19.0557 0.000803
NP_441644.1_6 Forward -175 -165 10.1076 0.0628
NP_441644.1_6 Forward -313 -303 5.68278 0.18
NP_441644.1_6 Reverse -178 -188 3.91283 0.256
NP_442501.1_2 Reverse -189 -208 0.0977854 0.222
NP_442215.1_2 Forward -189 -173 3.59845 0.094
NP_440253.1_2 Forward -175 -157 4.44404 0.104
NP_440929.1_8 Forward -175 -166 19.2726 0.000701
NP_440929.1_8 Reverse -166 -175 19.2726 0.000701
NP_442933.1_10 Forward -175 -166 17.601 0.00325
NP_442933.1_10 Reverse -166 -175 17.601 0.00325
NP_441751.2_8 Reverse -167 -181 5.21113 0.0448
NP_441751.2_8 Forward -174 -160 3.14618 0.0713
NP_442926.1_3 Forward -186 -167 11.1109 0.128
NP_442926.1_3 Reverse -167 -186 10.0292 0.139
NP_442554.1_8 Reverse -167 -177 17.2863 0.00543
NP_442554.1_8 Forward -174 -164 13.8447 0.0145
NP_442554.1_8 Forward -186 -176 3.91327 0.203
NP_442554.1_8 Reverse -179 -189 2.63497 0.265
NP_441762.1_7 Forward -176 -164 2.98891 0.0676
NP_441762.1_7 Reverse -165 -177 2.30059 0.0676
NP_442142.1_4 Reverse -163 -176 16.4399 0.0264
NP_442142.1_4 Forward -178 -165 15.4566 0.0264
NP_442292.1_1 Reverse -167 -176 17.5026 0.00435
NP_442292.1_1 Forward -174 -165 9.63616 0.0183
NP_442292.1_1 Reverse -9 -18 3.44131 0.198
NP_442476.1_6 Reverse -167 -181 2.45787 0.183
NP_442381.1_8 Reverse -163 -182 -12.8819 0.267
NP_443009.1_5 Forward -176 -165 19.626 0.00102
NP_443009.1_5 Reverse -165 -176 7.82632 0.118
NP_441715.1_4 Reverse -167 -177 16.7946 0.0106
NP_441715.1_4 Forward -174 -164 16.303 0.0117
NP_440279.1_2 Forward -198 -179 17.994 0.0479
NP_441198.1_8 Reverse -272 -282 12.0017 0.167
NP_441198.1_8 Reverse -176 -186 10.6345 0.254
NP_440379.1_5 Forward -190 -171 -11.2103 0.291
NP_441468.1_1 Forward -174 -167 15.8704 0.0124
NP_441468.1_1 Reverse -167 -174 15.8704 0.0124
NP_441468.1_1 Reverse -179 -186 4.07068 0.263
NP_441618.1_7 Reverse -258 -277 15.5439 0.295
NP_441020.2_6 Reverse -164 -181 7.70866 0.222
NP_441673.1_1 Forward -175 -166 20.8459 0.000698
NP_441673.1_1 Reverse -166 -175 20.8459 0.000698
NP_442253.1_5 Reverse -219 -236 -2.91109 0.284
NP_441330.1_1 Forward -318 -299 -13.6686 0.198
NP_442490.1_9 Reverse -166 -185 -5.01543 0.273
NP_442490.1_9 Forward -187 -168 -7.17871 0.275
NP_442868.1_6 Forward -177 -167 10.4031 0.038
NP_442868.1_6 Reverse -164 -174 0.963343 0.205
NP_441251.1_7 Forward -399 -386 10.2457 0.288
NP_441251.1_8 Reverse -239 -252 11.2343 0.27
NP_441056.1_1 Reverse -166 -185 -6.98204 0.271
NP_441056.1_1 Forward -187 -168 -9.34199 0.299
NP_442227.1_2 Reverse -208 -227 -0.295539 0.253
NP_442361.1_3 Forward -361 -348 8.67241 0.285
NP_442808.1_1 Reverse -165 -175 18.4657 0.00201
NP_442808.1_1 Forward -176 -166 8.73102 0.0481
NP_442692.1_1 Forward -185 -166 -3.93378 0.274
NP_440145.1_3 Forward -185 -166 -6.1954 0.292
NP_442542.1_9 Reverse -159 -173 6.68548 0.227
NP_442050.1_5 Forward -177 -167 15.9091 0.0091
NP_442050.1_5 Reverse -164 -174 9.12434 0.193
NP_442050.1_8 Reverse -160 -179 16.1275 0.272
NP_441114.1_3 Forward -185 -176 17.1093 0.113
NP_441114.1_3 Reverse -281 -290 7.66954 0.231
NP_440558.1_2 Forward -184 -165 8.35759 0.113
NP_440558.1_2 Forward -190 -171 2.94938 0.164
NP_440558.1_2 Forward -196 -177 -4.72043 0.248
NP_440558.1_2 Reverse -168 -187 -6.88371 0.283
NP_440558.1_2 Reverse -270 -289 -7.4737 0.294
NP_441878.1_6 Forward -176 -166 10.5014 0.0176
NP_441878.1_6 Reverse -165 -175 10.4031 0.0176
NP_441878.1_6 Reverse -177 -187 2.33998 0.0405
NP_441878.1_6 Reverse -222 -232 -7.59145 0.245
NP_441036.1_8 Reverse -165 -175 17.7779 0.000554
NP_441036.1_8 Forward -176 -166 15.713 0.00724
NP_441557.1_5 Forward -175 -166 19.9609 0.000699
NP_441557.1_5 Reverse -166 -175 19.9609 0.000699
NP_441557.1_8 Reverse -345 -355 11.9759 0.236
NP_442066.2_9 Reverse -162 -175 9.36073 0.175
NP_442777.1_1 Reverse -345 -364 8.75009 0.208
NP_441308.1_8 Reverse -164 -174 10.1081 0.22
NP_440101.1_3 Reverse -161 -180 0.58944 0.297
NP_440101.1_5 Reverse -159 -178 2.55606 0.219
NP_442183.1_1 Forward -175 -161 13.4709 0.0423
NP_442183.1_1 Reverse -166 -180 7.17775 0.147
NP_442166.1_7 Reverse -167 -181 12.3893 0.175
NP_441574.1_1 Reverse -166 -185 0.0977854 0.196
NP_441549.1_9 Reverse -162 -180 -5.48739 0.198
NP_442347.1_2 Forward -174 -165 11.1111 0.056
NP_442347.1_2 Reverse -167 -176 3.34298 0.284
NP_442645.1_2 Forward -195 -176 -7.37537 0.106
NP_442645.1_2 Forward -183 -164 -22.125 0.29
NP_441037.1_4 Forward -177 -167 7.22024 0.237
NP_441037.1_4 Reverse -164 -174 7.02532 0.237
NP_441037.1_4 Reverse -176 -186 6.44058 0.263
NP_442594.1_8 Forward -157 -138 9.0459 0.2
NP_441633.1_3 Forward -177 -164 3.5592 0.0699
NP_441633.1_3 Reverse -164 -177 -3.81562 0.177
NP_441633.1_3 Forward -189 -176 -4.30728 0.191
NP_440136.1_2 Forward -174 -167 15.9687 0.0123
NP_440136.1_2 Reverse -167 -174 15.9687 0.0123
NP_442590.1_5 Forward -128 -109 21.6061 0.0956
NP_442590.1_10 Reverse -159 -178 5.01433 0.267
NP_442590.1_10 Reverse -194 -213 4.52268 0.274
NP_442590.1_10 Reverse -160 -179 3.14605 0.295
NP_442998.1_5 Reverse -246 -256 7.94484 0.278
NP_442998.1_10 Forward -173 -166 15.5754 0.0102
NP_442998.1_10 Reverse -168 -175 15.5754 0.0102
NP_440299.1_1 Forward -179 -166 11.1301 0.0518
NP_440299.1_1 Forward -191 -178 4.14862 0.217
NP_440299.1_1 Reverse -162 -175 2.18201 0.294
NP_441799.1_1 Reverse -162 -176 11.9953 0.0487
NP_441799.1_1 Forward -179 -165 10.3237 0.0756
NP_441007.1_10 Forward -180 -167 3.26421 0.182
NP_440256.1_1 Reverse -163 -182 4.12936 0.0466
NP_440256.1_1 Forward -178 -159 2.85105 0.0589
NP_441362.1_4 Forward -400 -382 9.55725 0.219
NP_441559.1_8 Forward -180 -166 11.0127 0.0574
NP_441559.1_8 Reverse -161 -175 -6.29359 0.276
NP_440915.1_6 Forward -179 -165 10.6193 0.0301
NP_440915.1_6 Reverse -162 -176 5.80112 0.0879
NP_440748.1_5 Forward -184 -165 14.0608 0.0971
NP_440026.1_4 Forward -178 -159 10.2259 0.239
NP_440695.1_5 Reverse -166 -185 7.07928 0.15
NP_440695.1_5 Forward -187 -168 -1.37718 0.284
NP_441939.1_3 Reverse -167 -186 14.2574 0.0777
NP_441494.1_6 Forward -180 -167 8.77074 0.227
NP_442993.1_1 Forward -175 -159 19.0364 0.00415
NP_442386.1_9 Reverse -165 -174 15.7322 0.0144
NP_442386.1_9 Forward -176 -167 6.39082 0.219
NP_441340.1_5 Forward -174 -167 15.6737 0.0124
NP_441340.1_5 Reverse -167 -174 15.6737 0.0124
NP_441340.1_5 Forward -186 -179 3.97235 0.274
NP_441271.1_3 Reverse -195 -213 14.6697 0.143
NP_441947.1_4 Reverse -155 -174 12.0942 0.236
NP_442484.1_2 Forward -186 -167 10.4225 0.115
NP_442484.1_2 Reverse -167 -186 2.65439 0.223
NP_442240.1_1 Forward -112 -93 5.30853 0.264
NP_442240.1_1 Forward -99 -80 4.03023 0.275
NP_442240.1_2 Reverse -305 -324 -5.9004 0.11
NP_442240.1_2 Reverse -167 -186 -19.9617 0.295
NP_440161.1_3 Forward -177 -158 13.9625 0.126
NP_442950.1_6 Reverse -192 -211 6.88262 0.27
NP_440586.1_1 Forward -356 -337 -1.67217 0.239
NP_440586.1_8 Forward -174 -167 13.2151 0.026
NP_440586.1_8 Reverse -167 -174 13.2151 0.026
NP_440586.1_8 Forward -312 -305 7.51192 0.239
NP_442251.1_6 Forward -174 -167 15.2804 0.0124
NP_442251.1_6 Reverse -167 -174 15.2804 0.0124
NP_441262.1_3 Reverse -166 -173 14.7888 0.0223
NP_441262.1_3 Forward -175 -168 14.7888 0.0223
NP_440027.1_8 Reverse -163 -182 14.8466 0.154
NP_443051.1_1 Forward -176 -167 19.5676 0.00335
NP_443051.1_1 Reverse -165 -174 10.4228 0.00754
NP_441232.1_10 Forward -186 -167 0.58944 0.296
NP_439937.1_8 Forward -357 -338 -0.787193 0.242
NP_439937.1_8 Reverse -164 -183 -4.6221 0.286
NP_439937.1_9 Reverse -165 -182 -8.61494 0.176
NP_442294.1_3 Forward -260 -246 12.487 0.283
NP_443039.1_7 Reverse -274 -288 7.47213 0.19
NP_440408.1_7 Reverse -166 -185 13.0775 0.196
NP_440408.1_7 Forward -295 -276 8.16093 0.282
NP_440408.1_7 Forward -209 -190 7.17762 0.291
NP_440439.1_1 Forward -178 -165 18.1122 0.0105
NP_440439.1_1 Reverse -163 -176 8.08242 0.0559
NP_439943.1_1 Reverse -298 -317 -2.65548 0.202
NP_439943.1_7 Forward -192 -173 3.73603 0.29
NP_440372.1_2 Forward -174 -167 16.3621 0.0124
NP_440372.1_2 Reverse -167 -174 16.3621 0.0124
NP_440171.1_3 Forward -238 -219 4.71934 0.284
NP_441789.1_7 Reverse -134 -153 -1.8696 0.257
NP_440316.1_10 Reverse -177 -187 6.96153 0.251
NP_441803.1_2 Forward -180 -161 0.58944 0.249
NP_439977.1_5 Forward -181 -162 3.83436 0.157
NP_439977.1_5 Forward -193 -174 1.96607 0.183
NP_439977.1_5 Reverse -160 -179 0.687771 0.205
NP_441572.1_7 Forward -181 -162 -4.03212 0.224
NP_442549.1_3 Reverse -167 -186 12.5858 0.169
NP_442384.1_10 Reverse -166 -179 18.8988 0.00338
NP_442384.1_10 Forward -175 -162 6.50913 0.0995
NP_440472.1_1 Forward -113 -94 13.2733 0.265
NP_442790.1_4 Reverse -157 -176 -6.1954 0.144
NP_442262.1_10 Forward -174 -167 14.1988 0.0123
NP_442262.1_10 Reverse -167 -174 14.1988 0.0123
NP_442262.1_10 Forward -186 -179 9.87221 0.164
NP_441689.1_5 Reverse -164 -174 8.53436 0.132
NP_441689.1_5 Forward -177 -167 8.3377 0.132
NP_440163.1_10 Reverse -163 -173 15.2213 0.0762
NP_440163.1_10 Forward -292 -282 11.1898 0.171
NP_440344.1_10 Forward -182 -165 1.90713 0.0294
NP_440344.1_10 Reverse -159 -176 1.21881 0.0311
NP_440344.1_10 Forward -216 -199 -11.6625 0.223
NP_440344.1_10 Reverse -171 -188 -12.6459 0.261
NP_440282.1_3 Reverse -167 -186 -1.7705 0.298
NP_440282.1_10 Forward -185 -166 -7.4737 0.251
NP_440562.1_1 Reverse -181 -200 10.815 0.276
NP_441965.1_10 Reverse -163 -179 8.71166 0.123
NP_441965.1_10 Forward -343 -327 3.30346 0.266
NP_442693.1_7 Forward -210 -191 12.0942 0.211
NP_440297.1_9 Forward -174 -164 9.32148 0.0917
NP_440297.1_9 Forward -186 -176 7.35486 0.126
NP_440297.1_9 Reverse -167 -177 -0.216628 0.282
NP_440350.1_1 Reverse -343 -362 -4.91709 0.264
NP_442280.1_10 Forward -190 -172 4.67522 0.296
NP_441896.1_3 Reverse -157 -176 5.70265 0.118
NP_440894.1_10 Reverse -161 -180 10.1275 0.155
NP_440999.1_2 Reverse -95 -114 10.6192 0.243
NP_440999.1_9 Reverse -162 -176 8.55439 0.074
NP_440999.1_9 Forward -179 -165 1.17956 0.169
NP_440888.1_2 Forward -175 -161 14.5519 0.0168
NP_440888.1_2 Reverse -166 -180 14.1586 0.02
NP_440888.1_7 Reverse -315 -334 18.289 0.158
NP_440052.1_5 Forward -186 -167 -3.3438 0.234
NP_442948.1_2 Reverse -165 -184 9.3409 0.173
NP_442033.1_10 Reverse -164 -183 -9.83364 0.222
NP_441543.1_2 Forward -174 -165 18.486 0.00236
NP_441543.1_2 Reverse -167 -176 15.9293 0.00518
NP_442845.1_2 Forward -181 -167 6.09611 0.217
NP_441304.1_10 Reverse -92 -101 13.1761 0.255
NP_441551.1_5 Reverse -162 -178 9.4976 0.21
NP_441319.1_8 Reverse -160 -178 9.26226 0.219
NP_441469.1_8 Reverse -165 -174 16.126 0.00797
NP_441469.1_8 Reverse -177 -186 9.63616 0.227
NP_441469.1_8 Forward -176 -167 6.5879 0.227
NP_443064.1_6 Reverse -166 -176 10.8217 0.13
NP_441306.1_10 Forward -360 -346 15.8302 0.247
NP_442578.1_7 Forward -174 -167 14.5921 0.026
NP_442578.1_7 Reverse -167 -174 14.5921 0.026
NP_441462.1_2 Reverse -166 -176 20.2362 0.000805
NP_441462.1_2 Forward -175 -165 11.5831 0.00406
NP_441462.1_4 Reverse -190 -209 -4.52377 0.252
NP_441621.1_7 Reverse -164 -178 4.32615 0.0934
NP_443062.1_1 Reverse -166 -184 15.7615 0.0356
NP_443062.1_6 Reverse -158 -177 4.42435 0.218
NP_442204.1_1 Forward -179 -168 21.1015 0.0035
NP_442204.1_1 Reverse -174 -185 0.0586712 0.284
NP_442204.1_5 Reverse -156 -175 13.3725 0.059
NP_441560.1_8 Forward -180 -161 18.2325 0.033
NP_440454.1_2 Reverse -242 -256 10.7067 0.291
NP_440516.1_2 Reverse -160 -178 -1.06249 0.274
NP_440516.1_6 Reverse -116 -130 6.29216 0.3
NP_440516.1_8 Forward -175 -166 16.9127 0.00442
NP_440516.1_8 Reverse -166 -175 16.9127 0.00442
NP_442428.1_5 Forward -174 -167 15.8704 0.0124
NP_442428.1_5 Reverse -167 -174 15.8704 0.0124
NP_442428.1_5 Reverse -179 -186 4.46401 0.267
NP_440783.1_5 Forward -215 -196 -3.14714 0.273
NP_441867.1_2 Reverse -86 -105 -14.9469 0.291
NP_440673.1_3 Forward -173 -166 12.4288 0.0426
NP_440673.1_3 Reverse -168 -175 12.4288 0.0426
NP_440673.1_3 Forward -185 -178 8.98723 0.203
NP_441052.1_2 Forward -175 -165 10.5014 0.0285
NP_441052.1_2 Reverse -166 -176 10.4031 0.0285
NP_442219.1_9 Forward -174 -165 8.35786 0.0681
NP_442219.1_9 Reverse -167 -176 8.25953 0.0681
NP_440436.1_4 Forward -174 -165 18.1905 0.00233
NP_440436.1_4 Forward -186 -177 9.73406 0.0871
NP_440436.1_4 Reverse -167 -176 9.24241 0.0871
NP_441884.1_8 Reverse -165 -184 -1.86883 0.138
NP_441884.1_9 Forward -227 -208 -21.4367 0.245
NP_441336.1_1 Reverse -37 -56 18.289 0.24
NP_440041.1_6 Reverse -184 -203 12.7816 0.285
NP_442907.1_9 Reverse -184 -203 1.57275 0.187
NP_442907.1_9 Reverse -178 -197 -4.52377 0.279
NP_441719.1_4 Forward -174 -167 16.3621 0.0124
NP_441719.1_4 Reverse -167 -174 16.3621 0.0124
NP_441733.1_10 Forward -178 -165 5.82081 0.203
NP_441004.1_2 Reverse -167 -186 5.50599 0.193
NP_442366.1_3 Forward -176 -158 5.52568 0.0875
NP_442366.1_3 Reverse -165 -183 -2.73412 0.232
NP_442366.1_3 Forward -314 -296 -4.70074 0.275
NP_441729.1_1 Reverse -185 -204 13.7658 0.287
NP_441115.1_4 Forward -176 -158 12.6047 0.0997
NP_441115.1_4 Reverse -165 -183 10.6381 0.17
NP_442206.1_10 Reverse -166 -181 2.73316 0.198
NP_443054.1_2 Forward -177 -163 10.521 0.0761
NP_443054.1_2 Forward -106 -92 5.99778 0.212
NP_442430.1_10 Forward -185 -166 9.24175 0.297
NP_442308.1_7 Forward -189 -170 14.6176 0.29
NP_442308.1_8 Forward -228 -209 10.1275 0.231
NP_441851.1_10 Reverse -165 -175 16.008 0.00552
NP_441851.1_10 Forward -176 -166 8.53483 0.114
NP_441851.1_10 Reverse -177 -187 6.07655 0.187
NP_442208.1_5 Reverse -80 -99 -8.35868 0.275
NP_442208.1_5 Reverse -210 -229 -9.047 0.29
NP_442515.1_1 Forward -176 -162 -4.62196 0.298
NP_440940.1_7 Reverse -156 -174 8.76983 0.171
NP_441349.1_10 Forward -185 -166 -0.885524 0.0967
NP_441409.1_6 Reverse -160 -179 -4.72043 0.0943
NP_441409.1_6 Forward -181 -162 -8.16202 0.164
NP_440474.1_8 Forward -174 -160 14.3553 0.0637
NP_440726.1_2 Forward -185 -166 -0.4922 0.295
NP_440431.1_3 Forward -188 -169 -8.752 0.236
NP_442450.1_5 Reverse -164 -174 9.32148 0.115
NP_442168.1_5 Reverse -167 -186 -1.57384 0.264
NP_440588.1_2 Forward -184 -165 12.7825 0.024
NP_442006.1_2 Forward -216 -199 -9.20427 0.197
NP_442006.1_2 Reverse -94 -111 -16.9724 0.267
NP_442006.1_2 Reverse -87 -104 -18.3491 0.29
NP_442243.1_1 Forward -181 -163 -0.0799167 0.239
NP_441570.1_1 Reverse -166 -184 -8.83064 0.122
NP_441570.1_1 Forward -346 -328 -9.81395 0.15
NP_441078.1_4 Forward -175 -166 19.6659 0.0007
NP_441078.1_4 Reverse -166 -175 19.6659 0.0007
NP_441078.1_4 Reverse -178 -187 -1.57357 0.266
NP_442729.1_8 Reverse -162 -175 9.45906 0.125
NP_442729.1_8 Reverse -342 -355 4.44418 0.3
NP_442348.1_2 Forward -289 -280 14.356 0.159
NP_442443.1_1 Forward -141 -122 -1.7705 0.243
NP_440526.1_3 Forward -174 -163 1.92649 0.267
NP_441432.1_8 Forward -176 -167 16.8143 0.00595
NP_441432.1_8 Reverse -165 -174 8.25953 0.0755
NP_441432.1_8 Reverse -177 -186 6.5879 0.112
NP_441432.1_9 Forward -253 -240 16.5488 0.104
NP_442320.1_8 Forward -181 -167 -0.688726 0.0817
NP_442320.1_8 Reverse -160 -174 -2.65535 0.0926
NP_442344.1_7 Forward -174 -155 -5.50708 0.168
NP_441732.1_2 Forward -179 -163 -6.62797 0.0495
NP_441732.1_2 Reverse -126 -142 -17.7394 0.292
NP_442815.1_2 Reverse -167 -185 2.47742 0.295
NP_440760.1_1 Reverse -166 -185 -19.1751 0.219
NP_442797.1_2 Reverse -218 -236 13.045 0.239
NP_440199.1_10 Reverse -163 -173 14.533 0.0861
NP_442353.1_4 Forward -312 -293 0.785326 0.265
NP_442353.1_4 Reverse -316 -335 -0.787962 0.291
NP_440913.1_1 Reverse -11 -29 7.39397 0.202
NP_442407.1_8 Forward -216 -197 17.0107 0.171
NP_440713.1_4 Forward -185 -166 16.0274 0.0724
NP_442489.1_7 Forward -175 -166 20.1576 0.000695
NP_442489.1_7 Reverse -166 -175 20.1576 0.000695
NP_442489.1_7 Reverse -178 -187 -1.57357 0.213
NP_442489.1_7 Forward -187 -178 -2.06522 0.288
NP_440386.1_3 Forward -392 -373 -4.03212 0.221
NP_442079.1_7 Reverse -167 -186 4.22769 0.195
NP_440559.1_1 Forward -174 -165 8.75118 0.0586
NP_440559.1_1 Reverse -167 -176 8.65285 0.0586
NP_441659.2_8 Reverse -166 -176 20.9245 0.000805
NP_441659.2_8 Forward -175 -165 11.9764 0.0147
NP_441659.2_8 Forward -313 -303 0.766681 0.258
NP_440426.1_7 Forward -323 -304 0.687771 0.26
NP_441040.1_5 Reverse -173 -192 4.62101 0.246
NP_441800.1_3 Forward -186 -168 3.85406 0.289
NP_442776.1_1 Forward -186 -167 19.3707 0.0502
NP_442346.1_5 Forward -176 -166 16.303 0.00248
NP_442346.1_5 Reverse -177 -187 13.1564 0.029
NP_442346.1_5 Reverse -165 -175 9.02648 0.118
NP_442346.1_5 Forward -314 -304 8.23984 0.143
NP_440545.1_3 Forward -179 -162 4.16874 0.0738
NP_440545.1_3 Reverse -174 -191 0.0388413 0.146
NP_440545.1_3 Forward -191 -174 -6.35267 0.276
NP_441856.1_3 Reverse -163 -182 1.96607 0.208
NP_440831.1_3 Reverse -206 -225 14.5416 0.113
NP_441629.1_1 Reverse -158 -177 6.88262 0.253
NP_440459.1_2 Forward -364 -347 7.90532 0.276
NP_440459.1_8 Forward -172 -154 6.60732 0.291
NP_441653.1_2 Reverse -167 -186 10.0041 0.137
NP_441653.1_2 Reverse -84 -103 9.42428 0.154
NP_441653.1_2 Forward -186 -167 6.332 0.234
NP_440010.1_4 Forward -228 -209 -3.54122 0.299
NP_442551.1_4 Forward -189 -174 -2.8717 0.276
NP_441888.1_7 Forward -180 -166 3.93283 0.225
NP_441050.1_5 Forward -142 -124 -3.02911 0.286
NP_441948.1_4 Reverse -159 -177 -1.25915 0.145
NP_441833.1_4 Forward -174 -167 15.9687 0.0124
NP_441833.1_4 Reverse -167 -174 15.9687 0.0124
NP_441329.1_6 Reverse -237 -256 -2.81744 0.294
NP_442162.1_9 Forward -174 -167 16.2637 0.0124
NP_442162.1_9 Reverse -167 -174 16.2637 0.0124
NP_443015.1_2 Forward -92 -73 11.6025 0.182
NP_441313.1_6 Forward -294 -275 31.2687 0.000149
NP_442796.1_10 Forward -364 -345 8.06259 0.268
NP_440671.1_4 Forward -181 -167 9.73436 0.172
NP_440224.1_1 Forward -186 -167 -0.295539 0.141
NP_442073.1_6 Forward -184 -165 -0.787193 0.269
NP_442199.1_5 Forward -183 -164 11.1109 0.0558
NP_442199.1_7 Reverse -265 -284 8.94676 0.14
NP_442140.1_3 Forward -174 -164 8.33817 0.119
NP_442140.1_3 Forward -81 -71 6.17489 0.184
NP_442140.1_3 Reverse -167 -177 4.69992 0.238
NP_442021.1_3 Forward -289 -270 -7.57203 0.275
NP_441671.1_6 Forward -186 -167 9.24257 0.179
NP_440875.1_9 Reverse -168 -178 16.5483 0.0145
NP_440875.1_9 Forward -173 -163 8.37203 0.233
NP_441813.1_5 Forward -177 -167 18.1713 0.00743
NP_441813.1_5 Reverse -164 -174 17.188 0.00979
NP_440590.1_4 Forward -174 -161 5.32916 0.0585
NP_440590.1_4 Reverse -167 -180 4.44418 0.0601
NP_440590.1_4 Reverse -74 -87 -0.767364 0.2
NP_440567.1_1 Reverse -167 -181 9.43936 0.0442
NP_440567.1_1 Forward -174 -160 5.89945 0.0945
NP_442497.1_10 Reverse -167 -176 17.601 0.00813
NP_442497.1_10 Forward -174 -165 10.4228 0.0087
NP_442497.1_10 Forward -186 -177 0.196389 0.208
NP_440821.1_4 Reverse -164 -174 19.0562 0.00399
NP_440821.1_4 Forward -177 -167 2.24165 0.131
NP_441239.1_1 Reverse -39 -58 14.8474 0.0984
NP_441239.1_9 Forward -177 -165 15.5753 0.0186
NP_441239.1_9 Reverse -164 -176 13.3137 0.037
NP_441239.1_9 Reverse -176 -188 4.26721 0.256
NP_441239.1_9 Reverse -340 -352 4.16888 0.26
NP_442639.1_1 Forward -58 -39 17.0099 0.299
NP_441009.1_4 Reverse -166 -185 11.4058 0.255
NP_441892.1_1 Reverse -169 -186 1.51381 0.152
NP_442044.1_1 Forward -180 -161 -11.8986 0.271
NP_442270.1_9 Reverse -173 -192 -7.08038 0.213
NP_440945.1_6 Reverse -231 -250 17.0099 0.224
NP_442643.1_1 Reverse -160 -179 -10.6203 0.231
NP_441769.1_3 Forward -391 -372 -7.57277 0.296
NP_440833.1_4 Forward -85 -67 15.3588 0.0722
NP_440876.1_5 Reverse -281 -300 7.86593 0.277
NP_442052.1_8 Reverse -176 -186 15.3197 0.253
NP_440546.1_4 Reverse -166 -176 13.5365 0.0459
NP_440546.1_4 Forward -175 -165 11.8882 0.0679
NP_440546.1_4 Forward -82 -72 7.81598 0.22
NP_440546.1_6 Forward -209 -190 11.8975 0.245
NP_440462.1_6 Forward -177 -167 18.7612 0.00454
NP_440462.1_6 Reverse -164 -174 15.418 0.0142
NP_440868.1_4 Reverse -162 -174 10.7571 0.0364
NP_440868.1_4 Forward -179 -167 8.00379 0.0602
NP_442499.1_1 Forward -180 -161 5.40766 0.225
NP_442402.1_10 Reverse -133 -143 13.1559 0.204
NP_441084.1_6 Forward -315 -301 16.325 0.0689
NP_441084.1_6 Reverse -86 -100 11.3802 0.205
NP_441084.1_6 Forward -177 -163 10.2167 0.25
NP_441084.1_6 Reverse -44 -58 9.8289 0.263
NP_440653.1_10 Forward -186 -167 12.0942 0.126
NP_440653.1_10 Forward -300 -281 4.22769 0.252
NP_440843.1_8 Forward -289 -270 19.764 0.166
NP_442039.1_4 Forward -174 -167 15.1821 0.0124
NP_442039.1_4 Reverse -167 -174 15.1821 0.0124
NP_442837.1_3 Forward -174 -167 15.7721 0.0124
NP_442837.1_3 Reverse -167 -174 15.7721 0.0124
NP_440160.1_2 Forward -193 -174 -6.98204 0.283
NP_440160.1_9 Reverse -166 -185 8.94757 0.256
NP_439994.1_3 Forward -176 -157 16.2427 0.0785
NP_442053.1_1 Forward -175 -166 18.3876 0.0007
NP_442053.1_1 Reverse -166 -175 18.3876 0.0007
NP_440505.1_3 Forward -177 -167 17.188 0.00332
NP_440505.1_3 Reverse -164 -174 13.8447 0.0247
NP_440505.1_7 Forward -179 -160 -1.18052 0.271
NP_442360.1_2 Forward -364 -351 17.4232 0.286
NP_442456.1_5 Reverse -96 -114 5.42735 0.287
NP_441252.1_6 Forward -128 -121 11.9372 0.25
NP_441203.1_1 Forward -174 -155 -20.3551 0.297
NP_441408.2_7 Forward -315 -296 -3.44213 0.272
NP_440914.1_1 Reverse -166 -176 16.3248 0.00196
NP_440914.1_1 Reverse -178 -188 12.226 0.0652
NP_440914.1_1 Forward -175 -165 8.6151 0.186
NP_441011.1_8 Forward -174 -165 16.9127 0.00602
NP_441011.1_8 Reverse -167 -176 16.6177 0.00602
NP_442533.1_6 Forward -175 -166 17.2076 0.00137
NP_442533.1_6 Reverse -166 -175 17.2076 0.00137
NP_442533.1_6 Reverse -200 -209 4.52295 0.179
NP_442533.1_6 Reverse -184 -193 2.26134 0.266
NP_442541.1_10 Reverse -223 -237 1.86729 0.273
NP_442232.1_3 Forward -195 -176 -9.24366 0.246
NP_441482.1_7 Forward -181 -167 16.3225 0.00702
NP_441482.1_7 Reverse -172 -186 -9.14519 0.194
NP_439944.1_9 Forward -174 -164 10.3048 0.0887
NP_439944.1_9 Reverse -167 -177 9.12481 0.1
NP_441028.1_6 Reverse -347 -357 4.01116 0.278
NP_440116.1_8 Reverse -167 -186 2.0644 0.0894
NP_440115.1_6 Forward -178 -168 14.0414 0.0615
NP_440007.1_4 Forward -186 -167 9.43923 0.274
NP_440007.1_9 Reverse -174 -188 4.12949 0.267
NP_440007.1_9 Forward -179 -165 2.06454 0.281
NP_440007.1_9 Reverse -162 -176 1.37622 0.285
NP_441347.1_5 Forward -181 -167 12.6836 0.238
NP_441059.1_2 Reverse -83 -102 -8.26035 0.299
NP_441972.1_5 Reverse -167 -186 7.57094 0.0748
NP_441972.1_5 Forward -186 -167 0.687771 0.146
NP_441106.1_1 Forward -176 -167 18.486 0.0028
NP_441106.1_1 Reverse -165 -174 18.191 0.0028
NP_439903.1_6 Forward -178 -159 0.785326 0.256
NP_439903.1_6 Forward -190 -171 -0.591301 0.283
NP_439903.1_6 Reverse -163 -182 -0.787962 0.285
NP_442704.1_7 Reverse -381 -400 12.0942 0.25
NP_441286.1_1 Forward -176 -164 5.05386 0.0259
NP_441286.1_1 Reverse -165 -177 -3.59927 0.145
NP_441286.1_1 Forward -188 -176 -5.46756 0.203
NP_440670.1_8 Forward -175 -166 18.3876 0.000699
NP_440670.1_8 Reverse -166 -175 18.3876 0.000699
NP_441930.1_2 Reverse -177 -187 12.2714 0.262
NP_440886.1_7 Reverse -165 -175 17.7774 0.0011
NP_440886.1_7 Forward -176 -166 8.04271 0.0805
NP_440886.1_7 Reverse -339 -349 3.22451 0.291
NP_442614.1_2 Forward -175 -161 7.17775 0.275
NP_442382.1_9 Forward -96 -77 9.24175 0.281
NP_439995.1_5 Reverse -156 -175 22.3206 0.0262
NP_440767.1_1 Reverse -222 -241 10.7175 0.204
NP_442072.1_9 Reverse -165 -183 -22.4003 0.234
NP_440907.2_8 Reverse -167 -177 9.616 0.103
NP_440907.2_8 Forward -174 -164 7.84605 0.117
NP_440907.2_8 Reverse -226 -236 7.25606 0.123
NP_442264.1_5 Forward -187 -173 17.6992 0.222
NP_442264.1_5 Forward -376 -362 12.3893 0.253
NP_441021.1_1 Forward -186 -167 0.786102 0.086
NP_441021.1_1 Forward -192 -173 -0.295539 0.0992
NP_441021.1_1 Reverse -167 -186 -2.36049 0.138
NP_441021.1_1 Reverse -280 -299 -10.522 0.24
NP_441021.1_1 Forward -312 -293 -12.0953 0.279
NP_441021.1_8 Forward -180 -162 2.77242 0.239
NP_441463.1_3 Forward -185 -166 6.68596 0.0596
NP_441463.1_3 Forward -386 -367 -6.78538 0.249
NP_441626.1_2 Forward -174 -167 15.7721 0.0124
NP_441626.1_2 Reverse -167 -174 15.7721 0.0124
NP_442238.1_1 Forward -294 -275 15.7324 0.0445
NP_442238.1_3 Forward -294 -275 7.66927 0.197
NP_442209.1_6 Forward -330 -311 12.6841 0.268
NP_442794.1_1 Reverse -300 -312 13.0187 0.0721
NP_442794.1_1 Forward -179 -167 10.5604 0.0721
NP_442794.1_1 Reverse -174 -186 7.4138 0.138
NP_442615.1_1 Reverse -157 -175 3.55906 0.0536
NP_442615.1_1 Forward -184 -166 1.88744 0.0783
NP_442615.1_1 Reverse -169 -187 -7.06068 0.273
NP_441962.1_4 Forward -180 -161 -7.67036 0.192
NP_441796.1_7 Forward -347 -328 16.7157 0.299
NP_440387.1_1 Forward -175 -159 5.6634 0.0311
NP_440387.1_1 Reverse -166 -182 -1.3181 0.142
NP_440387.1_1 Reverse -337 -353 -5.93965 0.258
NP_441431.1_2 Forward -178 -164 7.27547 0.244
NP_441488.1_8 Forward -180 -166 9.04542 0.169
NP_441836.1_2 Reverse -160 -179 0.294447 0.203
NP_441993.1_1 Forward -232 -213 1.94669 0.267
NP_440467.1_3 Forward -186 -167 24.9287 0.000339
NP_440467.1_3 Reverse -167 -186 19.948 0.04
NP_440114.1_10 Forward -175 -161 13.5693 0.0531
NP_442437.1_8 Forward -186 -167 10.3242 0.187
NP_442323.1_7 Forward -180 -161 5.40686 0.205
NP_441510.2_2 Forward -119 -100 5.30853 0.26
NP_440293.1_3 Reverse -170 -189 2.65439 0.195
NP_440293.1_9 Forward -192 -178 10.7645 0.261
NP_440766.1_4 Forward -179 -165 7.76774 0.0871
NP_441237.1_9 Forward -186 -176 14.0414 0.0535
NP_439910.1_2 Reverse -158 -175 -11.8592 0.0788
NP_442867.1_8 Reverse -346 -365 8.45592 0.233
NP_440457.1_1 Forward -179 -167 7.70879 0.101
NP_440457.1_1 Reverse -162 -174 -0.0593532 0.25
NP_440213.1_5 Forward -198 -179 10.7175 0.244
NP_441984.1_3 Forward -299 -281 7.78729 0.239
NP_440473.1_1 Forward -178 -159 13.8604 0.179
NP_442509.1_9 Forward -175 -165 16.2041 0.00739
NP_442509.1_9 Reverse -166 -176 8.04271 0.192
NP_440524.1_2 Forward -191 -172 3.44104 0.211
NP_440524.1_2 Forward -173 -154 -0.295539 0.27
NP_442514.1_5 Reverse -170 -189 5.60352 0.136
NP_440554.1_4 Reverse -167 -177 17.9746 0.0131
NP_440554.1_4 Forward -174 -164 14.6313 0.02
NP_441845.1_6 Reverse -154 -172 6.41066 0.167
NP_441885.1_5 Forward -175 -165 11.4848 0.00668
NP_441885.1_5 Reverse -166 -176 11.3864 0.00668
NP_440478.1_9 Forward -183 -164 8.65258 0.268
NP_440478.1_10 Reverse -164 -178 6.3911 0.291
NP_440649.2_8 Forward -207 -193 10.226 0.265
NP_442341.1_7 Forward -176 -162 7.57108 0.102
NP_442341.1_7 Reverse -165 -179 1.67122 0.282
NP_442341.1_7 Reverse -199 -213 1.08123 0.299
NP_442341.1_9 Forward -177 -163 11.7987 0.118
NP_442341.1_9 Reverse -164 -178 5.50552 0.267
NP_442395.2_3 Forward -223 -205 15.8504 0.286
NP_442395.2_4 Reverse -165 -184 17.3048 0.0394
NP_443000.1_7 Forward -177 -167 20.3345 0.00223
NP_443000.1_7 Reverse -164 -174 8.73149 0.0437
NP_441842.1_10 Reverse -159 -173 6.09611 0.299
NP_440275.1_3 Forward -177 -167 16.1063 0.0155
NP_440275.1_3 Reverse -164 -174 8.4365 0.0602
NP_440091.1_1 Reverse -162 -174 10.7571 0.0429
NP_443060.1_2 Forward -185 -166 1.47442 0.282
NP_441359.1_5 Reverse -163 -182 3.14605 0.259
NP_441122.1_1 Forward -191 -176 5.97809 0.28
NP_439962.1_4 Reverse -344 -363 -7.96535 0.292
NP_442495.1_4 Reverse -170 -180 14.4347 0.16
NP_442495.1_5 Reverse -167 -186 12.7825 0.23
NP_441105.1_3 Forward -186 -167 9.14423 0.0472
NP_441105.1_3 Forward -198 -179 -5.99873 0.227
NP_441105.1_3 Forward -192 -173 -7.37537 0.251
NP_441105.1_3 Reverse -172 -191 -10.0303 0.3
NP_440216.1_1 Reverse -166 -180 7.27608 0.00942
NP_440216.1_1 Forward -175 -161 -1.47537 0.0328
NP_440216.1_9 Reverse -180 -189 5.70292 0.29
NP_440172.1_1 Reverse -166 -176 17.5813 0.00421
NP_440172.1_1 Forward -175 -165 8.73149 0.0586
NP_440172.1_1 Reverse -178 -188 2.43831 0.279
NP_442015.1_10 Forward -179 -166 13.4906 0.0354
NP_442015.1_10 Reverse -162 -175 0.805932 0.218
NP_441226.1_7 Forward -174 -167 14.4934 0.0123
NP_441226.1_7 Reverse -167 -174 14.4934 0.0123
NP_441226.1_7 Forward -361 -354 6.52862 0.253
NP_440198.1_10 Forward -290 -271 19.8623 0.0608
NP_441757.1_2 Forward -371 -353 6.214 0.289
NP_441111.1_7 Forward -174 -166 18.7023 0.00294
NP_441111.1_7 Reverse -167 -175 18.7023 0.00294
NP_441766.1_2 Forward -175 -166 17.5026 0.00297
NP_441766.1_2 Reverse -166 -175 17.5026 0.00297
NP_442417.1_5 Reverse -166 -180 6.98109 0.197
NP_440416.1_1 Reverse -166 -185 -11.7019 0.272
NP_440416.1_9 Forward -194 -175 -0.0988766 0.0573
NP_440416.1_9 Forward -182 -163 -5.50708 0.0803
NP_440416.1_9 Reverse -159 -178 -13.8652 0.171
NP_440416.1_9 Reverse -171 -190 -14.4552 0.176
NP_443052.1_8 Reverse -156 -175 -1.96717 0.085
NP_442154.1_1 Forward -25 -7 -16.2055 0.236
NP_440261.1_5 Reverse -167 -180 -2.73398 0.0924
NP_440261.1_5 Forward -174 -161 -2.93064 0.0983
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

TTTGGTGGGTAATTTAATCAGTAATGCCATTCACTACACCCCAACGGGGGGCGAGGTAACCGTCATGCTTGAGACCGATAAACAGCAAGCCATCATCAAAGTCCAAGATACGGGCATTGGTATTGCTTCGGAGAATCAAAGCCGGGTTTTTGACCGTTTTTATCGGGTGGATACGGCCCGGTCTCGACAACGGGGAGGGGCAGGATTAGGCCTTGCCATTGCCCAGGCGATCGCCGTTAAGCATAGGGGGTCTTTAACGGTGGAGAGTGAATTGGGGCAAGGCAGTCTTTTCACCGTCCAGTTGCCCCTTGTTTCTGCACCGATAGTTCAGTCGTAATTCCATTTCATCTTGGTTTCATATTCCTGTGAAACACTAAGAACGTTGCGCTGTCGGAATTCT

CDS

ATGCAAAACCGGATCATTGTTCAGGGTTGGGCGTTCCCCCTGCTGTTAGGGTTGCTGGTAATGTCTCCCCAAGCGACCCTAGCCCATGCTGGCCATGGGGATGAATTCCACCAAAGTGAATCGGCTCAGTCTGCCCAGGGTATTTCCCTTGATGGGGACACTATTCGTCGCCTGGATATTCAGGTGGAGCCTTTACAACCCCGTTATCTAGATACGGGCATCAGGACAACGGGTCAGATTGAAACCCTACCGCAACAAAGGGTTGAGGTCACAACACCCGTGGGGGGAAAATTACTCGAGTTATTAGTGAATCCAGGGGAAAGCGTTACAGCCGGTCAACCCGTCGCCACTATGACCAGTGCCGAATTGGCAGAACTACGCACCACCGCCCAAGACCGTCGTAGCTCGGCGATCGCCGCTGTGGAAGAGGCCCAAGCTGATCTGGAGCTAGCTCGGGAAAATTACCGCCAACAACAACAGGTAGCCCAGAGTGAAATTGAAGAAGCCCGCCTTGCCAAGGAATTTGCCCAGGAGCGTTATGACCGAGACCGGGAACTGGAAGCCAATGGTGCCCTGCCCCGTCGTCAGTTTTTAGAATCAGAAGTGGCCTTAGCCCAAGCCCAGGCTAATTTAGTGAGAACCCAAAGTCGTTTACCGGTCAGTGAAGCCCAAGCTCAAATTAAGCGGGCCCAAGCTGCCTTAAGCGTGGCTCAAAAACAGGTCAAATTGAGCGAGGAAAACTATCAAACCCGTTTACAACAATTGGGGACTGATGCCCGCCCCGATGGCACCATTGTCATTAAAGCCCCCATCGATGGGATCGTTGTTGACCCCGCCACTACCCCAGAACATGAAATCAAGGTAGGAGAATCTCGCCAAGATGCAGGGGAGCCAATTTTTACCCTAATTAATAGTCAGCAAGTTCAAGTTTCAGCCAATATCTACGAGAAGGATCTAAACAAAATTCGCCGGGGCCAAGGAATTCGGGGCTGGGTGAGTAGTTCACCCGATAAAACTTTTAGGGGCAGGATTAATCAAATTGGCTCCGTGGTGGAAGGAGAAAATCGTATCGTTGCGGTGAAAGCAACCTTGGATAATCCCGATGGTCAACTGAAACCCGGCCTGTTTGTGGAGTTGGAAGTCCTAACTGACCGTACTTCGACCCCTGTGCTAGCAGTTCCTCAATCAGCCATTGTCAAAACCAATGATCAGCAAAATCTGGTGTTTGTGCAAAACGGCAATGTCTTTGAACCCATTACCGTTACCCTGGGGCAAGTTTCCGGGGATTGGGTGGAAATCACCGACGGTTTGTTTGCCGGGGATTTAGTGGTCAGCCAACGGGCCAGTCAGCTCTATGCCCAATCTTTGCGGGCTAAACCAGCAGAAAAAATAGAAGAGACTGAAGAATCTACAGAAATAACTGCATCTACCTTTACATTGCCTGGAGCACCGCCATGGCTTTTACCCCTGGGGGGAACCGTTATGGCCGCTGGATTATTTTGGGCCGGTAGCCTGTGGGGAAAACGCCAACAAAGTCAGCAGTTGCGGGAGCCTAGCTTAACGTCTAGCCCAGAGGAACCATCCCTGGAAGTTGAAAAAGTCCTGATTGAAACCCCATCCCACCAGGATTTCCCCTAA

Protein

No sequence available