Your browser is old and dusty. Try Google Chrome!

Details for slr6041

ORF slr6041
Accession NP_942484.1
Symbol
Category
Definition
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_441061.1_2 Reverse -322 -336 11.111 0.0538
NP_441061.1_2 Forward -376 -362 2.35953 0.177
NP_441061.1_2 Reverse -50 -64 0.982901 0.196
NP_441061.1_2 Forward -329 -315 -0.0987402 0.221
NP_440795.1_7 Forward -329 -322 14.6904 0.0123
NP_440795.1_7 Reverse -322 -329 14.6904 0.0123
NP_440694.1_7 Forward -149 -130 15.8307 0.279
NP_441418.1_6 Reverse -129 -148 -23.6 0.196
NP_441418.1_6 Reverse -321 -340 -29.1065 0.216
NP_442291.1_5 Forward -331 -315 8.41667 0.0558
NP_440897.1_6 Reverse -321 -340 12.585 0.0679
NP_441453.1_1 Forward -337 -319 5.62325 0.246
NP_441453.1_4 Reverse -321 -329 16.539 0.00633
NP_441453.1_4 Forward -330 -322 16.539 0.00633
NP_441453.1_4 Forward -64 -56 4.34598 0.257
NP_442151.1_6 Reverse -321 -335 7.57108 0.194
NP_441818.1_1 Forward -329 -318 15.4961 0.0264
NP_441818.1_1 Reverse -307 -318 10.9729 0.21
NP_441818.1_1 Reverse -322 -333 9.69459 0.232
NP_440150.1_2 Reverse -323 -342 5.11187 0.276
NP_442173.1_1 Forward -329 -321 15.4574 0.00633
NP_442173.1_1 Reverse -322 -330 15.4574 0.00633
NP_442173.1_1 Reverse -50 -58 9.1642 0.085
NP_442173.1_1 Forward -95 -87 5.32929 0.215
NP_442752.1_4 Forward -330 -323 13.8055 0.0199
NP_442752.1_4 Reverse -321 -328 13.8055 0.0199
NP_442752.1_4 Reverse -181 -188 9.18389 0.116
NP_442752.1_4 Forward -28 -21 5.25066 0.256
NP_443027.1_4 Forward -332 -322 14.828 0.0437
NP_443027.1_4 Reverse -319 -329 11.0914 0.107
NP_443027.1_4 Forward -66 -56 8.04317 0.219
NP_443027.1_4 Reverse -53 -63 7.55152 0.24
NP_441812.1_3 Reverse -320 -334 9.14437 0.245
NP_442975.1_10 Forward -334 -320 22.615 0.000219
NP_440784.1_7 Forward -329 -322 15.9687 0.0123
NP_440784.1_7 Reverse -322 -329 15.9687 0.0123
NP_441250.1_3 Forward -397 -378 3.53937 0.263
NP_440061.1_9 Forward -332 -318 17.1085 0.018
NP_440061.1_9 Forward -318 -304 4.91554 0.3
NP_440110.1_6 Forward -335 -316 12.3892 0.266
NP_441054.1_2 Reverse -304 -323 12.5858 0.229
NP_441476.1_5 Forward -326 -307 -5.21209 0.26
NP_442062.1_8 Reverse -321 -331 19.4496 0.000558
NP_442062.1_8 Forward -330 -320 17.3846 0.00193
NP_442062.1_8 Forward -96 -86 2.83163 0.293
NP_441859.1_3 Reverse -320 -339 2.85027 0.254
NP_440304.1_4 Forward -332 -322 10.8948 0.051
NP_440304.1_4 Forward -60 -50 6.37155 0.158
NP_440304.1_4 Forward -142 -132 3.02829 0.299
NP_440304.1_4 Reverse -319 -329 1.84832 0.299
NP_442242.1_4 Forward -329 -322 14.3954 0.0124
NP_442242.1_4 Reverse -322 -329 14.3954 0.0124
NP_442242.1_4 Reverse -50 -57 10.7572 0.153
NP_440044.1_8 Forward -329 -310 -1.86883 0.254
NP_440044.1_8 Reverse -322 -341 -2.55715 0.264
NP_441492.1_5 Reverse -263 -282 5.95601 0.237
NP_441594.1_6 Forward -137 -118 3.14605 0.236
NP_442196.1_10 Reverse -85 -104 10.8159 0.239
NP_442110.1_7 Reverse -321 -335 11.406 0.0595
NP_442110.1_7 Reverse -49 -63 -0.0987402 0.274
NP_441083.1_5 Forward -330 -320 20.3345 0.00053
NP_441083.1_5 Reverse -321 -331 11.3864 0.0159
NP_441434.1_7 Forward -328 -314 4.12949 0.225
NP_440109.1_10 Reverse -375 -394 25.6638 0.00149
NP_441738.1_2 Forward -328 -321 15.28 0.0102
NP_441738.1_2 Reverse -323 -330 15.28 0.0102
NP_441558.1_5 Forward -66 -47 6.58763 0.21
NP_440209.1_1 Reverse -321 -329 18.1123 0.00295
NP_440209.1_1 Forward -330 -322 18.1123 0.00295
NP_442889.1_8 Forward -333 -319 13.5686 0.0588
NP_440178.1_7 Reverse -320 -339 -22.125 0.255
NP_441598.1_1 Forward -234 -215 9.53756 0.261
NP_442111.1_4 Reverse -320 -334 10.7177 0.0518
NP_440906.1_5 Forward -329 -322 15.8704 0.0124
NP_440906.1_5 Reverse -322 -329 15.8704 0.0124
NP_440747.1_10 Reverse -318 -330 16.7552 0.0019
NP_440747.1_10 Forward -333 -321 -2.02597 0.0196
NP_440747.1_10 Forward -61 -49 -12.0557 0.199
NP_441130.1_10 Forward -332 -318 11.5043 0.106
NP_441130.1_10 Reverse -319 -333 6.58777 0.183
NP_441486.1_1 Forward -333 -319 13.2743 0.00871
NP_441486.1_1 Reverse -52 -66 7.27608 0.0344
NP_441486.1_1 Reverse -318 -332 2.5562 0.0812
NP_442634.1_4 Reverse -319 -333 -2.06536 0.149
NP_442634.1_4 Forward -60 -46 -4.03198 0.179
NP_440403.1_4 Reverse -312 -331 -1.08219 0.174
NP_442848.1_1 Forward -336 -322 5.70279 0.0803
NP_442848.1_1 Forward -64 -50 3.8345 0.12
NP_442848.1_1 Reverse -315 -329 -0.885388 0.263
NP_443018.1_3 Forward -329 -322 14.8871 0.0123
NP_443018.1_3 Reverse -322 -329 14.8871 0.0123
NP_443018.1_3 Forward -63 -56 12.5271 0.0523
NP_443018.1_3 Reverse -56 -63 12.5271 0.0523
NP_441316.1_7 Forward -332 -317 -3.26502 0.273
NP_441634.1_8 Reverse -319 -333 14.7492 0.0248
NP_440376.1_1 Forward -330 -321 19.4693 0.000692
NP_440376.1_1 Reverse -321 -330 19.4693 0.000692
NP_440376.1_1 Forward -292 -283 7.47288 0.0751
NP_441588.1_4 Reverse -323 -333 6.96153 0.178
NP_441588.1_4 Forward -328 -318 6.46988 0.193
NP_442687.1_7 Forward -331 -321 15.8113 0.0125
NP_442687.1_7 Reverse -320 -330 8.92815 0.0994
NP_441846.1_10 Forward -302 -283 -13.5702 0.206
NP_442958.1_3 Reverse -310 -329 -1.47551 0.277
NP_441029.1_4 Reverse -346 -365 0.196116 0.279
NP_441950.1_7 Forward -146 -127 6.19431 0.133
NP_441763.1_10 Forward -341 -322 5.11187 0.294
NP_440360.1_5 Forward -131 -112 -4.22878 0.297
NP_440360.1_5 Reverse -119 -138 -6.09707 0.298
NP_440360.1_10 Reverse -131 -145 2.85119 0.261
NP_442658.1_1 Forward -332 -322 15.9091 0.00966
NP_442658.1_1 Reverse -85 -95 12.0743 0.0643
NP_442658.1_1 Reverse -319 -329 7.94438 0.199
NP_441855.2_4 Reverse -79 -98 9.52306 0.275
NP_442782.1_2 Reverse -321 -335 0.687908 0.286
NP_441414.1_9 Forward -330 -311 7.07928 0.0358
NP_441414.1_9 Reverse -321 -340 -3.93378 0.143
NP_442937.1_5 Reverse -316 -335 9.73422 0.183
NP_442321.1_4 Reverse -40 -59 -6.49039 0.284
NP_441958.1_5 Forward -331 -321 12.2714 0.00183
NP_441958.1_5 Reverse -320 -330 12.2714 0.00183
NP_442836.1_5 Reverse -315 -334 3.53937 0.23
NP_440203.1_5 Reverse -52 -62 13.7459 0.111
NP_440203.1_5 Forward -187 -177 10.796 0.213
NP_439905.1_1 Forward -329 -316 9.65572 0.216
NP_440984.1_7 Forward -145 -131 14.3559 0.0818
NP_440984.1_7 Reverse -316 -330 11.3077 0.122
NP_440984.1_7 Reverse -124 -138 4.91614 0.281
NP_439990.1_5 Reverse -316 -329 10.2457 0.128
NP_442376.1_2 Forward -134 -115 -13.5702 0.297
NP_442911.1_2 Forward -340 -321 4.62101 0.0375
NP_442911.1_2 Reverse -39 -58 -7.08038 0.2
NP_441580.1_6 Forward -341 -322 -5.70374 0.235
NP_442119.1_6 Forward -332 -313 3.44104 0.3
NP_442064.1_4 Reverse -317 -336 8.65176 0.23
NP_442064.1_4 Forward -340 -321 5.01354 0.281
NP_443055.1_6 Reverse -87 -105 12.1131 0.112
NP_443055.1_6 Reverse -354 -372 3.95163 0.191
NP_443055.1_6 Reverse -313 -331 -1.16155 0.273
NP_440993.1_4 Forward -377 -360 7.11867 0.232
NP_440934.1_1 Reverse -307 -326 5.30933 0.239
NP_440827.1_3 Reverse -82 -101 13.5691 0.222
NP_441099.1_5 Reverse -311 -330 -4.52377 0.146
NP_441099.1_5 Reverse -73 -92 -10.7186 0.261
NP_442002.1_9 Forward -331 -324 10.7572 0.185
NP_442002.1_9 Reverse -86 -93 9.77388 0.258
NP_440809.1_9 Reverse -267 -285 -8.24065 0.23
NP_441294.1_7 Forward -334 -320 15.9698 0.0176
NP_442438.1_10 Forward -335 -321 17.5025 0.0186
NP_441000.1_6 Reverse -320 -334 -3.44199 0.221
NP_441000.1_6 Forward -331 -317 -3.93365 0.225
NP_440147.1_4 Forward -332 -319 11.0324 0.0341
NP_440147.1_4 Reverse -319 -332 7.39411 0.0695
NP_441175.1_2 Forward -99 -80 10.8159 0.175
NP_441550.1_8 Reverse -319 -329 15.1225 0.0132
NP_441550.1_8 Forward -332 -322 6.0761 0.214
NP_441916.1_7 Reverse -321 -331 18.4663 0.00144
NP_441916.1_7 Forward -330 -320 10.3048 0.0261
NP_441041.1_4 Reverse -321 -340 10.9142 0.0268
NP_441041.1_4 Forward -140 -121 -2.65548 0.115
NP_441041.1_4 Forward -64 -45 -3.14714 0.119
NP_441041.1_7 Forward -333 -321 10.916 0.0864
NP_441041.1_7 Forward -99 -87 5.47405 0.255
NP_442396.1_5 Reverse -317 -330 11.819 0.0913
NP_440569.1_10 Forward -211 -192 3.67602 0.278
NP_442004.1_6 Reverse -321 -335 3.34284 0.242
NP_441725.1_4 Reverse -316 -330 2.26061 0.287
NP_441725.1_5 Reverse -322 -332 11.2881 0.0247
NP_441725.1_5 Forward -329 -319 2.04498 0.115
NP_441725.1_5 Reverse -50 -60 -0.0199663 0.223
NP_439966.1_7 Forward -332 -322 18.4657 0.00473
NP_439966.1_7 Reverse -319 -329 15.3192 0.0152
NP_439966.1_9 Reverse -304 -313 4.12963 0.253
NP_439966.1_9 Forward -332 -323 0.983037 0.253
NP_442941.1_3 Forward -329 -319 19.2529 0.00262
NP_442941.1_3 Reverse -322 -332 11.4848 0.0116
NP_442941.1_3 Reverse -50 -60 0.668351 0.19
NP_440289.1_2 Forward -333 -320 21.3571 0.00262
NP_440289.1_2 Reverse -318 -331 -3.61896 0.267
NP_440983.1_5 Forward -327 -308 -5.01543 0.261
NP_442281.1_1 Forward -335 -321 18.3868 0.00441
NP_442281.1_1 Forward -63 -49 9.34041 0.0717
NP_442281.1_1 Reverse -316 -330 7.86545 0.0907
NP_442281.1_1 Reverse -82 -96 3.44058 0.231
NP_441079.1_7 Reverse -261 -280 -2.8529 0.223
NP_442847.1_2 Reverse -225 -244 15.8307 0.278
NP_442256.1_2 Reverse -129 -147 -8.43732 0.224
NP_440437.1_1 Reverse -92 -111 -1.96717 0.207
NP_442012.1_1 Forward -135 -116 0.392778 0.241
NP_442012.1_1 Reverse -55 -74 -1.37718 0.286
NP_442049.1_6 Reverse -313 -332 6.68596 0.215
NP_441556.1_1 Reverse -131 -150 9.83255 0.23
NP_441556.1_10 Forward -143 -129 13.0446 0.182
NP_441556.1_10 Forward -136 -122 10.3192 0.27
NP_440498.1_1 Reverse -40 -58 1.88744 0.201
NP_442982.1_5 Forward -326 -307 -2.36049 0.286
NP_443030.1_4 Reverse -3 -22 -6.58872 0.288
NP_441644.1_6 Forward -330 -320 17.3841 0.00127
NP_441644.1_6 Reverse -321 -331 10.1076 0.0628
NP_441644.1_6 Forward -64 -54 9.12434 0.084
NP_441644.1_6 Reverse -327 -337 3.91283 0.256
NP_442215.1_2 Reverse -319 -335 -1.90808 0.189
NP_442215.1_2 Reverse -129 -145 -6.33298 0.268
NP_442247.1_7 Reverse -16 -35 4.12936 0.298
NP_440253.1_2 Forward -330 -312 13.8838 0.0208
NP_440253.1_2 Reverse -321 -339 -3.22577 0.287
NP_440929.1_8 Forward -330 -321 19.2726 0.000701
NP_440929.1_8 Reverse -321 -330 19.2726 0.000701
NP_442933.1_10 Forward -330 -321 17.601 0.00325
NP_442933.1_10 Reverse -321 -330 17.601 0.00325
NP_440382.1_2 Forward -162 -143 3.04693 0.274
NP_441751.2_8 Forward -329 -315 4.22782 0.0521
NP_441751.2_8 Reverse -322 -336 -3.83532 0.156
NP_441751.2_8 Reverse -277 -291 -6.98191 0.294
NP_442554.1_8 Forward -329 -319 16.2046 0.0065
NP_442554.1_8 Reverse -322 -332 13.8447 0.0145
NP_442554.1_8 Forward -63 -53 10.4031 0.0466
NP_442554.1_8 Reverse -56 -66 4.10993 0.198
NP_442554.1_8 Reverse -50 -60 4.0116 0.2
NP_441762.1_7 Reverse -320 -332 2.89058 0.0676
NP_441762.1_7 Forward -331 -319 2.39892 0.0676
NP_441762.1_7 Forward -141 -129 -6.05754 0.268
NP_442142.1_4 Forward -333 -320 15.85 0.0264
NP_442142.1_4 Reverse -318 -331 6.80355 0.154
NP_442142.1_4 Reverse -92 -105 5.23026 0.197
NP_442142.1_4 Forward -125 -112 3.55864 0.251
NP_442142.1_4 Forward -374 -361 2.96866 0.269
NP_442292.1_1 Forward -329 -320 18.486 0.00229
NP_442292.1_1 Reverse -322 -331 9.63616 0.0183
NP_442292.1_1 Reverse -50 -59 6.5879 0.101
NP_442292.1_1 Forward -63 -54 5.21127 0.152
NP_442292.1_5 Forward -75 -56 1.76941 0.257
NP_442476.1_6 Forward -329 -315 15.9292 0.037
NP_439989.1_7 Forward -147 -130 17.7384 0.273
NP_442381.1_8 Forward -333 -314 -5.99873 0.151
NP_443009.1_5 Reverse -320 -331 18.3477 0.00265
NP_441715.1_4 Forward -329 -319 17.3846 0.0106
NP_441715.1_4 Reverse -322 -332 16.303 0.0117
NP_441715.1_4 Reverse -50 -60 10.9931 0.0955
NP_440620.1_4 Forward -191 -177 13.7625 0.281
NP_440881.1_1 Reverse -127 -146 12.4875 0.123
NP_441448.1_1 Forward -332 -313 12.5858 0.165
NP_440379.1_5 Forward -300 -281 -8.65367 0.253
NP_441468.1_1 Forward -329 -322 15.8704 0.0124
NP_441468.1_1 Reverse -322 -329 15.8704 0.0124
NP_441468.1_1 Reverse -56 -63 3.97235 0.277
NP_441468.1_1 Forward -63 -56 3.97235 0.277
NP_441020.2_6 Forward -332 -315 7.80699 0.218
NP_441015.1_10 Reverse -50 -69 -5.80207 0.232
NP_441673.1_1 Forward -330 -321 20.8459 0.000698
NP_441673.1_1 Reverse -321 -330 20.8459 0.000698
NP_441826.1_2 Forward -336 -322 4.12949 0.105
NP_441826.1_2 Reverse -321 -335 -0.197071 0.204
NP_441826.1_2 Forward -377 -363 -4.03198 0.291
NP_441330.1_1 Reverse -316 -335 -11.2103 0.183
NP_441764.1_8 Forward -242 -232 12.9377 0.284
NP_442868.1_6 Reverse -319 -329 19.2529 0.00563
NP_442868.1_6 Forward -332 -322 0.963343 0.205
NP_441056.1_1 Reverse -49 -68 -5.99873 0.266
NP_441612.1_2 Forward -330 -320 8.54929 0.21
NP_442361.1_3 Forward -336 -323 8.77074 0.285
NP_442808.1_1 Forward -331 -321 18.4657 0.00201
NP_442808.1_1 Reverse -320 -330 8.63269 0.0481
NP_440145.1_3 Reverse -311 -330 0.491109 0.136
NP_442542.1_2 Forward -332 -319 9.45906 0.134
NP_442542.1_2 Forward -72 -59 6.1158 0.234
NP_442542.1_2 Forward -140 -127 5.62415 0.257
NP_442505.1_2 Reverse -234 -253 13.3448 0.259
NP_442050.1_5 Reverse -319 -329 14.3359 0.0206
NP_442050.1_5 Forward -332 -322 9.12434 0.193
NP_442050.1_5 Reverse -85 -95 7.55106 0.251
NP_442342.1_9 Reverse -319 -335 3.69678 0.258
NP_440346.1_1 Forward -391 -372 14.9458 0.21
NP_440558.1_2 Forward -324 -305 -1.86883 0.218
NP_440558.1_2 Forward -339 -320 -3.54046 0.236
NP_440558.1_2 Forward -73 -54 -7.17871 0.289
NP_441518.1_3 Forward -325 -306 -14.7502 0.28
NP_441878.1_6 Forward -331 -321 10.4031 0.0176
NP_441878.1_6 Reverse -320 -330 10.4031 0.0176
NP_441878.1_6 Forward -141 -131 0.963343 0.128
NP_441036.1_8 Forward -331 -321 17.7779 0.000554
NP_441036.1_8 Reverse -320 -330 8.33817 0.174
NP_441557.1_5 Forward -330 -321 19.9609 0.000699
NP_441557.1_5 Reverse -321 -330 19.9609 0.000699
NP_441445.1_1 Forward -339 -320 0.58944 0.272
NP_442066.2_9 Reverse -317 -330 20.0788 0.00699
NP_442066.2_9 Reverse -125 -138 6.70579 0.271
NP_441433.1_8 Forward -95 -76 -0.0988766 0.244
NP_441433.1_8 Forward -376 -357 -2.65548 0.27
NP_441308.1_8 Forward -332 -322 10.1081 0.22
NP_441458.1_10 Forward -339 -320 6.39097 0.2
NP_441458.1_10 Reverse -312 -331 2.3594 0.269
NP_442183.1_1 Reverse -321 -335 18.9775 0.0065
NP_442183.1_1 Forward -330 -316 11.5043 0.0702
NP_441655.1_3 Forward -21 -2 13.5691 0.0719
NP_441549.1_9 Reverse -317 -335 -3.6191 0.198
NP_440861.1_3 Reverse -357 -375 9.75391 0.296
NP_442347.1_2 Forward -329 -320 12.4878 0.056
NP_442347.1_2 Reverse -322 -331 11.1111 0.056
NP_442347.1_2 Reverse -277 -286 2.85133 0.299
NP_442645.1_2 Reverse -313 -332 -2.65548 0.0487
NP_441037.1_4 Forward -332 -322 7.02532 0.237
NP_441633.1_3 Reverse -319 -332 10.7374 0.0286
NP_441633.1_3 Forward -332 -319 -3.71729 0.177
NP_440136.1_2 Forward -329 -322 15.9687 0.0123
NP_440136.1_2 Reverse -322 -329 15.9687 0.0123
NP_440136.1_2 Reverse -50 -57 3.97235 0.288
NP_442590.1_10 Reverse -315 -334 6.09597 0.25
NP_442998.1_10 Forward -328 -321 15.5754 0.0102
NP_442998.1_10 Reverse -323 -330 15.5754 0.0102
NP_442998.1_10 Reverse -51 -58 9.28223 0.117
NP_440299.1_1 Forward -334 -321 11.9167 0.0427
NP_440299.1_1 Reverse -317 -330 10.9334 0.0529
NP_441799.1_1 Reverse -317 -331 16.1252 0.0153
NP_441007.1_10 Reverse -316 -329 8.27909 0.115
NP_441007.1_10 Forward -143 -130 -0.570702 0.287
NP_440256.1_1 Reverse -318 -337 15.2408 0.00688
NP_440256.1_1 Forward -333 -314 -0.39387 0.0928
NP_440256.1_1 Forward -288 -269 -1.37718 0.103
NP_440087.1_1 Reverse -312 -331 -1.37718 0.196
NP_440087.1_1 Reverse -120 -139 -7.67036 0.276
NP_441559.1_8 Forward -335 -321 -6.19526 0.275
NP_440915.1_6 Forward -334 -320 6.3911 0.0826
NP_440915.1_6 Reverse -317 -331 0.687908 0.155
NP_441704.1_8 Forward -69 -50 21.1397 0.0268
NP_442452.1_1 Reverse -289 -308 4.81767 0.232
NP_441464.1_1 Reverse -283 -302 15.8307 0.12
NP_440306.1_9 Reverse -313 -332 13.5691 0.184
NP_441939.1_3 Forward -95 -76 8.75091 0.164
NP_441494.1_6 Reverse -82 -95 10.049 0.227
NP_442993.1_1 Reverse -321 -337 0.55019 0.0631
NP_440677.1_1 Forward -345 -326 7.96426 0.221
NP_442386.1_9 Forward -331 -322 15.7322 0.0144
NP_442386.1_9 Reverse -320 -329 13.8639 0.0289
NP_442386.1_9 Reverse -361 -370 11.4057 0.0942
NP_442386.1_9 Forward -65 -56 11.3073 0.0971
NP_442386.1_9 Forward -372 -363 10.7174 0.119
NP_442386.1_9 Reverse -54 -63 9.04574 0.175
NP_441340.1_5 Forward -329 -322 15.6737 0.0124
NP_441340.1_5 Reverse -322 -329 15.6737 0.0124
NP_441340.1_5 Reverse -56 -63 4.07068 0.239
NP_441340.1_5 Forward -63 -56 4.07068 0.239
NP_440194.1_3 Reverse -311 -330 4.71934 0.271
NP_441160.1_1 Reverse -79 -98 -10.7186 0.269
NP_440586.1_8 Forward -329 -322 13.2151 0.026
NP_440586.1_8 Reverse -322 -329 13.2151 0.026
NP_440586.1_8 Forward -63 -56 7.61025 0.227
NP_440586.1_8 Reverse -56 -63 7.61025 0.227
NP_442251.1_6 Forward -329 -322 15.2804 0.0124
NP_442251.1_6 Reverse -322 -329 15.2804 0.0124
NP_442251.1_6 Reverse -50 -57 9.67555 0.174
NP_440192.1_4 Forward -323 -304 9.78569 0.264
NP_441262.1_3 Reverse -321 -328 14.7888 0.0223
NP_441262.1_3 Forward -330 -323 14.7888 0.0223
NP_443051.1_1 Reverse -320 -329 10.4228 0.00754
NP_443051.1_1 Forward -331 -322 10.4228 0.00754
NP_439937.1_9 Reverse -320 -337 -8.8116 0.177
NP_440439.1_1 Reverse -318 -331 1.88757 0.139
NP_440439.1_1 Forward -333 -320 1.19926 0.159
NP_440372.1_2 Forward -329 -322 16.3621 0.0124
NP_440372.1_2 Reverse -322 -329 16.3621 0.0124
NP_441138.1_5 Reverse -235 -248 11.0433 0.227
NP_441181.1_6 Reverse -322 -340 2.37909 0.295
NP_440316.1_10 Forward -141 -131 7.74818 0.246
NP_440316.1_10 Forward -292 -282 7.55152 0.246
NP_439977.1_5 Reverse -81 -100 3.73603 0.158
NP_439977.1_5 Reverse -125 -144 3.6377 0.159
NP_439977.1_5 Reverse -315 -334 0.196116 0.212
NP_439977.1_5 Forward -336 -317 -0.787193 0.236
NP_439977.1_5 Reverse -43 -62 -0.787193 0.236
NP_441572.1_7 Forward -336 -317 -3.54046 0.215
NP_442887.1_5 Reverse -124 -143 -13.0786 0.281
NP_442384.1_10 Forward -330 -317 19.2922 0.00338
NP_442384.1_10 Reverse -321 -334 8.37742 0.0656
NP_442384.1_10 Reverse -19 -32 0.805932 0.278
NP_441877.1_7 Reverse -316 -335 4.91521 0.218
NP_441018.1_7 Reverse -317 -336 20.354 0.0268
NP_442790.1_4 Reverse -120 -139 2.26107 0.0729
NP_442790.1_4 Reverse -312 -331 -7.76869 0.156
NP_442262.1_10 Forward -329 -322 14.1988 0.0123
NP_442262.1_10 Reverse -322 -329 14.1988 0.0123
NP_442262.1_10 Forward -63 -56 10.4622 0.145
NP_442262.1_10 Reverse -56 -63 10.4622 0.145
NP_442262.1_10 Reverse -50 -57 8.8889 0.219
NP_441689.1_5 Forward -332 -322 8.53436 0.132
NP_441689.1_5 Reverse -319 -329 5.78111 0.197
NP_440163.1_10 Forward -333 -323 15.2213 0.0762
NP_440163.1_10 Forward -67 -57 8.73149 0.262
NP_440344.1_10 Forward -337 -320 31.5048 0.0000398
NP_440531.1_6 Reverse -313 -332 -2.75381 0.258
NP_440531.1_6 Forward -148 -129 -4.03212 0.273
NP_442917.1_1 Reverse -188 -207 7.07848 0.254
NP_441965.1_10 Forward -333 -317 10.285 0.107
NP_440297.1_9 Forward -63 -53 9.61647 0.0917
NP_440297.1_9 Reverse -322 -332 9.32148 0.0917
NP_440297.1_9 Reverse -56 -66 0.766681 0.282
NP_440297.1_9 Forward -329 -319 -0.118297 0.282
NP_441592.1_4 Forward -330 -311 6.4893 0.124
NP_441896.1_3 Reverse -312 -331 7.7676 0.0933
NP_440999.1_9 Forward -334 -320 14.1593 0.0277
NP_440999.1_9 Reverse -127 -141 1.96621 0.156
NP_440888.1_2 Reverse -321 -335 18.0918 0.00261
NP_440888.1_2 Forward -330 -316 14.1586 0.02
NP_440888.1_2 Reverse -284 -298 5.40719 0.28
NP_441771.1_4 Reverse -249 -268 -4.72043 0.295
NP_440600.1_4 Reverse -313 -331 -1.35749 0.163
NP_440052.1_5 Forward -341 -322 -5.70374 0.295
NP_442948.1_2 Reverse -320 -339 5.01433 0.256
NP_441543.1_2 Reverse -322 -331 18.486 0.00236
NP_441543.1_2 Forward -329 -320 16.9127 0.00359
NP_442845.1_2 Forward -70 -56 15.6342 0.0694
NP_442845.1_2 Forward -377 -363 12.4876 0.11
NP_442845.1_2 Forward -336 -322 6.29277 0.212
NP_442845.1_2 Reverse -49 -63 5.99778 0.219
NP_440739.1_7 Forward -285 -266 11.3075 0.25
NP_441469.1_8 Forward -331 -322 16.126 0.00797
NP_441469.1_8 Reverse -361 -370 12.7828 0.0967
NP_441469.1_8 Reverse -320 -329 6.48957 0.227
NP_442315.1_2 Reverse -176 -188 15.2803 0.27
NP_442637.1_1 Forward -379 -360 24.2872 0.000761
NP_442637.1_2 Forward -118 -99 26.2538 0.000123
NP_442637.1_3 Forward -36 -17 31.8587 0.0000731
NP_442637.1_4 Forward -96 -77 22.7139 0.0033
NP_442637.1_5 Forward -187 -168 19.9598 0.0158
NP_442637.1_6 Forward -358 -339 22.8122 0.00388
NP_442637.1_7 Forward -214 -195 29.4004 0.000744
NP_442637.1_8 Forward -58 -39 26.3522 0.00483
NP_442637.1_9 Forward -150 -131 19.764 0.0283
NP_442637.1_10 Forward -310 -291 28.5154 0.000736
NP_443064.1_6 Forward -330 -320 12.5669 0.0796
NP_442578.1_7 Forward -329 -322 14.5921 0.026
NP_442578.1_7 Reverse -322 -329 14.5921 0.026
NP_440148.1_1 Forward -81 -62 -5.9004 0.24
NP_441462.1_2 Forward -330 -320 11.5831 0.00406
NP_441462.1_2 Reverse -321 -331 11.5831 0.00406
NP_443062.1_1 Reverse -321 -339 14.9814 0.0427
NP_443062.1_6 Forward -338 -319 2.3594 0.256
NP_441601.1_4 Reverse -289 -308 -5.99873 0.295
NP_442204.1_1 Forward -334 -323 0.353664 0.281
NP_442204.1_5 Forward -340 -321 20.354 0.0241
NP_440544.1_7 Forward -279 -261 19.0181 0.152
NP_440516.1_8 Forward -330 -321 16.9127 0.00442
NP_440516.1_8 Reverse -321 -330 16.9127 0.00442
NP_441785.1_1 Reverse -321 -335 16.2288 0.112
NP_442428.1_5 Forward -329 -322 15.8704 0.0124
NP_442428.1_5 Reverse -322 -329 15.8704 0.0124
NP_442428.1_5 Forward -63 -56 4.36568 0.271
NP_442428.1_5 Reverse -56 -63 4.36568 0.271
NP_442120.1_10 Forward -64 -45 -15.8318 0.296
NP_440673.1_2 Reverse -311 -330 10.4871 0.207
NP_440673.1_3 Forward -328 -321 12.4288 0.0426
NP_440673.1_3 Reverse -323 -330 12.4288 0.0426
NP_440673.1_7 Forward -107 -88 0.786102 0.262
NP_441052.1_2 Forward -330 -320 19.9412 0.00106
NP_441052.1_2 Reverse -321 -331 10.5014 0.0285
NP_441052.1_2 Reverse -362 -372 2.7333 0.193
NP_442219.1_9 Forward -329 -320 17.7976 0.00718
NP_442219.1_9 Reverse -322 -331 8.35786 0.0681
NP_440436.1_4 Reverse -322 -331 18.1905 0.00233
NP_440436.1_4 Forward -329 -320 17.2072 0.00233
NP_440436.1_4 Reverse -50 -59 4.22755 0.277
NP_441884.1_9 Forward -333 -314 -6.39206 0.0594
NP_442412.1_4 Reverse -291 -310 16.7157 0.188
NP_441893.1_10 Forward -307 -288 11.4058 0.24
NP_440314.1_9 Forward -329 -310 3.14605 0.0849
NP_441719.1_4 Forward -329 -322 16.3621 0.0124
NP_441719.1_4 Reverse -322 -329 16.3621 0.0124
NP_441733.1_10 Reverse -318 -331 7.09911 0.156
NP_441004.1_1 Forward -146 -127 -11.9969 0.243
NP_441004.1_1 Forward -377 -358 -17.0118 0.288
NP_441004.1_4 Forward -233 -223 8.53483 0.271
NP_442366.1_3 Reverse -320 -338 8.47561 0.0653
NP_442139.1_7 Reverse -316 -335 13.3725 0.167
NP_440129.1_10 Forward -337 -323 3.73617 0.189
NP_440129.1_10 Reverse -80 -94 2.5562 0.25
NP_442694.1_3 Forward -100 -82 -4.8974 0.276
NP_442206.1_7 Reverse -54 -73 11.9958 0.295
NP_442206.1_10 Forward -330 -315 3.61814 0.181
NP_440094.1_9 Reverse -320 -339 2.45773 0.173
NP_443054.1_2 Reverse -319 -333 10.521 0.0761
NP_442308.1_7 Reverse -325 -344 14.4233 0.29
NP_441851.1_10 Forward -331 -321 16.008 0.00552
NP_441851.1_10 Reverse -320 -330 15.8113 0.00552
NP_441851.1_10 Forward -97 -87 5.87989 0.196
NP_441851.1_10 Reverse -54 -64 4.10993 0.287
NP_442856.1_7 Forward -339 -320 -3.24547 0.242
NP_442515.1_1 Forward -331 -317 11.6026 0.0393
NP_442515.1_1 Reverse -320 -334 -4.91696 0.298
NP_440593.1_3 Forward -101 -82 6.39097 0.112
NP_441046.1_2 Reverse -170 -189 -1.7705 0.292
NP_441349.1_10 Forward -340 -321 -0.983855 0.0981
NP_441409.1_6 Reverse -43 -62 -5.40875 0.103
NP_440432.1_9 Forward -329 -314 5.19144 0.0578
NP_442843.1_1 Forward -329 -310 -2.65548 0.209
NP_442843.1_1 Reverse -223 -242 -10.7186 0.28
NP_440474.1_8 Reverse -322 -336 7.47213 0.204
NP_440396.1_10 Forward -329 -313 12.8408 0.153
NP_442450.1_3 Reverse -194 -212 5.1316 0.282
NP_442450.1_5 Forward -332 -322 9.32148 0.115
NP_440588.1_2 Forward -339 -320 5.11266 0.0712
NP_441570.1_1 Reverse -321 -339 -8.04399 0.101
NP_441570.1_1 Forward -330 -312 -14.2388 0.225
NP_441078.1_4 Forward -330 -321 19.6659 0.0007
NP_441078.1_4 Reverse -321 -330 19.6659 0.0007
NP_441078.1_4 Reverse -61 -70 3.14632 0.15
NP_442729.1_8 Reverse -317 -330 10.639 0.125
NP_442729.1_8 Forward -334 -321 8.18076 0.125
NP_440526.1_3 Reverse -88 -99 7.82632 0.131
NP_440526.1_3 Reverse -322 -333 1.92649 0.267
NP_440526.1_3 Forward -329 -318 1.04151 0.267
NP_441432.1_8 Reverse -320 -329 16.8143 0.00595
NP_441432.1_8 Forward -331 -322 8.25953 0.0755
NP_441432.1_8 Forward -59 -50 8.1612 0.0815
NP_442320.1_8 Forward -336 -322 24.9757 0.00275
NP_442320.1_8 Reverse -315 -329 -4.81863 0.188
NP_442344.1_7 Reverse -322 -341 -6.68705 0.172
NP_441732.1_2 Forward -334 -318 -6.7263 0.0495
NP_441732.1_2 Forward -135 -119 -17.346 0.253
NP_441732.1_2 Reverse -45 -61 -17.346 0.253
NP_440760.1_1 Forward -330 -311 3.93269 0.017
NP_440760.1_1 Reverse -321 -340 -20.4534 0.222
NP_440199.1_10 Forward -333 -323 14.533 0.0861
NP_442353.1_4 Forward -336 -317 -0.197979 0.287
NP_441072.1_2 Reverse -317 -336 7.86593 0.248
NP_442489.1_2 Forward -341 -322 9.43923 0.168
NP_442489.1_2 Reverse -44 -63 7.37428 0.172
NP_442489.1_7 Forward -330 -321 20.1576 0.000695
NP_442489.1_7 Reverse -321 -330 20.1576 0.000695
NP_442489.1_7 Reverse -49 -58 -1.96689 0.28
NP_440565.1_7 Forward -370 -351 -1.67217 0.284
NP_442079.1_7 Forward -329 -310 9.24257 0.113
NP_440559.1_1 Forward -329 -320 17.4043 0.00658
NP_440559.1_1 Reverse -322 -331 8.75118 0.0586
NP_441659.2_8 Forward -330 -320 18.1713 0.00133
NP_441659.2_8 Reverse -321 -331 11.9764 0.0147
NP_441659.2_8 Forward -64 -54 0.766681 0.258
NP_442913.1_10 Forward -105 -86 -0.983855 0.165
NP_440779.1_5 Reverse -87 -104 -13.4325 0.212
NP_442346.1_5 Reverse -320 -330 16.6963 0.00248
NP_442346.1_5 Forward -65 -55 11.2881 0.0706
NP_442346.1_5 Forward -331 -321 9.02648 0.118
NP_442346.1_5 Reverse -54 -64 4.79825 0.272
NP_440486.1_6 Forward -378 -359 6.39097 0.283
NP_440459.1_2 Reverse -46 -63 7.31533 0.296
NP_442603.1_7 Forward -330 -316 14.6503 0.0613
NP_441888.1_7 Reverse -316 -330 2.75286 0.225
NP_441888.1_7 Forward -335 -321 2.65453 0.225
NP_441047.1_2 Forward -335 -316 6.98095 0.192
NP_440170.1_5 Forward -340 -321 9.93088 0.134
NP_441502.1_3 Forward -42 -23 12.0942 0.21
NP_442732.1_1 Reverse -375 -392 18.6234 0.162
NP_441833.1_4 Forward -329 -322 15.9687 0.0124
NP_441833.1_4 Reverse -322 -329 15.9687 0.0124
NP_443040.1_1 Reverse -192 -206 13.3728 0.276
NP_441895.1_2 Forward -308 -289 -26.8449 0.256
NP_442162.1_9 Forward -329 -322 16.2637 0.0124
NP_442162.1_9 Reverse -322 -329 16.2637 0.0124
NP_442162.1_10 Reverse -206 -225 17.1891 0.209
NP_440671.1_4 Forward -336 -322 19.0758 0.00997
NP_442073.1_6 Forward -339 -320 -2.95047 0.291
NP_442199.1_5 Forward -338 -319 -5.40875 0.245
NP_442199.1_5 Reverse -47 -66 -6.88371 0.283
NP_442140.1_3 Forward -329 -319 10.3048 0.0902
NP_442140.1_3 Reverse -322 -332 8.33817 0.119
NP_442140.1_3 Forward -370 -360 3.42162 0.297
NP_442021.1_3 Forward -34 -15 1.86774 0.176
NP_440875.1_9 Reverse -97 -107 8.66404 0.233
NP_440875.1_9 Reverse -323 -333 8.37203 0.233
NP_441813.1_5 Reverse -319 -329 18.1713 0.00743
NP_441813.1_5 Forward -332 -322 17.188 0.00979
NP_440590.1_4 Reverse -322 -335 13.0973 0.013
NP_440590.1_4 Forward -329 -316 2.67422 0.0835
NP_440567.1_1 Reverse -322 -336 16.7159 0.0166
NP_440567.1_1 Forward -95 -81 4.81781 0.111
NP_442497.1_10 Forward -329 -320 10.4228 0.0087
NP_442497.1_10 Reverse -322 -331 10.4228 0.0087
NP_442497.1_10 Reverse -88 -97 -1.18024 0.256
NP_440821.1_4 Forward -332 -322 19.0562 0.00399
NP_440821.1_4 Reverse -319 -329 9.41981 0.0286
NP_440821.1_4 Forward -98 -88 -0.41329 0.257
NP_441239.1_9 Forward -332 -320 13.3137 0.037
NP_441239.1_9 Reverse -319 -331 7.80712 0.148
NP_441239.1_9 Reverse -129 -141 6.33216 0.193
NP_441009.1_4 Reverse -321 -340 10.6192 0.263
NP_442691.1_2 Reverse -274 -293 7.7676 0.179
NP_441727.1_3 Reverse -48 -67 5.01433 0.257
NP_442669.1_1 Reverse -169 -188 0.884433 0.256
NP_440604.1_6 Reverse -321 -340 -4.03212 0.236
NP_441017.1_6 Forward -334 -320 16.4202 0.0651
NP_442772.1_6 Reverse -210 -229 16.368 0.196
NP_440833.1_6 Forward -241 -227 9.04542 0.267
NP_440876.1_5 Forward -328 -309 20.354 0.104
NP_441526.1_6 Reverse -304 -323 4.71934 0.271
NP_440354.1_7 Reverse -315 -333 5.72234 0.297
NP_442052.1_8 Reverse -85 -95 12.5664 0.265
NP_440546.1_4 Reverse -321 -331 11.8882 0.0679
NP_440546.1_4 Forward -330 -320 10.046 0.109
NP_440546.1_4 Forward -28 -18 6.65249 0.288
NP_440546.1_6 Forward -340 -321 9.14423 0.253
NP_440462.1_6 Forward -332 -322 15.418 0.0142
NP_440462.1_6 Reverse -319 -329 9.61647 0.0429
NP_442611.1_1 Reverse -321 -340 0.392778 0.259
NP_442592.1_3 Forward -367 -348 9.83255 0.255
NP_440868.1_4 Reverse -317 -329 9.97041 0.0405
NP_440868.1_4 Forward -334 -322 1.7106 0.174
NP_442499.1_1 Forward -63 -44 2.16274 0.293
NP_440374.1_6 Forward -43 -24 10.0292 0.264
NP_442479.1_9 Forward -332 -313 -11.8986 0.275
NP_440905.1_2 Reverse -227 -244 15.0835 0.223
NP_441848.1_4 Forward -171 -155 7.1687 0.295
NP_442460.1_7 Forward -342 -323 5.89931 0.167
NP_442039.1_4 Forward -329 -322 15.1821 0.0124
NP_442039.1_4 Reverse -322 -329 15.1821 0.0124
NP_442039.1_4 Reverse -50 -57 10.5605 0.121
NP_442837.1_3 Forward -329 -322 15.7721 0.0124
NP_442837.1_3 Reverse -322 -329 15.7721 0.0124
NP_440160.1_5 Forward -326 -316 14.5325 0.291
NP_442053.1_1 Forward -330 -321 18.3876 0.0007
NP_442053.1_1 Reverse -321 -330 18.3876 0.0007
NP_440505.1_3 Reverse -319 -329 18.3679 0.00213
NP_440505.1_3 Forward -332 -322 13.8447 0.0247
NP_440505.1_3 Forward -60 -50 4.89658 0.257
NP_440520.1_5 Forward -392 -373 25.7622 0.00103
NP_440914.1_1 Forward -330 -320 17.5935 0.000537
NP_440914.1_1 Forward -58 -48 9.68861 0.178
NP_440914.1_1 Reverse -321 -331 8.6151 0.186
NP_440914.1_4 Forward -323 -307 10.7759 0.271
NP_441011.1_8 Reverse -322 -331 16.9127 0.00602
NP_441011.1_8 Forward -329 -320 8.25953 0.144
NP_442931.1_10 Reverse -188 -207 6.39016 0.261
NP_442533.1_6 Forward -330 -321 17.2076 0.00137
NP_442533.1_6 Reverse -321 -330 17.2076 0.00137
NP_442533.1_6 Reverse -55 -64 4.62128 0.179
NP_442533.1_6 Reverse -283 -292 2.35967 0.259
NP_441482.1_7 Reverse -315 -329 4.71948 0.0454
NP_441482.1_7 Forward -336 -322 0.687908 0.0554
NP_441482.1_7 Forward -64 -50 -0.000409212 0.0612
NP_442293.1_6 Reverse -171 -190 18.4857 0.19
NP_439944.1_9 Forward -329 -319 10.5014 0.0887
NP_439944.1_9 Reverse -322 -332 10.3048 0.0887
NP_439944.1_9 Reverse -56 -66 5.28991 0.262
NP_440116.1_8 Reverse -88 -107 -9.63698 0.286
NP_440115.1_6 Reverse -318 -328 6.76487 0.167
NP_440115.1_6 Reverse -84 -94 6.66654 0.172
NP_440007.1_9 Forward -334 -320 4.03116 0.267
NP_440007.1_9 Forward -62 -48 1.57289 0.285
NP_439965.1_1 Forward -339 -320 -3.93378 0.182
NP_440608.1_6 Forward -329 -310 6.29183 0.238
NP_441602.1_3 Reverse -316 -335 6.68596 0.128
NP_441106.1_1 Forward -331 -322 18.191 0.0028
NP_441106.1_1 Reverse -320 -329 9.63616 0.0311
NP_439903.1_6 Forward -380 -361 6.98015 0.164
NP_439903.1_6 Reverse -46 -65 6.78348 0.167
NP_439903.1_6 Forward -333 -314 1.47364 0.245
NP_442306.1_10 Reverse -316 -335 -19.7651 0.2
NP_440797.1_2 Forward -341 -322 11.9854 0.284
NP_441286.1_1 Reverse -320 -332 14.4936 0.00418
NP_441286.1_1 Forward -331 -319 3.38223 0.0467
NP_440670.1_8 Forward -330 -321 18.3876 0.000699
NP_440670.1_8 Reverse -321 -330 18.3876 0.000699
NP_440670.1_8 Forward -58 -49 3.34298 0.275
NP_440670.1_8 Forward -285 -276 3.24465 0.29
NP_440886.1_7 Forward -331 -321 17.7774 0.0011
NP_440886.1_7 Reverse -320 -330 7.94438 0.0805
NP_440886.1_7 Reverse -128 -138 4.50281 0.232
NP_440886.1_7 Reverse -361 -371 3.8145 0.265
NP_442614.1_2 Reverse -129 -143 10.6193 0.234
NP_439995.1_5 Forward -340 -321 4.22769 0.289
NP_442072.1_9 Reverse -320 -338 -23.187 0.284
NP_440513.1_8 Reverse -1 -20 18.6573 0.181
NP_440907.2_8 Reverse -322 -332 7.84605 0.117
NP_442264.1_2 Reverse -317 -334 8.20031 0.22
NP_441021.1_8 Forward -297 -279 10.0489 0.133
NP_441463.1_3 Forward -340 -321 8.45592 0.0487
NP_441463.1_3 Reverse -45 -64 5.30933 0.0769
NP_441463.1_3 Forward -51 -32 -4.72043 0.211
NP_441463.1_6 Reverse -47 -61 7.28563 0.262
NP_441463.1_6 Forward -66 -52 5.83613 0.287
NP_441626.1_2 Forward -329 -322 15.7721 0.0124
NP_441626.1_2 Reverse -322 -329 15.7721 0.0124
NP_442211.1_3 Reverse -129 -148 6.98569 0.29
NP_442365.1_7 Forward -334 -315 -1.08219 0.189
NP_442238.1_7 Reverse -262 -281 13.175 0.167
NP_442238.1_7 Reverse -143 -162 8.35677 0.239
NP_442794.1_1 Reverse -317 -329 7.31547 0.142
NP_442794.1_1 Forward -62 -50 7.31547 0.142
NP_442615.1_1 Forward -339 -321 -1.16082 0.125
NP_441962.1_4 Forward -335 -316 0.786102 0.111
NP_441962.1_4 Reverse -82 -101 -5.21209 0.166
NP_441962.1_4 Forward -320 -301 -12.5869 0.26
NP_441962.1_4 Reverse -307 -326 -12.7836 0.265
NP_441962.1_4 Reverse -322 -341 -14.2585 0.285
NP_440387.1_1 Forward -330 -314 4.18844 0.0455
NP_440387.1_1 Reverse -321 -337 -1.41643 0.142
NP_440855.1_2 Reverse -360 -379 12.9783 0.299
NP_440855.1_5 Reverse -319 -338 6.1935 0.285
NP_441836.1_2 Forward -336 -317 -3.93378 0.247
NP_441174.1_4 Reverse -8 -18 17.5813 0.184
NP_440114.1_10 Reverse -321 -335 9.43936 0.172
NP_440114.1_10 Forward -330 -316 5.80112 0.292
NP_441552.1_3 Forward -337 -318 11.995 0.292
NP_440766.1_4 Forward -334 -320 8.55439 0.0871
NP_442743.1_5 Reverse -322 -341 10.0292 0.148
NP_442930.1_1 Forward -180 -170 14.3359 0.239
NP_439910.1_2 Forward -338 -321 -12.4492 0.0863
NP_439910.1_2 Reverse -380 -397 -13.9242 0.171
NP_442867.1_7 Reverse -38 -57 14.8474 0.132
NP_440457.1_1 Forward -334 -322 7.02048 0.105
NP_440457.1_1 Reverse -317 -329 -0.74767 0.273
NP_441984.1_3 Reverse -317 -335 9.26226 0.211
NP_441332.1_6 Reverse -127 -137 10.9691 0.278
NP_442509.1_7 Reverse -14 -33 18.7807 0.221
NP_442509.1_9 Reverse -321 -331 16.2041 0.00739
NP_442509.1_9 Forward -330 -320 8.14104 0.192
NP_440524.1_2 Reverse -323 -342 -3.24547 0.27
NP_442514.1_5 Forward -97 -78 -7.76943 0.28
NP_440554.1_4 Reverse -322 -332 14.6313 0.02
NP_440554.1_4 Forward -329 -319 8.92815 0.0646
NP_441885.1_5 Forward -330 -320 20.9245 0.000538
NP_441885.1_5 Reverse -321 -331 11.4848 0.00668
NP_440478.1_10 Forward -332 -318 9.83269 0.218
NP_442341.1_7 Reverse -320 -334 19.7641 0.00702
NP_442341.1_7 Forward -331 -317 6.78443 0.118
NP_442341.1_9 Forward -379 -365 5.21053 0.277
NP_442395.2_4 Reverse -320 -339 10.2251 0.101
NP_440409.1_1 Reverse -313 -332 -1.08219 0.225
NP_440423.1_6 Reverse -313 -332 -16.4218 0.232
NP_440423.1_10 Reverse -314 -333 13.5691 0.172
NP_443000.1_7 Reverse -319 -329 19.9412 0.00223
NP_443000.1_7 Forward -332 -322 8.73149 0.0437
NP_440507.2_3 Forward -339 -320 9.53674 0.218
NP_441842.1_10 Forward -337 -323 17.0108 0.0273
NP_440275.1_3 Reverse -319 -329 15.123 0.0182
NP_440275.1_3 Forward -332 -322 8.4365 0.0602
NP_440091.1_1 Forward -334 -322 10.7571 0.0429
NP_440127.1_5 Forward -281 -263 12.8022 0.226
NP_443010.1_10 Forward -333 -316 9.92169 0.131
NP_442451.1_2 Reverse -313 -332 -6.49039 0.232
NP_439962.1_4 Forward -314 -295 -1.67217 0.216
NP_439962.1_4 Reverse -79 -98 -7.37537 0.288
NP_442495.1_5 Reverse -76 -95 6.88262 0.291
NP_440149.1_8 Reverse -49 -68 5.89931 0.0726
NP_440149.1_8 Forward -330 -311 -1.57384 0.162
NP_440149.1_8 Reverse -321 -340 -7.96535 0.296
NP_441105.1_3 Forward -341 -322 6.98095 0.0565
NP_441105.1_3 Reverse -316 -335 -2.85214 0.169
NP_441105.1_3 Forward -69 -50 -6.68705 0.239
NP_440216.1_1 Forward -330 -316 -0.885388 0.0286
NP_440216.1_1 Reverse -321 -335 -1.5737 0.034
NP_440216.1_6 Forward -337 -321 5.76173 0.189
NP_440216.1_9 Forward -62 -53 7.76787 0.286
NP_440216.1_9 Reverse -329 -338 5.80125 0.289
NP_440172.1_1 Forward -330 -320 15.0247 0.00945
NP_440172.1_1 Reverse -321 -331 8.73149 0.0586
NP_440172.1_1 Forward -58 -48 5.87989 0.127
NP_442015.1_10 Forward -334 -321 10.639 0.0391
NP_442015.1_10 Reverse -317 -330 2.67422 0.187
NP_442015.1_10 Reverse -364 -377 1.69091 0.204
NP_441226.1_7 Forward -329 -322 14.4934 0.0123
NP_441226.1_7 Reverse -322 -329 14.4934 0.0123
NP_441111.1_7 Forward -329 -321 18.7023 0.00294
NP_441111.1_7 Reverse -322 -330 18.7023 0.00294
NP_441766.1_2 Forward -330 -321 17.5026 0.00297
NP_441766.1_2 Reverse -321 -330 17.5026 0.00297
NP_442252.1_3 Forward -337 -319 8.96727 0.244
NP_440416.1_1 Reverse -321 -340 -11.8003 0.272
NP_440416.1_9 Forward -337 -318 -3.04881 0.0727
NP_440416.1_9 Reverse -54 -73 -16.5201 0.216
NP_443052.1_8 Forward -340 -321 -4.13045 0.112
NP_443052.1_9 Reverse -130 -149 -2.45882 0.238
NP_443052.1_9 Reverse -127 -146 -2.75381 0.242
NP_442116.1_6 Forward -211 -194 6.25912 0.283
NP_440591.1_9 Forward -337 -319 3.85406 0.295
NP_442154.1_1 Forward -98 -80 -9.71562 0.188
NP_442564.1_9 Forward -64 -50 14.8951 0.227
NP_440261.1_5 Forward -329 -316 -2.53732 0.0924
NP_440261.1_5 Reverse -132 -145 -12.3704 0.284
NP_440988.1_10 Reverse -325 -339 16.5164 0.112
NP_440988.1_10 Forward -66 -52 5.09245 0.246
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

GGGGCCGATGATTATTTAATTAAGCCCTTCGGCATGGCGGAACTATTAGCCCGTTTACGTTCTTTGCAACGGCGATCGCCAGAATTGCAACCCCAGCAGTTACAGGTGGGGGACTGGCGATTAGATTATGGAACTTTTGTGGTAGTAACGCCAGATAAACAGCAAATTTCCCTAACGGCTAAAGAATTTCAGCTTTTAGAATATTTTATGAAGCATCCCCAACAAATTCTCAGTAGTGAACAAATTAAAAATCAACTGTGGGCGCTGTCGGCGGAATCCACCAGTAATGTTGTAGCGGCCCAGGTGCGTTTGCTCCGGCGAAAATTAGGGGAGTATAGCCATGGCAATCTCATTGAAACTGTGTATGGCTTAGGGTATCGTTTTCAGCCCCATCCAACCC

CDS

ATGCAGAACAATAGATTATTCAATCTATCCCGTTGGCGTTTAGCCAGTTATTACGCTGGGGTCATGGGACTTATTTTGGGTCTTTGTGGCCTAGCGGTCTATGAAATGACTTCCCAGGATCATTGGCGATCGCTGGATCAAGAATTAACCTCTTTAGCAGGAACCCTCCATGATGGACTGGAACCACTATTACAACAACCGGGGCAGTTAGAGCCCTCGGTTAAACAAATTTTGCCTAATCTTTGCTTAGGTACAGTAGCTTGCCCTAGGTCGCCTCAACGGAGGCATATTCTCAACGCAACCCAACAGCCGGGCTATTATGTCCGGTTTTTGGACTTAAACGGTCAATTATTAGCAACGGCAGGGGAAAATCCCCCAGGCTTAGCCTTTGAGCGGGAAACCACCCGTCAAAAACCATTAACGGATCAAAAAGGGAACCGCTATCACCAAGTTTCTTTGCTGTTAAAAACCACCACTGGTGAACCTTGGGGCTATTTAAAGGTGGGGCGCTCCTTGGTGGAATATGACCATCATTTGCACACGATCCAAGGCTTTTTAGTTTGGGGTTTACCCATTGTGATGATTGTGGTCGGTGGTGCTAGTTGGTGGTTAGCAGGCTTAGCCATGGAGCCGGTTTATCGTTCCTACCAACAAATCCAGCAGTTCACCGCTGATATTGCCCACGAATTACGTACACCGATTACGGCGATTCAGGCAACGTTGGAAACGACATTAAATGCAGAACCTAATGCTGAAGAAACCCATAGCACCTTGCAAACCTTAAAACGACAAAATTATCGTCTCAGCCATTTAATCCATGATTTATTACTCCTCTCCCGCATGGATTTAACAACAGTTAATCCGACCCAGTTTACCCTTTGTTGTCTCAATGATTTAGTTGAAGATTTAACCGAAGAATTTGCCAGTTTGGCGATCGCCGCTGGGGTATTGTTATCTGCGAAGTTAGACAATCAAGCAAATATCTGGGTCAGGGGAGAAGAAGAACAGCTTTATCGTTTGGTGGGTAATTTAATCAGTAATGCCATTCACTACACCCCAACGGGGGGCGAGGTAACCGTCATGCTTGAGACCGATAAACAGCAAGCCATCATCAAAGTCCAAGATACGGGCATTGGTATTGCTTCGGAGAATCAAAGCCGGGTTTTTGACCGTTTTTATCGGGTGGATACGGCCCGGTCTCGACAACGGGGAGGGGCAGGATTAGGCCTTGCCATTGCCCAGGCGATCGCCGTTAAGCATAGGGGGTCTTTAACGGTGGAGAGTGAATTGGGGCAAGGCAGTCTTTTCACCGTCCAGTTGCCCCTTGTTTCTGCACCGATAGTTCAGTCGTAA

Protein

No sequence available