Your browser is old and dusty. Try Google Chrome!

Details for slr6034

ORF slr6034
Accession NP_942477.1
Symbol
Category Interconversions and salvage of nucleosides and nucleotides
Definition cytidine deaminase
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_441061.1_2 Reverse -306 -320 6.58777 0.115
NP_441418.1_6 Reverse -305 -324 -19.7651 0.0955
NP_441453.1_4 Reverse -305 -313 14.8674 0.00947
NP_441453.1_4 Forward -314 -306 6.80426 0.121
NP_440226.1_1 Reverse -305 -324 4.42435 0.192
NP_440226.1_1 Forward -314 -295 3.34271 0.229
NP_441098.1_6 Reverse -284 -303 10.0284 0.296
NP_441976.1_2 Reverse -381 -400 12.9783 0.257
NP_442287.1_1 Reverse -1 -11 15.3192 0.22
NP_442655.1_8 Reverse -198 -217 16.8141 0.138
NP_442173.1_1 Forward -313 -305 13.8841 0.0225
NP_442173.1_1 Reverse -306 -314 12.0158 0.0316
NP_442752.1_4 Forward -314 -307 13.8055 0.0199
NP_442975.1_10 Forward -318 -304 3.24392 0.26
NP_441675.1_4 Forward -380 -361 2.26107 0.294
NP_440784.1_7 Forward -313 -306 6.23397 0.241
NP_440784.1_7 Reverse -306 -313 6.13563 0.241
NP_442062.1_8 Reverse -305 -315 7.15819 0.107
NP_440304.1_4 Forward -342 -332 3.32329 0.299
NP_441208.1_9 Reverse -302 -316 6.78443 0.229
NP_440370.1_10 Reverse -296 -315 8.75091 0.24
NP_442726.1_1 Forward -215 -196 7.47261 0.296
NP_441083.1_5 Reverse -305 -315 0.865012 0.218
NP_441083.1_5 Forward -314 -304 -1.10161 0.295
NP_441738.1_2 Reverse -307 -314 15.28 0.0102
NP_441558.1_5 Forward -316 -297 6.09597 0.229
NP_440209.1_1 Forward -314 -306 8.57422 0.0425
NP_442111.1_4 Reverse -304 -318 5.70279 0.154
NP_440906.1_5 Forward -313 -306 6.23397 0.234
NP_440906.1_5 Reverse -306 -313 6.13563 0.241
NP_440747.1_10 Reverse -302 -314 -4.28759 0.0903
NP_441486.1_1 Forward -317 -303 5.40779 0.037
NP_440842.1_5 Reverse -276 -295 12.4797 0.283
NP_442848.1_1 Forward -320 -306 -3.34366 0.265
NP_443018.1_3 Reverse -306 -313 11.7405 0.0655
NP_443018.1_3 Forward -295 -288 8.39725 0.147
NP_443018.1_3 Forward -313 -306 5.44732 0.193
NP_440376.1_1 Forward -314 -305 5.89959 0.116
NP_440376.1_1 Forward -11 -2 1.76968 0.242
NP_440376.1_1 Reverse -305 -314 -0.0986038 0.285
NP_441588.1_4 Reverse -307 -317 6.96153 0.178
NP_442687.1_7 Forward -315 -305 12.5664 0.0712
NP_442958.1_3 Forward -293 -274 -1.18052 0.271
NP_442658.1_1 Forward -316 -306 6.17443 0.235
NP_442782.1_2 Forward -314 -300 5.30946 0.245
NP_440607.1_8 Forward -234 -215 -1.08219 0.299
NP_441958.1_5 Forward -315 -305 8.73149 0.0255
NP_441958.1_5 Reverse -304 -314 1.65166 0.0872
NP_441580.1_6 Forward -325 -306 -5.70374 0.235
NP_440615.1_2 Reverse -10 -29 4.22769 0.296
NP_442002.1_9 Forward -315 -308 10.7572 0.185
NP_440147.1_4 Reverse -303 -316 -0.275709 0.279
NP_441295.1_4 Reverse -306 -325 3.14605 0.29
NP_441550.1_8 Reverse -303 -313 9.51767 0.0926
NP_441550.1_8 Forward -316 -306 4.7978 0.283
NP_441916.1_7 Reverse -305 -315 9.51814 0.0338
NP_441916.1_7 Forward -314 -304 7.15819 0.0745
NP_440206.1_9 Forward -29 -10 9.73422 0.272
NP_441041.1_4 Reverse -305 -324 -1.57384 0.101
NP_442004.1_6 Forward -314 -300 1.76955 0.278
NP_441725.1_5 Reverse -306 -316 1.455 0.135
NP_439966.1_7 Forward -316 -306 8.73102 0.13
NP_439966.1_9 Forward -316 -307 0.983037 0.253
NP_442941.1_3 Reverse -306 -316 1.65166 0.147
NP_442941.1_3 Forward -313 -303 -1.19994 0.288
NP_440289.1_2 Forward -317 -304 -4.50394 0.288
NP_442281.1_1 Reverse -300 -314 7.27547 0.104
NP_442281.1_1 Forward -319 -305 6.88214 0.113
NP_441334.1_7 Reverse -303 -322 -20.5517 0.277
NP_440177.1_9 Forward -144 -125 11.0125 0.292
NP_440498.1_1 Reverse -296 -314 -3.91409 0.281
NP_442982.1_5 Reverse -140 -159 0.884433 0.233
NP_441644.1_6 Reverse -305 -315 7.45273 0.124
NP_440929.1_8 Reverse -305 -314 7.17789 0.0713
NP_442933.1_10 Reverse -305 -314 8.06287 0.0885
NP_442933.1_10 Forward -314 -305 7.96454 0.0937
NP_442554.1_8 Forward -313 -303 4.40493 0.188
NP_442554.1_8 Reverse -306 -316 4.0116 0.2
NP_441762.1_7 Reverse -304 -316 -5.07423 0.187
NP_442142.1_4 Forward -317 -304 5.23026 0.197
NP_442292.1_1 Reverse -306 -315 -0.196935 0.239
NP_440039.1_9 Forward -325 -306 13.5691 0.269
NP_442476.1_6 Reverse -274 -288 0.589577 0.252
NP_443009.1_5 Reverse -304 -315 5.95804 0.18
NP_442408.2_1 Reverse -305 -324 -4.13045 0.256
NP_441715.1_4 Reverse -306 -316 6.46988 0.143
NP_441468.1_1 Forward -313 -306 6.13563 0.209
NP_441468.1_1 Reverse -306 -313 6.0373 0.223
NP_441020.2_6 Forward -316 -299 8.29864 0.203
NP_441020.2_6 Reverse -303 -320 6.43035 0.262
NP_441673.1_1 Forward -314 -305 1.27803 0.155
NP_441673.1_1 Reverse -305 -314 1.27803 0.155
NP_441876.1_9 Forward -269 -259 13.4509 0.267
NP_441826.1_2 Forward -320 -306 0.88457 0.17
NP_441826.1_2 Reverse -305 -319 -2.36035 0.271
NP_441330.1_1 Reverse -282 -301 -15.2418 0.27
NP_442868.1_6 Forward -86 -76 3.61828 0.195
NP_442361.1_3 Forward -320 -307 17.6205 0.0481
NP_442427.1_3 Reverse -361 -379 2.77242 0.18
NP_442808.1_1 Forward -87 -77 2.33954 0.27
NP_442542.1_9 Forward -321 -307 10.6187 0.111
NP_440111.2_2 Forward -325 -306 -2.65548 0.258
NP_441518.1_3 Forward -324 -305 2.45773 0.0591
NP_441036.1_8 Forward -315 -305 12.5664 0.0744
NP_441036.1_8 Reverse -304 -314 6.07655 0.242
NP_441557.1_5 Forward -314 -305 8.94785 0.0289
NP_441557.1_5 Reverse -305 -314 0.688044 0.128
NP_441308.1_8 Forward -316 -306 8.4365 0.254
NP_442183.1_1 Reverse -305 -319 9.83269 0.0926
NP_442347.1_2 Reverse -306 -315 8.94785 0.0718
NP_442645.1_2 Reverse -297 -316 -22.2233 0.29
NP_440136.1_2 Forward -313 -306 6.23397 0.171
NP_440136.1_2 Reverse -306 -313 6.13563 0.193
NP_442998.1_10 Reverse -307 -314 15.5754 0.0102
NP_440299.1_1 Forward -318 -305 2.47701 0.288
NP_441799.1_1 Reverse -301 -315 15.7319 0.0167
NP_440256.1_1 Reverse -302 -321 13.3725 0.0103
NP_441559.1_8 Reverse -71 -85 -6.68692 0.279
NP_440915.1_6 Forward -318 -304 5.99778 0.0871
NP_440915.1_6 Forward -399 -385 -3.147 0.29
NP_441704.1_8 Reverse -116 -135 5.80018 0.277
NP_442866.1_1 Reverse -300 -319 -9.83364 0.3
NP_442993.1_1 Forward -314 -298 -10.9545 0.231
NP_442386.1_9 Forward -315 -306 5.9975 0.23
NP_442386.1_9 Forward -347 -338 5.40752 0.253
NP_441340.1_5 Forward -313 -306 13.5105 0.0314
NP_441340.1_5 Reverse -306 -313 5.84064 0.208
NP_442240.1_2 Forward -295 -276 -20.7484 0.295
NP_440586.1_8 Reverse -306 -313 9.47853 0.146
NP_440586.1_8 Forward -295 -288 7.21693 0.27
NP_440586.1_8 Forward -313 -306 5.74197 0.283
NP_441262.1_3 Forward -314 -307 14.7888 0.0223
NP_440027.1_3 Reverse -295 -313 2.37835 0.29
NP_443051.1_1 Forward -315 -306 7.47288 0.0571
NP_443051.1_1 Reverse -304 -313 0.393051 0.169
NP_441595.1_2 Reverse -58 -71 9.13351 0.278
NP_440439.1_1 Forward -317 -304 6.50913 0.0755
NP_440372.1_2 Forward -313 -306 13.8055 0.0214
NP_440372.1_2 Reverse -306 -313 6.52896 0.188
NP_442384.1_10 Reverse -305 -318 4.73917 0.148
NP_442790.1_4 Forward -323 -304 -13.0786 0.257
NP_442262.1_10 Reverse -306 -313 13.2155 0.0213
NP_442262.1_10 Forward -295 -288 10.7572 0.124
NP_441689.1_5 Reverse -303 -313 8.3377 0.132
NP_441689.1_5 Forward -316 -306 5.97777 0.197
NP_440163.1_10 Forward -317 -307 15.2213 0.0762
NP_440344.1_10 Forward -321 -304 -2.12444 0.0609
NP_440189.1_2 Reverse -297 -316 1.86774 0.268
NP_440297.1_9 Reverse -306 -316 -0.511621 0.289
NP_440888.1_2 Reverse -305 -319 13.372 0.0297
NP_441543.1_2 Reverse -306 -315 8.65285 0.0968
NP_441543.1_2 Forward -129 -120 5.21127 0.209
NP_441469.1_8 Forward -315 -306 6.39124 0.227
NP_442578.1_7 Forward -313 -306 6.0373 0.18
NP_441462.1_2 Forward -314 -304 17.4829 0.00406
NP_441621.1_7 Forward -325 -311 -6.39192 0.29
NP_443062.1_1 Reverse -305 -323 9.22847 0.138
NP_442204.1_1 Forward -318 -307 0.353664 0.281
NP_440516.1_8 Forward -314 -305 9.4395 0.0183
NP_440516.1_8 Reverse -305 -314 5.11294 0.118
NP_441785.1_1 Reverse -305 -319 17.5862 0.0726
NP_442428.1_5 Forward -313 -306 6.13563 0.209
NP_442428.1_5 Reverse -306 -313 6.0373 0.212
NP_440673.1_3 Reverse -307 -314 12.4288 0.0426
NP_440673.1_3 Reverse -333 -340 6.23397 0.283
NP_441714.1_2 Forward -79 -61 12.1139 0.244
NP_440436.1_4 Reverse -306 -315 8.55409 0.0997
NP_441884.1_8 Forward -315 -296 -0.983855 0.138
NP_441719.1_4 Forward -313 -306 6.82395 0.0855
NP_441719.1_4 Reverse -306 -313 6.52896 0.188
NP_442813.1_4 Reverse -303 -322 -9.14533 0.299
NP_440129.1_10 Forward -321 -307 13.4709 0.0534
NP_442206.1_10 Forward -314 -299 0.373221 0.261
NP_441851.1_10 Forward -315 -305 7.55152 0.137
NP_442515.1_1 Reverse -1 -15 1.96621 0.145
NP_441982.1_6 Reverse -109 -118 14.9681 0.274
NP_440940.1_7 Forward -324 -306 2.57501 0.298
NP_441349.1_10 Forward -350 -331 -5.99873 0.217
NP_440474.1_1 Forward -331 -312 15.6332 0.149
NP_440396.1_7 Forward -335 -316 19.3698 0.191
NP_440877.1_1 Reverse -184 -203 8.94757 0.296
NP_440431.1_4 Reverse -227 -246 -5.68219 0.246
NP_442168.1_5 Forward -313 -294 0.58944 0.245
NP_441003.1_3 Forward -39 -20 17.3057 0.245
NP_441570.1_1 Reverse -305 -323 0.314141 0.0395
NP_441078.1_4 Reverse -305 -314 0.0980582 0.205
NP_441078.1_4 Forward -314 -305 0.0980582 0.205
NP_441432.1_8 Forward -315 -306 5.50626 0.151
NP_442320.1_8 Forward -320 -306 3.44117 0.0617
NP_440497.1_2 Reverse -306 -325 10.1275 0.201
NP_440199.1_10 Forward -317 -307 14.533 0.0861
NP_440913.1_1 Forward -298 -280 8.7706 0.183
NP_441072.1_2 Reverse -294 -313 5.70265 0.296
NP_442489.1_7 Reverse -305 -314 0.786375 0.152
NP_442489.1_7 Forward -314 -305 0.589713 0.17
NP_442079.1_7 Reverse -306 -325 2.85105 0.222
NP_440559.1_1 Forward -313 -304 5.99792 0.135
NP_441659.2_8 Reverse -305 -315 6.56821 0.0714
NP_441659.2_8 Forward -314 -304 1.74999 0.227
NP_442913.1_10 Forward -291 -272 -6.29373 0.3
NP_442346.1_5 Reverse -304 -314 4.3066 0.291
NP_440352.1_5 Reverse -253 -272 10.8063 0.27
NP_440545.1_3 Reverse -301 -318 -6.15601 0.27
NP_440486.1_4 Forward -26 -8 -4.60241 0.268
NP_440459.1_2 Reverse -285 -302 17.1484 0.0834
NP_441653.1_2 Forward -325 -306 3.91615 0.264
NP_442027.1_5 Reverse -12 -31 9.73422 0.29
NP_440847.1_3 Reverse -324 -338 11.5037 0.263
NP_441888.1_7 Forward -319 -305 3.53951 0.225
NP_441833.1_4 Reverse -306 -313 6.52896 0.0924
NP_441833.1_4 Forward -313 -306 6.23397 0.163
NP_442162.1_9 Forward -313 -306 12.9205 0.0282
NP_442162.1_9 Reverse -306 -313 12.9205 0.0282
NP_440671.1_4 Forward -320 -306 10.816 0.149
NP_442199.1_7 Reverse -57 -76 4.12856 0.245
NP_442199.1_7 Forward -360 -341 0.195343 0.286
NP_442140.1_3 Reverse -306 -316 6.27322 0.176
NP_442021.1_2 Forward -387 -368 8.75091 0.27
NP_440875.1_9 Forward -294 -284 12.2655 0.127
NP_440875.1_9 Reverse -307 -317 8.37203 0.233
NP_441813.1_5 Forward -316 -306 7.45319 0.0746
NP_441813.1_5 Reverse -303 -313 4.69992 0.148
NP_440590.1_4 Reverse -306 -319 -3.61896 0.255
NP_440567.1_1 Reverse -306 -320 2.65453 0.167
NP_440567.1_1 Forward -313 -299 0.196253 0.254
NP_442497.1_10 Forward -313 -304 5.99792 0.095
NP_442497.1_10 Reverse -306 -315 0.589713 0.153
NP_440821.1_4 Forward -316 -306 9.32148 0.03
NP_441239.1_9 Reverse -303 -315 10.8554 0.0714
NP_441892.1_1 Forward -323 -306 0.727158 0.163
NP_440900.1_4 Reverse -313 -332 16.0416 0.271
NP_442138.1_10 Reverse -305 -324 -0.688862 0.16
NP_440546.1_4 Forward -314 -304 16.1543 0.0459
NP_440546.1_4 Reverse -305 -315 10.046 0.109
NP_440462.1_4 Forward -397 -383 7.57108 0.278
NP_440462.1_6 Reverse -303 -313 6.8632 0.0967
NP_440462.1_6 Forward -316 -306 5.87989 0.135
NP_442899.1_4 Reverse -230 -246 5.85938 0.276
NP_440868.1_4 Reverse -283 -295 0.825626 0.199
NP_440868.1_4 Forward -318 -306 -0.846001 0.282
NP_442402.1_4 Reverse -69 -88 -8.06442 0.278
NP_441848.1_7 Reverse -371 -390 -1.37794 0.247
NP_441848.1_10 Forward -73 -60 18.9678 0.0736
NP_442023.1_2 Reverse -286 -305 3.44104 0.296
NP_442039.1_4 Forward -313 -306 11.6422 0.0747
NP_441180.1_2 Forward -336 -317 12.1291 0.287
NP_440825.1_6 Reverse -160 -179 6.98095 0.291
NP_442837.1_3 Forward -313 -306 6.0373 0.25
NP_442837.1_3 Reverse -306 -313 6.0373 0.25
NP_442053.1_1 Reverse -305 -314 7.17789 0.104
NP_440505.1_3 Forward -316 -306 12.2714 0.0543
NP_441203.1_1 Forward -313 -294 -15.5368 0.233
NP_442255.1_5 Reverse -337 -356 9.63589 0.255
NP_441011.1_8 Forward -313 -304 14.356 0.0249
NP_441011.1_8 Reverse -306 -315 7.07956 0.179
NP_442533.1_6 Forward -314 -305 5.40793 0.14
NP_442533.1_6 Reverse -305 -314 4.52295 0.179
NP_441482.1_7 Reverse -299 -313 -3.04867 0.106
NP_441482.1_7 Forward -320 -306 -10.9151 0.222
NP_440116.1_8 Forward -313 -294 -4.22878 0.164
NP_440007.1_9 Forward -318 -304 2.5562 0.277
NP_441106.1_1 Forward -315 -306 8.45619 0.0548
NP_441106.1_1 Reverse -304 -313 7.96454 0.0647
NP_439903.1_6 Reverse -302 -321 1.17865 0.253
NP_442704.1_7 Forward -334 -315 11.0125 0.272
NP_440670.1_8 Forward -314 -305 8.65285 0.0627
NP_440670.1_8 Reverse -305 -314 6.29291 0.124
NP_441930.1_3 Reverse -64 -83 13.6331 0.191
NP_441930.1_3 Reverse -63 -82 3.15712 0.288
NP_440907.2_8 Reverse -47 -57 6.86274 0.144
NP_440907.2_8 Reverse -306 -316 6.0761 0.179
NP_441626.1_2 Forward -313 -306 12.2322 0.0511
NP_441626.1_2 Reverse -306 -313 5.93897 0.231
NP_442615.1_1 Reverse -296 -314 6.11567 0.0364
NP_441962.1_4 Reverse -300 -319 -14.8485 0.294
NP_440387.1_1 Forward -314 -298 2.91013 0.0693
NP_441431.1_2 Forward -317 -303 6.78381 0.261
NP_441488.1_8 Reverse -282 -296 7.07881 0.275
NP_441836.1_1 Forward -147 -128 13.1551 0.232
NP_440634.1_6 Reverse -1 -15 19.1741 0.0808
NP_440114.1_10 Forward -314 -300 7.47274 0.235
NP_441510.2_7 Forward -320 -306 17.3052 0.215
NP_440766.1_4 Forward -318 -304 12.291 0.0556
NP_441246.1_7 Forward -400 -381 1.47442 0.265
NP_442930.1_1 Reverse -64 -74 13.0576 0.239
NP_440457.1_1 Forward -318 -306 9.28209 0.0929
NP_440798.1_6 Forward -313 -300 0.314277 0.274
NP_440473.1_9 Forward -325 -306 -11.5053 0.293
NP_442509.1_9 Reverse -3 -13 6.46942 0.268
NP_442439.1_8 Reverse -120 -139 11.6025 0.221
NP_440554.1_4 Reverse -306 -316 11.6814 0.0377
NP_441845.1_6 Forward -326 -308 -0.669169 0.274
NP_441885.1_5 Forward -314 -304 7.84651 0.0419
NP_442703.1_9 Reverse -236 -254 3.06741 0.3
NP_442341.1_7 Reverse -304 -318 1.57289 0.286
NP_442341.1_9 Forward -316 -302 5.40719 0.271
NP_440750.1_5 Reverse -54 -68 15.1426 0.0968
NP_440750.1_5 Reverse -241 -255 5.60446 0.255
NP_441842.1_10 Forward -321 -307 15.0442 0.0474
NP_440275.1_3 Forward -316 -306 5.87989 0.13
NP_440091.1_1 Forward -318 -306 1.02229 0.218
NP_440679.1_10 Reverse -307 -326 -6.39206 0.161
NP_441730.1_2 Forward -72 -54 18.407 0.188
NP_440216.1_1 Forward -296 -282 -6.58858 0.145
NP_440216.1_9 Reverse -289 -298 10.6195 0.286
NP_440172.1_1 Forward -314 -304 10.1081 0.0551
NP_442371.1_1 Reverse -60 -70 12.4676 0.249
NP_442015.1_10 Forward -300 -287 0.117615 0.241
NP_441226.1_7 Forward -313 -306 12.7234 0.0312
NP_441226.1_7 Reverse -306 -313 11.5435 0.0757
NP_441111.1_7 Reverse -306 -314 8.86921 0.0589
NP_441766.1_2 Forward -314 -305 8.1612 0.0645
NP_441766.1_2 Reverse -305 -314 5.89959 0.103
NP_442417.1_5 Reverse -305 -319 11.8976 0.0981
NP_440416.1_9 Forward -321 -302 -17.6018 0.243
NP_442116.1_6 Forward -122 -105 11.4157 0.198
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

GGTGCAGGAATGGGATAGAAAGAAAGTGGATGTAATCCTCATTCTGCAATATCTTGGCAAGGCAACGGACTAATTGACCCCACAACGGCGATCGGTTAGCCTCTTCCGATGGACTGGTGTGGATTGCATAATTAGCCCCTAGTAATTTTTGGAGACTGTTACCTGATCTTTGTTGGATGAACTGAACTTTCACCTAGTTGAGTTTGTAGCCTGATGCGTATGCGAATTACCAAATATTTGCGTACTTGGACTTTTGGATGTTTAGTCAGTTGCCATAAATGCTTTTTGACTACATTGGAAGAATCCGTTTTATTCTCGAAACCCCTGGTAATTTTTTTGAGACTGTTGGATAGCTAGAAAGTACAGTAAAGTCACCAACGGATAATTCGGGGTTTTGCCA

CDS

ATGGTTGATATTTGTTGGGAGCAGTTACATCGATCTGCCATTGAGGTTCGACAAAATGCCTATGCCCCCTATTCTCATTTTTTAGTGGGGGCGGCAGGACTCGTGGATGACGGGCGAATTGTTGTTGGTTGTAATGTCGAAAATGCCTCCTATGGCTTAACCCTTTGTGCCGAGTGTGGTTTGGTTTCCCATTTGATAGCTACTGGCGGGGGACGTTTACTGGCAGTGGTCTGTGTTGATAGTCAGGATAATTATCTTGCTCCCTGTGGCCGCTGTCGTCAGGTTTTGTTGGAGCATGGCGGTAAGGAATTACAAGTTATGACCCCCACCGGGCCGCTATCAATGGCTGAATTATTGCCCTGGTCATTTGGCCCACAAGATTTACGTCGGATTGGTGGATTGAACACAAACCCCTAG

Protein

No sequence available