Your browser is old and dusty. Try Google Chrome!

Details for slr6029

ORF slr6029
Accession NP_942472.1
Symbol
Category
Definition
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_440557.1_1 Reverse -48 -67 2.26107 0.24
NP_440795.1_10 Reverse -303 -322 15.8299 0.195
NP_441453.1_8 Forward -265 -248 13.2152 0.205
NP_440259.1_4 Reverse -45 -59 16.4448 0.131
NP_442074.1_5 Reverse -249 -268 16.5191 0.237
NP_440761.1_3 Forward -64 -45 9.69258 0.263
NP_441802.1_1 Forward -65 -46 12.5858 0.182
NP_441802.1_1 Forward -52 -33 5.50599 0.283
NP_440304.1_4 Reverse -332 -342 5.97822 0.185
NP_440916.1_1 Forward -363 -349 11.3077 0.206
NP_441738.1_2 Forward -358 -351 6.52862 0.261
NP_441770.1_4 Reverse -62 -81 -8.94866 0.246
NP_442111.1_4 Reverse -176 -190 7.17775 0.103
NP_442111.1_4 Forward -92 -78 2.45787 0.276
NP_440906.1_9 Forward -71 -52 13.6666 0.296
NP_441014.1_10 Reverse -196 -215 -2.8529 0.289
NP_442687.1_7 Forward -258 -248 8.73149 0.101
NP_442687.1_7 Reverse -341 -351 4.50326 0.245
NP_440642.1_10 Forward -144 -130 5.40719 0.241
NP_440887.1_4 Reverse -57 -76 15.065 0.242
NP_440656.1_8 Reverse -323 -342 -4.72043 0.208
NP_440800.1_2 Reverse -370 -389 13.6108 0.299
NP_441958.1_1 Reverse -245 -264 11.8865 0.295
NP_442836.1_3 Forward -141 -122 17.7819 0.199
NP_440984.1_7 Forward -163 -149 4.71948 0.292
NP_442002.1_9 Reverse -234 -241 11.3472 0.185
NP_442885.1_4 Reverse -54 -67 14.5663 0.294
NP_441110.1_10 Reverse -293 -312 17.8957 0.0948
NP_440147.1_4 Forward -330 -317 -0.177378 0.276
NP_440147.1_4 Forward -188 -175 -0.472371 0.287
NP_439966.1_9 Reverse -349 -358 13.5694 0.0863
NP_440289.1_2 Forward -396 -383 -2.24233 0.253
NP_442982.1_2 Forward -313 -295 14.7688 0.271
NP_441795.1_5 Reverse -42 -61 5.80098 0.255
NP_442247.1_8 Reverse -253 -267 9.5377 0.247
NP_442313.1_5 Reverse -243 -262 6.29264 0.236
NP_442408.2_5 Forward -384 -365 15.7847 0.299
NP_440620.1_4 Forward -69 -55 14.3354 0.272
NP_442542.1_9 Reverse -384 -398 5.60385 0.26
NP_442050.1_5 Forward -362 -352 7.74772 0.243
NP_441114.1_3 Forward -141 -132 6.5879 0.262
NP_442135.1_4 Reverse -129 -148 18.0187 0.224
NP_440899.1_8 Reverse -82 -101 -8.16202 0.254
NP_441007.1_5 Forward -142 -123 11.1109 0.214
NP_441559.1_9 Forward -58 -39 11.8975 0.233
NP_441270.1_5 Reverse -260 -279 14.6533 0.211
NP_442069.1_6 Forward -49 -30 7.47261 0.224
NP_440134.1_2 Forward -320 -301 -0.39387 0.298
NP_442452.1_3 Reverse -323 -342 1.27776 0.282
NP_440146.1_8 Reverse -154 -172 14.9878 0.255
NP_440059.1_3 Forward -153 -134 6.48849 0.266
NP_441254.1_1 Reverse -115 -128 10.3434 0.295
NP_440586.1_1 Reverse -251 -270 -3.14714 0.263
NP_441138.1_5 Reverse -360 -373 8.17859 0.256
NP_441689.1_5 Forward -362 -352 12.1726 0.132
NP_442280.1_10 Reverse -66 -84 9.35044 0.233
NP_441304.1_10 Reverse -232 -241 16.6177 0.164
NP_440220.1_4 Reverse -214 -233 -0.0996487 0.257
NP_441621.1_4 Forward -241 -228 19.4888 0.246
NP_441929.1_3 Reverse -273 -292 2.0644 0.278
NP_443062.1_6 Reverse -240 -259 7.66927 0.162
NP_440939.1_5 Forward -321 -305 10.4816 0.273
NP_442204.1_1 Reverse -342 -353 5.8602 0.186
NP_440818.1_1 Forward -67 -48 -5.40875 0.295
NP_441321.1_5 Reverse -218 -237 1.76941 0.287
NP_440689.1_7 Reverse -112 -130 20.0778 0.13
NP_442577.1_9 Forward -381 -367 9.83206 0.298
NP_442813.1_4 Reverse -45 -64 -4.22878 0.297
NP_442813.1_4 Forward -143 -124 -5.11376 0.299
NP_442366.1_3 Reverse -176 -194 -4.60241 0.274
NP_439949.1_7 Forward -286 -272 12.1926 0.269
NP_442206.1_10 Reverse -346 -361 -0.413427 0.292
NP_441851.1_10 Reverse -350 -360 8.73149 0.114
NP_441851.1_10 Forward -51 -41 7.25653 0.144
NP_441668.1_4 Reverse -219 -238 -0.688862 0.261
NP_441982.1_6 Forward -312 -303 13.5358 0.274
NP_441982.1_6 Forward -64 -55 11.1485 0.288
NP_439950.1_1 Forward -386 -377 13.5694 0.266
NP_439950.1_1 Forward -230 -221 13.2744 0.277
NP_440195.1_5 Reverse -229 -248 7.86593 0.174
NP_442006.1_2 Reverse -125 -142 -10.4826 0.197
NP_442348.1_2 Reverse -60 -69 6.5879 0.299
NP_441432.1_9 Reverse -294 -307 10.3436 0.252
NP_440578.1_10 Forward -342 -323 8.84924 0.286
NP_442400.1_10 Forward -69 -56 7.70113 0.282
NP_440284.1_9 Reverse -139 -158 17.5024 0.012
NP_442857.1_4 Reverse -273 -292 16.7565 0.197
NP_442875.1_7 Reverse -278 -297 12.6833 0.259
NP_441888.1_10 Forward -78 -59 19.7546 0.0904
NP_441329.1_6 Forward -59 -40 4.24897 0.206
NP_440204.1_8 Reverse -49 -68 15.3391 0.193
NP_440875.1_9 Forward -358 -348 8.95605 0.233
NP_442193.1_1 Reverse -47 -65 8.96727 0.26
NP_441154.1_3 Forward -140 -121 5.30933 0.175
NP_440675.1_3 Forward -151 -132 4.81767 0.3
NP_442402.1_4 Reverse -294 -313 -4.81951 0.231
NP_441848.1_4 Forward -317 -301 8.50558 0.288
NP_442039.1_7 Forward -54 -44 9.32148 0.257
NP_442273.1_6 Forward -312 -294 19.3335 0.158
NP_442679.1_1 Forward -52 -33 -0.4922 0.221
NP_442829.1_2 Forward -57 -41 9.20406 0.287
NP_441252.1_6 Forward -313 -306 14.3954 0.168
NP_440263.1_5 Reverse -55 -69 7.57108 0.294
NP_441527.1_4 Forward -375 -356 -9.31089 0.256
NP_441527.1_4 Forward -69 -50 -10.4568 0.27
NP_441527.1_4 Forward -306 -287 -11.2207 0.278
NP_441527.1_4 Forward -58 -39 -12.3666 0.285
NP_439903.1_6 Reverse -331 -350 -0.197979 0.277
NP_440670.1_8 Forward -186 -177 3.63797 0.239
NP_442908.1_1 Reverse -42 -61 3.44104 0.277
NP_440841.1_4 Forward -374 -355 -8.94866 0.251
NP_441460.1_5 Reverse -271 -285 15.9285 0.214
NP_441742.1_10 Forward -355 -342 17.3198 0.245
NP_441431.1_2 Forward -354 -340 7.3738 0.244
NP_440766.1_5 Forward -313 -301 8.03776 0.286
NP_442582.1_8 Reverse -292 -310 5.13236 0.28
NP_442514.1_5 Forward -194 -175 -8.35941 0.285
NP_442862.1_3 Forward -144 -127 6.52869 0.263
NP_441885.1_5 Forward -186 -176 -1.59326 0.273
NP_441173.1_9 Reverse -304 -312 12.1137 0.21
NP_440507.2_8 Forward -309 -290 3.83436 0.269
NP_441902.1_3 Forward -313 -303 13.7591 0.226
NP_440216.1_9 Forward -235 -226 8.65285 0.286
NP_440172.1_1 Reverse -255 -265 2.53664 0.277
NP_440172.1_1 Reverse -334 -344 2.43831 0.279
NP_442015.1_10 Reverse -37 -50 0.707601 0.221
NP_443052.1_8 Reverse -132 -151 -5.31042 0.129
NP_442226.1_8 Reverse -55 -65 15.6147 0.167
NP_440988.1_5 Reverse -373 -392 12.9585 0.28
NP_440988.1_5 Reverse -306 -325 12.9585 0.28
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

GAATACCGACGCTTGCGAGATTTAGCAGAACAATCAGAAAATCAATCCCAGCGACTACGCAATTACCTTGTTAGCAATATGCAGAAGTTGGGCAAAAAGAAAGTTAATGGAGTATCGGTAAATTTATCACTACGGAAGAAACCGGCAAAAGTCGTTCTTAATTGCCCCTTGGAAGATTTACCAGCCGCATTTATGAAAGTCGAAATTACACCTCGCCTATCGGAACTTAAAAAGCACCTTCAGAGCAACGCTGATTGTTCCTTTGCTCAATTGGCGGATGTTGAAGAATATTCAGTGATGATCAAGTAAACCGAAAGACCTGGGCAAGTCTAAAACTGCCCAAAAAAAATGGCGAACCAAAAGGGACACCACTCAAATACTATCCATAGGATAACAAACC

CDS

ATGCTCCTAGCCGAAATTCTCGAAAACCTACGCCAACCCATTGCCCCCCAATTCATTAGCCAGAAAAAAACCTTCAAAAACAAAAAACCGACTGGTTCCGTTGATTTTGTGGCCTGGTATGACCTAGCGGACTTGCTCGACGATCTTTGTGGCCTGGGGGGTTGGGAATGGTTAATCATCGACACCCAACAAATTGGCGATCGCCTAACCCTCACCGGCTCCCTCACGATCCATGGGGATGACCGCAGTTTGACCAGGCAGGCCACCGGCACTGAAGACATTGATTGCAATAGCTACGGTGATCCAAGCTCCAATGCGGAGGCCATGGCCCTGAGAAGATGTTGCGCCAAGTTTGGCCTGGGCCGTGACCTATGGCGGAAAAACAAACCCCAGCCCCTCAAAATGGGACAACGGCAAGAACCAGAGAAACAGACAGTTTTGGCCCCTGGCACTATCTCACGGGAAGAATGGCTCAAGAGAAAACAAGCCAAATCCTAA

Protein

No sequence available