Your browser is old and dusty. Try Google Chrome!

Details for slr6014

ORF slr6014
Accession NP_942457.1
Symbol
Category
Definition
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_441061.1_2 Reverse -293 -307 7.86607 0.0956
NP_442100.1_1 Reverse -51 -70 6.82725 0.277
NP_441453.1_1 Forward -98 -80 2.87 0.282
NP_441453.1_4 Reverse -293 -301 5.23096 0.157
NP_442151.1_6 Forward -302 -288 6.78443 0.221
NP_441098.1_3 Reverse -35 -54 -6.11904 0.28
NP_441098.1_3 Forward -30 -11 -6.59756 0.28
NP_441098.1_3 Forward -46 -27 -7.17178 0.285
NP_442173.1_1 Forward -301 -293 9.45919 0.0825
NP_442173.1_1 Reverse -229 -237 6.70593 0.188
NP_441812.1_3 Reverse -100 -114 7.57108 0.272
NP_441675.1_4 Forward -23 -4 5.40766 0.24
NP_442062.1_8 Reverse -146 -156 3.61828 0.26
NP_440761.1_4 Reverse -288 -307 -14.3569 0.262
NP_441859.1_3 Forward -128 -109 4.42355 0.222
NP_440304.1_4 Forward -304 -294 8.33817 0.0811
NP_441620.1_3 Forward -309 -290 15.4374 0.227
NP_441208.1_9 Reverse -290 -304 6.09611 0.253
NP_440769.1_8 Reverse -345 -364 7.86593 0.248
NP_440856.1_4 Forward -130 -111 1.76941 0.157
NP_441083.1_5 Reverse -228 -238 2.53664 0.194
NP_441083.1_5 Reverse -293 -303 0.275027 0.237
NP_441083.1_5 Forward -302 -292 -1.10161 0.295
NP_441434.1_1 Reverse -40 -54 17.0092 0.162
NP_441434.1_6 Forward -14 -4 14.0414 0.291
NP_441738.1_2 Reverse -295 -302 13.8051 0.0221
NP_441713.1_1 Reverse -287 -306 -15.6352 0.268
NP_441716.1_2 Forward -200 -181 4.79121 0.229
NP_441716.1_2 Forward -45 -26 3.64276 0.229
NP_441327.1_1 Forward -204 -185 14.0165 0.184
NP_441327.1_1 Reverse -185 -204 8.44218 0.211
NP_441327.1_1 Reverse -29 -48 4.40559 0.268
NP_441327.1_1 Forward -21 -2 3.73283 0.276
NP_441327.1_1 Forward -49 -30 2.86785 0.279
NP_442111.1_4 Reverse -292 -306 5.1128 0.176
NP_440438.2_8 Forward -52 -33 5.70265 0.193
NP_440747.1_10 Forward -158 -146 -4.38592 0.0974
NP_440747.1_10 Forward -305 -293 -11.7607 0.142
NP_442145.1_4 Forward -55 -36 3.10306 0.299
NP_442634.1_4 Reverse -291 -305 -2.65535 0.155
NP_441012.1_4 Reverse -295 -308 6.70579 0.276
NP_440376.1_1 Forward -302 -293 12.2911 0.0198
NP_440376.1_1 Reverse -293 -302 -0.0986038 0.285
NP_442530.1_2 Reverse -58 -68 11.5831 0.284
NP_440360.1_9 Forward -54 -35 10.4225 0.243
NP_442782.1_2 Reverse -293 -307 10.521 0.173
NP_441958.1_5 Forward -303 -293 9.12481 0.025
NP_441958.1_5 Reverse -292 -302 1.65166 0.0872
NP_440203.1_5 Forward -152 -142 12.1726 0.164
NP_440203.1_5 Reverse -296 -306 10.4026 0.225
NP_442816.1_7 Forward -46 -27 7.11373 0.238
NP_442690.1_1 Forward -35 -16 -9.24366 0.195
NP_442690.1_1 Reverse -1 -20 -17.3068 0.299
NP_442064.1_1 Forward -160 -141 -9.14533 0.259
NP_443055.1_6 Forward -389 -371 4.14829 0.186
NP_441654.1_6 Reverse -2 -20 15.7582 0.219
NP_441294.1_7 Reverse -289 -303 10.6905 0.177
NP_440147.1_4 Reverse -291 -304 -0.0790467 0.271
NP_441550.1_8 Reverse -144 -154 5.58445 0.242
NP_441550.1_8 Reverse -291 -301 4.7978 0.283
NP_440345.1_3 Reverse -4 -18 11.4707 0.248
NP_441568.1_6 Forward -293 -275 11.5565 0.295
NP_441725.1_5 Forward -154 -144 1.74999 0.125
NP_440202.1_1 Reverse -42 -61 17.5302 0.246
NP_442941.1_3 Reverse -294 -304 0.373358 0.212
NP_442281.1_1 Reverse -288 -302 5.21053 0.166
NP_442172.1_1 Forward -35 -16 15.7475 0.189
NP_441644.1_6 Reverse -293 -303 9.41933 0.0767
NP_441644.1_6 Forward -302 -292 5.48612 0.188
NP_442215.1_2 Forward -157 -141 16.3815 0.0155
NP_440929.1_8 Reverse -293 -302 6.78456 0.082
NP_440929.1_8 Forward -155 -146 4.81794 0.176
NP_442933.1_1 Reverse -184 -203 12.6523 0.242
NP_442933.1_2 Reverse -24 -42 8.97823 0.257
NP_442933.1_2 Forward -282 -264 7.54585 0.257
NP_442933.1_2 Reverse -152 -170 6.30445 0.274
NP_442933.1_6 Reverse -33 -52 12.7478 0.287
NP_440382.1_2 Reverse -40 -59 4.52188 0.27
NP_441751.2_8 Reverse -294 -308 -3.34366 0.141
NP_442554.1_8 Forward -301 -291 4.79825 0.173
NP_442970.1_3 Forward -34 -16 13.4309 0.199
NP_442142.1_4 Forward -305 -292 2.28034 0.295
NP_443009.1_5 Reverse -292 -303 5.17139 0.214
NP_442301.1_1 Reverse -177 -196 8.45592 0.297
NP_441758.1_10 Forward -202 -183 2.45694 0.189
NP_441673.1_1 Forward -302 -293 1.27803 0.155
NP_441673.1_1 Reverse -293 -302 1.27803 0.155
NP_441637.1_9 Reverse -267 -285 -2.93078 0.292
NP_441764.1_4 Forward -200 -183 10.5546 0.251
NP_441764.1_4 Reverse -33 -50 9.31325 0.29
NP_441251.1_8 Forward -252 -239 11.8073 0.267
NP_440145.1_3 Reverse -283 -302 -4.42544 0.231
NP_440093.1_7 Reverse -252 -271 13.2741 0.175
NP_441878.1_6 Forward -303 -293 -7.49312 0.231
NP_441557.1_5 Forward -302 -293 0.393051 0.166
NP_441557.1_5 Reverse -293 -302 0.393051 0.166
NP_440084.1_8 Forward -54 -40 9.17885 0.29
NP_441819.1_5 Forward -367 -348 11.4109 0.261
NP_442645.1_2 Forward -310 -291 -17.7985 0.264
NP_441633.1_3 Forward -157 -144 0.60927 0.119
NP_442590.1_10 Reverse -286 -305 9.43923 0.196
NP_442998.1_10 Reverse -295 -302 6.23397 0.157
NP_441799.1_1 Reverse -289 -303 10.6187 0.0702
NP_441799.1_1 Reverse -142 -156 5.1122 0.223
NP_440256.1_1 Reverse -290 -309 -5.11376 0.174
NP_440256.1_1 Forward -305 -286 -7.37537 0.234
NP_441362.1_2 Forward -365 -346 4.21699 0.28
NP_440915.1_6 Forward -306 -292 0.982901 0.148
NP_440695.1_6 Reverse -381 -395 13.417 0.236
NP_442993.1_1 Forward -302 -286 -11.5445 0.251
NP_440677.1_6 Forward -311 -292 7.57094 0.298
NP_442386.1_9 Forward -309 -300 7.66912 0.219
NP_441340.1_5 Forward -301 -294 3.97235 0.274
NP_443028.1_4 Forward -285 -266 10.5576 0.293
NP_440161.1_3 Forward -304 -285 8.84924 0.264
NP_442251.1_6 Forward -109 -102 8.20058 0.23
NP_441262.1_3 Forward -302 -295 11.5438 0.0584
NP_440027.1_8 Reverse -289 -308 4.91521 0.285
NP_443051.1_1 Forward -303 -294 6.78456 0.071
NP_443051.1_1 Reverse -292 -301 -0.000272808 0.245
NP_443051.1_1 Reverse -145 -154 -1.18024 0.297
NP_440439.1_1 Forward -305 -292 3.85419 0.109
NP_441138.1_5 Reverse -272 -285 9.89744 0.238
NP_441138.1_5 Reverse -269 -282 3.21301 0.297
NP_441572.1_7 Reverse -140 -159 -6.58872 0.296
NP_442384.1_10 Forward -155 -142 2.77255 0.213
NP_442384.1_10 Reverse -293 -306 1.59258 0.253
NP_442114.1_8 Forward -283 -269 4.62054 0.256
NP_440530.1_6 Reverse -266 -280 18.3446 0.129
NP_441689.1_4 Reverse -187 -206 18.9547 0.0845
NP_441689.1_5 Forward -304 -294 5.48612 0.251
NP_441689.1_5 Forward -112 -102 5.48612 0.251
NP_440562.1_3 Forward -154 -137 3.67709 0.219
NP_440562.1_10 Reverse -284 -302 19.6853 0.0624
NP_440297.1_9 Forward -154 -144 6.07655 0.206
NP_442454.1_2 Forward -54 -35 12.6523 0.251
NP_442454.1_2 Reverse -36 -55 6.15881 0.298
NP_440792.1_9 Forward -364 -345 19.4947 0.144
NP_441268.1_1 Reverse -34 -53 13.9891 0.238
NP_440575.1_8 Forward -274 -255 3.34271 0.166
NP_442701.1_2 Reverse -219 -237 1.88744 0.282
NP_442710.1_7 Forward -354 -335 -8.66439 0.299
NP_440710.1_4 Forward -278 -264 13.476 0.242
NP_441462.1_2 Forward -302 -292 8.63316 0.0339
NP_441462.1_2 Reverse -293 -303 0.668351 0.135
NP_440936.1_10 Forward -367 -348 0.142815 0.241
NP_441410.1_3 Forward -311 -292 14.6508 0.124
NP_442204.1_1 Forward -306 -295 1.23864 0.277
NP_442487.1_5 Reverse -292 -311 1.96529 0.3
NP_442780.1_3 Reverse -178 -197 5.77684 0.286
NP_440516.1_8 Forward -302 -293 7.07956 0.0867
NP_440516.1_8 Reverse -293 -302 5.11294 0.118
NP_442428.1_5 Forward -154 -147 3.67736 0.298
NP_442366.1_3 Forward -303 -285 0.805796 0.163
NP_442366.1_3 Reverse -117 -135 -4.70074 0.275
NP_440296.1_6 Reverse -186 -204 13.1799 0.295
NP_442206.1_10 Reverse -146 -161 3.71647 0.181
NP_443054.1_2 Forward -304 -290 -0.0987402 0.284
NP_442689.1_8 Forward -31 -14 -7.92597 0.292
NP_442689.1_8 Forward -363 -346 -8.22096 0.294
NP_440431.1_4 Reverse -26 -45 -7.49654 0.262
NP_440431.1_4 Reverse -155 -174 -7.78302 0.27
NP_440431.1_4 Reverse -355 -374 -9.31089 0.281
NP_440588.1_2 Forward -164 -145 0.786102 0.144
NP_440040.1_8 Reverse -22 -41 10.7424 0.203
NP_442038.1_1 Reverse -347 -366 -0.4922 0.278
NP_441078.1_4 Reverse -293 -302 0.589713 0.174
NP_441078.1_4 Forward -302 -293 0.589713 0.174
NP_442388.1_3 Reverse -360 -379 6.29264 0.282
NP_442348.1_2 Reverse -234 -243 9.14451 0.28
NP_441432.1_8 Reverse -292 -301 7.96454 0.0953
NP_441432.1_8 Forward -303 -294 4.42462 0.213
NP_441432.1_8 Reverse -145 -154 2.55633 0.298
NP_441333.1_1 Forward -165 -155 13.4965 0.217
NP_440290.1_1 Forward -356 -347 16.0328 0.292
NP_442400.1_10 Forward -286 -273 7.89211 0.281
NP_442489.1_7 Forward -302 -293 7.86621 0.0448
NP_442489.1_7 Reverse -293 -302 0.786375 0.152
NP_441659.2_8 Reverse -293 -303 8.33817 0.0443
NP_441659.2_8 Forward -302 -292 1.55333 0.238
NP_442346.1_10 Forward -246 -227 -1.18052 0.286
NP_441233.1_4 Forward -157 -138 10.7167 0.267
NP_439970.1_4 Reverse -226 -245 -4.6221 0.293
NP_442732.1_2 Forward -340 -321 14.5603 0.271
NP_441329.1_6 Forward -204 -185 2.91208 0.217
NP_441329.1_6 Forward -26 -7 2.14815 0.231
NP_442162.1_9 Forward -301 -294 9.28223 0.0694
NP_440671.1_4 Forward -308 -294 16.9125 0.0246
NP_442028.1_1 Reverse -263 -276 8.65605 0.281
NP_442028.1_1 Reverse -268 -281 7.03268 0.292
NP_442028.1_1 Forward -368 -355 6.93719 0.294
NP_442497.1_10 Forward -154 -145 0.589713 0.153
NP_440821.1_4 Reverse -144 -154 0.57002 0.169
NP_441239.1_9 Reverse -291 -303 8.00379 0.145
NP_442270.1_9 Reverse -141 -160 -12.2919 0.292
NP_440546.1_4 Forward -237 -227 6.74945 0.282
NP_441184.1_3 Forward -310 -291 1.76941 0.296
NP_440868.1_4 Forward -306 -294 0.825626 0.199
NP_442402.1_4 Forward -370 -351 -0.39464 0.189
NP_442923.1_6 Reverse -39 -53 10.5157 0.292
NP_442039.1_4 Forward -301 -294 10.8555 0.109
NP_442679.1_1 Reverse -144 -163 -0.39387 0.221
NP_442829.1_2 Forward -23 -7 8.91416 0.287
NP_441926.1_3 Forward -302 -286 4.28677 0.193
NP_440160.1_1 Forward -202 -183 13.7874 0.169
NP_442053.1_1 Reverse -293 -302 6.8829 0.111
NP_440505.1_3 Forward -304 -294 10.5014 0.105
NP_441102.1_2 Reverse -235 -254 13.2741 0.159
NP_442532.1_4 Reverse -346 -364 7.5771 0.296
NP_440914.1_1 Reverse -293 -303 12.4212 0.058
NP_440914.1_1 Forward -237 -227 6.46809 0.279
NP_441011.1_8 Forward -154 -145 8.06287 0.16
NP_442533.1_6 Reverse -293 -302 5.70292 0.132
NP_441482.1_7 Forward -308 -294 -2.16369 0.0941
NP_442597.1_6 Reverse -273 -292 16.9494 0.292
NP_442203.1_3 Forward -278 -259 8.90547 0.257
NP_441697.1_5 Reverse -258 -277 -9.97933 0.278
NP_441697.1_5 Forward -57 -38 -11.1252 0.292
NP_441527.1_4 Forward -203 -184 -6.63711 0.222
NP_441527.1_4 Forward -204 -185 -8.64244 0.248
NP_440007.1_9 Reverse -142 -156 6.98109 0.213
NP_439965.1_1 Forward -311 -292 -2.26216 0.177
NP_441347.1_5 Forward -129 -115 10.717 0.269
NP_442673.1_5 Reverse -112 -130 11.9172 0.272
NP_442673.1_7 Reverse -268 -287 12.3658 0.264
NP_441186.1_4 Reverse -150 -160 16.4991 0.223
NP_441286.1_1 Forward -156 -144 3.38223 0.0467
NP_440670.1_8 Forward -302 -293 14.8477 0.00987
NP_440670.1_8 Reverse -293 -302 6.09625 0.127
NP_440886.1_7 Reverse -292 -302 4.20782 0.249
NP_440083.1_4 Forward -113 -94 15.8859 0.0919
NP_442382.1_9 Reverse -306 -325 11.8967 0.266
NP_440404.1_10 Reverse -16 -29 15.5549 0.281
NP_442459.1_2 Reverse -215 -234 8.16093 0.297
NP_442459.1_8 Reverse -141 -160 11.1109 0.185
NP_440387.1_1 Reverse -293 -309 -6.52964 0.292
NP_442084.1_6 Forward -87 -69 13.9821 0.16
NP_440114.1_10 Forward -302 -288 13.8643 0.0481
NP_441425.1_2 Forward -206 -187 11.0271 0.298
NP_440422.1_10 Forward -35 -16 8.17758 0.212
NP_441237.1_9 Forward -220 -210 10.5014 0.228
NP_442635.1_8 Forward -328 -310 17.9154 0.242
NP_442930.1_1 Reverse -61 -71 12.5659 0.239
NP_440457.1_1 Forward -306 -294 3.57889 0.191
NP_440213.1_5 Forward -139 -120 7.66927 0.284
NP_442509.1_9 Forward -155 -145 12.8609 0.0737
NP_441489.1_3 Reverse -348 -362 15.3858 0.178
NP_443037.1_7 Reverse -200 -219 -5.31042 0.276
NP_440554.1_4 Reverse -294 -304 3.61828 0.222
NP_441885.1_5 Forward -302 -292 -0.708283 0.222
NP_442341.1_9 Reverse -291 -305 5.21053 0.277
NP_441173.1_9 Forward -358 -350 11.8187 0.222
NP_439906.1_4 Reverse -151 -170 13.7878 0.292
NP_442395.2_4 Reverse -292 -311 1.96529 0.229
NP_443000.1_7 Reverse -144 -154 3.42162 0.226
NP_440727.1_8 Reverse -259 -273 16.1498 0.214
NP_440312.1_8 Reverse -46 -65 7.40211 0.271
NP_441635.1_5 Forward -40 -26 17.7945 0.192
NP_441635.1_5 Reverse -190 -204 17.4089 0.2
NP_441122.1_1 Forward -299 -284 17.5811 0.126
NP_441207.1_7 Forward -275 -261 9.2554 0.282
NP_440216.1_1 Reverse -293 -307 -5.40861 0.129
NP_440216.1_2 Reverse -351 -370 13.5691 0.216
NP_440172.1_1 Reverse -293 -303 11.3864 0.0392
NP_440172.1_1 Forward -302 -292 4.79825 0.166
NP_442015.1_10 Forward -159 -146 7.19745 0.0941
NP_441111.1_7 Forward -154 -146 -0.570565 0.233
NP_441766.1_2 Reverse -293 -302 4.22796 0.193
NP_442116.1_6 Reverse -347 -364 13.8985 0.172
NP_442116.1_6 Reverse -6 -23 10.7472 0.215
NP_442116.1_6 Forward -32 -15 8.74191 0.241
NP_442116.1_6 Forward -22 -5 5.68616 0.291
NP_442116.1_6 Reverse -51 -68 5.2087 0.299
NP_440261.1_5 Forward -154 -141 -1.16069 0.0662
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

GTCGTTATCTTGAAAATGACTCCATGCCGGTTATTCAATGTTTTTTACAAAATTATGTTGTATCATTTCAATTGAATCGTAGTTCAAGTATTAGGCAAGGCGATTGGCTATTAATAATTAAACAACAAAAAATTAATTCCTTGGAAGTTAAAACGTTGCAAATACCGATCTGGATATTTTGGTATCGTCCAAGTCTAAAATTGATTAATAAAAATAACTTCAAACGAGCCTTATATTTTTATCTTTGTGAACGCCCTGAGACTAATAATTATAGCCAATGGATCACAAAAATAGATCACAGTCTTATGATTCGTTTACCTGATTTAAAGGAAAATAATTTGCAGACAATTATAATATTTTTAAATGATATATTTTGTAAATATTTGAAGGAATATTTTTC

CDS

ATGAGTTTACCAACTGAATTGATTGAATCTAGCTGCAATCAAAGTTCAACTTATTTTATTTCACGGGCAAATTTAAATTTTCCTTGTGCAAATTATACTTTACCTTTAAGTTCTGCTCAGAAAGAAGCCTTCGACTTAGCCATTTCTAATAGTCCAATCTCCCTAATTAGCGGTAATCCTGCCAGTGGCAAAACCCATGTCGGCTGTTTTGTTCTTGAAATGTCCGTTCGATTTCAGAAATCTATATTAGTAGTTGCTAGACATGCTAATACTCTGGAAGCTTATAAAAACTTAAATGTTAATTCTCTTTTTCTTGAAATATTTAATAATTACTCAGATAGTATTTTTGCGTGGTTACGACACAACCTTGCCCAGCCTAAAATCAATTTTATGCCTCTCCATTTGTTCCCAGATCCCCTGCTAGAAACATTACAAGAAAGTAAACAGTTAAACCAATGGATTGATTTAGCAGAAAAAGGGGATAAAAAAAATCTTCAAGAAGAGATGATGAAAGTTTTTCCGCAGGTATCGAAATCTCGCTTAGATCTCTTAGTAGAAAAGCTATATAAACTATATCCTCTACTGAAGCAACATCAAAAATTAAAGGAACATTATCTAAATTTGTCCGAGGAAGGAATTTTACAACTTACCGAATTAATGTCAGAAACAACAAAAATACCTATTTTAGCAACTTTTCAAAGTGTCTTAAATAGTGATGTTAAATTTAAACAGTTTGAAATTGTTCTTGTTGAGGATTCACATCTTTTTTCTGATCATGACCTACTATTGATGGCGAGTATGACTAACAAACTAATTTTATTGGGAGAAAATATTAAATCCGATACTTTTTTTACTCGTCTATCTGAATGTTTATCGCCAGCCTATCGCGCTAATCTATCAGAAAATTTTCGTCTGCACCCATTGTTAAGCCGTCCAATTTTTTCTACTTTTTATTATTCACAACCCTATTCATCTTTGCAGAACTATTCTTATCGAACATTTCAAAATCGTTTACGATGGATTGATATTCATGAAGATAAGCTGATTACTCCACAATTATTGGATTTTATCGAAAATTCAGATATTGATATATCCAGTATTAAAGTTGGAATACTAACTTTTTCAATAACCGCCAAAGAAATGATACAAAGCCAATGCCCAGAACAATGGCTCAATCAAATTTACGTCGATAGTTGCGAAAATTGGTATGGAAAGGAATGTAATGTGCTTTTAATAGTTTGTGATGGTACTAAACCCACACCTGATCAACTTCGTCTTGCCTTAACACGTGCCAGTGATGCCATTGTATGTTTTGGCGATATTAACCAATATGAAATGTCTTCATTTAGAACTTTAATTAGGGATAAAACTTTAACCATCGAGCGGGAGGTTTCACTATTATGA

Protein

No sequence available