Your browser is old and dusty. Try Google Chrome!

Details for slr6013

ORF slr6013
Accession NP_942456.1
Symbol
Category
Definition
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_442711.1_5 Reverse -23 -42 14.9458 0.214
NP_441061.1_2 Forward -287 -273 11.701 0.0507
NP_441061.1_2 Reverse -279 -293 7.27608 0.104
NP_440795.1_7 Forward -233 -226 14.6904 0.0123
NP_440795.1_7 Reverse -226 -233 14.6904 0.0123
NP_441418.1_6 Forward -234 -215 -18.7818 0.0837
NP_441453.1_1 Forward -241 -223 3.06666 0.278
NP_441453.1_4 Reverse -225 -233 16.539 0.00633
NP_441453.1_4 Forward -234 -226 16.539 0.00633
NP_442151.1_6 Forward -234 -220 16.6175 0.0139
NP_442151.1_6 Reverse -225 -239 6.98109 0.214
NP_440561.1_4 Reverse -8 -27 12.2379 0.262
NP_440226.1_1 Forward -234 -215 16.9124 0.0205
NP_440226.1_1 Reverse -225 -244 11.0125 0.0571
NP_442655.1_2 Reverse -239 -258 -0.0988766 0.295
NP_442173.1_1 Forward -233 -225 15.4574 0.00633
NP_442173.1_1 Reverse -226 -234 15.4574 0.00633
NP_442752.1_4 Forward -234 -227 13.8055 0.0199
NP_442752.1_4 Reverse -225 -232 13.8055 0.0199
NP_443027.1_4 Forward -236 -226 13.2547 0.0521
NP_443027.1_4 Reverse -252 -262 11.1898 0.107
NP_440613.1_1 Reverse -65 -84 19.2723 0.119
NP_441812.1_3 Reverse -224 -238 9.2427 0.245
NP_441812.1_3 Reverse -328 -342 8.94771 0.248
NP_442975.1_10 Forward -238 -224 11.5037 0.0497
NP_442975.1_10 Reverse -221 -235 9.93039 0.0607
NP_442975.1_10 Forward -149 -135 5.70218 0.212
NP_440784.1_7 Forward -233 -226 15.9687 0.0123
NP_440784.1_7 Reverse -226 -233 15.9687 0.0123
NP_441250.1_3 Forward -227 -208 16.3224 0.0862
NP_440061.1_9 Reverse -223 -237 10.2254 0.126
NP_440061.1_9 Forward -236 -222 9.24208 0.149
NP_441054.1_4 Forward -244 -226 -2.93078 0.254
NP_442062.1_8 Forward -234 -224 17.3846 0.00193
NP_442062.1_8 Reverse -225 -235 10.3048 0.0493
NP_442062.1_8 Forward -171 -161 4.89658 0.193
NP_440304.1_4 Forward -236 -226 10.8948 0.051
NP_440304.1_4 Reverse -223 -233 1.84832 0.299
NP_442242.1_4 Forward -233 -226 14.3954 0.0124
NP_442242.1_4 Reverse -226 -233 14.3954 0.0124
NP_440044.1_8 Forward -233 -214 -3.63879 0.288
NP_441208.1_9 Reverse -222 -236 7.57108 0.221
NP_440370.1_10 Reverse -216 -235 6.88262 0.278
NP_441925.1_2 Forward -145 -126 4.22769 0.262
NP_440769.1_8 Reverse -140 -159 7.7676 0.25
NP_440856.1_4 Forward -241 -222 6.58763 0.0739
NP_440856.1_4 Reverse -247 -266 -3.93378 0.243
NP_441083.1_5 Forward -234 -224 20.3345 0.00053
NP_441083.1_5 Reverse -225 -235 11.2881 0.0159
NP_439957.1_4 Reverse -279 -298 10.4225 0.252
NP_442827.1_8 Reverse -217 -236 0.785326 0.196
NP_441434.1_7 Forward -232 -218 2.94952 0.266
NP_441738.1_2 Forward -232 -225 15.28 0.0102
NP_441738.1_2 Reverse -227 -234 15.28 0.0102
NP_441558.1_5 Forward -236 -217 22.0256 0.00216
NP_441558.1_5 Reverse -240 -259 6.09597 0.229
NP_440209.1_1 Reverse -225 -233 18.1123 0.00295
NP_440209.1_1 Forward -234 -226 18.1123 0.00295
NP_442889.1_8 Forward -237 -223 19.1735 0.0084
NP_440447.1_6 Reverse -217 -235 6.70565 0.143
NP_442398.1_5 Reverse -19 -37 18.0137 0.236
NP_440687.1_6 Reverse -31 -49 12.9988 0.285
NP_441716.1_1 Forward -234 -220 4.52282 0.255
NP_441716.1_2 Forward -157 -138 -1.81236 0.289
NP_441327.1_1 Forward -148 -129 5.36669 0.255
NP_442111.1_4 Reverse -224 -238 12.1926 0.0451
NP_440343.1_3 Forward -338 -320 4.34495 0.266
NP_440906.1_5 Forward -233 -226 15.8704 0.0124
NP_440906.1_5 Reverse -226 -233 15.8704 0.0124
NP_442801.1_3 Reverse -228 -241 18.3507 0.176
NP_440747.1_10 Reverse -222 -234 14.887 0.00223
NP_440747.1_10 Forward -237 -225 7.31547 0.00577
NP_441486.1_1 Reverse -222 -236 -2.45868 0.175
NP_441486.1_1 Forward -237 -223 -2.55701 0.175
NP_442634.1_4 Forward -236 -222 -1.8687 0.149
NP_441014.1_10 Forward -235 -216 -2.36125 0.274
NP_443018.1_3 Forward -233 -226 14.8871 0.0123
NP_443018.1_3 Reverse -226 -233 14.8871 0.0123
NP_443018.1_3 Forward -250 -243 8.20058 0.153
NP_440376.1_1 Forward -234 -225 19.4693 0.000692
NP_440376.1_1 Reverse -225 -234 19.4693 0.000692
NP_441857.1_5 Reverse -218 -236 4.14905 0.222
NP_441588.1_4 Forward -232 -222 15.9097 0.0369
NP_442687.1_7 Forward -235 -225 9.02648 0.0994
NP_442687.1_7 Reverse -224 -234 8.92815 0.0994
NP_442530.1_2 Reverse -135 -145 13.648 0.226
NP_440550.1_7 Reverse -291 -310 14.0599 0.222
NP_442658.1_1 Forward -236 -226 14.2375 0.0237
NP_442658.1_1 Reverse -223 -233 6.76441 0.214
NP_440656.1_8 Forward -245 -226 -6.78538 0.249
NP_441414.1_9 Reverse -225 -244 -7.27704 0.214
NP_441414.1_9 Reverse -242 -261 -9.44032 0.259
NP_441414.1_9 Forward -234 -215 -10.6203 0.29
NP_442937.1_5 Forward -301 -282 9.83255 0.179
NP_442937.1_5 Reverse -220 -239 8.45592 0.22
NP_442937.1_5 Reverse -3 -22 7.66927 0.244
NP_441958.1_5 Forward -235 -225 21.2195 0.000805
NP_441958.1_5 Reverse -224 -234 12.2714 0.00183
NP_439905.1_1 Reverse -226 -239 6.4108 0.288
NP_440984.1_7 Forward -239 -225 8.16106 0.154
NP_440984.1_7 Reverse -220 -234 7.47274 0.171
NP_439990.1_5 Reverse -220 -233 10.934 0.128
NP_439990.1_5 Forward -239 -226 10.344 0.128
NP_442690.1_1 Forward -148 -129 -3.44213 0.142
NP_442690.1_1 Forward -161 -142 -5.60541 0.159
NP_442690.1_1 Reverse -127 -146 -15.6352 0.28
NP_442690.1_1 Reverse -139 -158 -16.3235 0.287
NP_442911.1_2 Forward -244 -225 -0.0988766 0.0718
NP_442119.1_6 Reverse -292 -311 4.32602 0.279
NP_440602.1_2 Reverse -220 -239 2.16274 0.263
NP_441099.1_5 Reverse -215 -234 -11.2103 0.273
NP_440809.1_9 Forward -243 -225 -8.14232 0.227
NP_441938.1_6 Reverse -160 -179 8.75091 0.211
NP_441424.1_5 Forward -201 -183 16.0471 0.18
NP_441000.1_6 Reverse -224 -238 -3.83532 0.225
NP_440484.1_3 Forward -236 -222 12.1926 0.242
NP_440147.1_4 Reverse -223 -236 18.4072 0.00407
NP_440147.1_4 Forward -236 -223 10.344 0.0355
NP_441550.1_8 Forward -236 -226 15.8108 0.0132
NP_441550.1_8 Reverse -223 -233 14.6309 0.0132
NP_441916.1_7 Reverse -225 -235 18.9579 0.00144
NP_441916.1_7 Forward -234 -224 10.3048 0.0261
NP_441041.1_4 Forward -234 -215 -9.44032 0.216
NP_441041.1_7 Forward -237 -225 7.22324 0.171
NP_442396.1_5 Reverse -221 -234 12.2123 0.0913
NP_441725.1_4 Forward -239 -225 2.75226 0.279
NP_441725.1_5 Forward -233 -223 2.04498 0.115
NP_441725.1_5 Reverse -226 -236 1.94665 0.115
NP_439966.1_7 Forward -236 -226 14.3359 0.0203
NP_439966.1_7 Reverse -223 -233 7.25606 0.15
NP_442941.1_3 Reverse -226 -236 19.2529 0.00262
NP_442941.1_3 Forward -233 -223 11.0914 0.0116
NP_440289.1_2 Forward -237 -224 3.16588 0.0811
NP_440289.1_2 Forward -22 -9 -1.06236 0.221
NP_440260.1_8 Reverse -216 -234 -5.29072 0.273
NP_442281.1_1 Forward -292 -278 2.26061 0.272
NP_441644.1_6 Reverse -225 -235 19.0557 0.000803
NP_441644.1_6 Forward -234 -224 17.3841 0.00127
NP_441644.1_6 Forward -251 -241 3.61784 0.272
NP_443049.1_6 Reverse -328 -338 11.6409 0.24
NP_442177.1_5 Reverse -245 -259 14.8476 0.22
NP_440253.1_2 Reverse -225 -243 11.8189 0.0302
NP_440253.1_2 Forward -234 -216 0.805796 0.176
NP_440929.1_8 Forward -234 -225 19.2726 0.000701
NP_440929.1_8 Reverse -225 -234 19.2726 0.000701
NP_442933.1_10 Forward -234 -225 17.601 0.00325
NP_442933.1_10 Reverse -225 -234 17.601 0.00325
NP_441751.2_8 Reverse -226 -240 -4.52363 0.174
NP_442554.1_8 Reverse -226 -236 17.2863 0.00543
NP_442554.1_8 Forward -233 -223 15.3197 0.00882
NP_442970.1_1 Forward -156 -142 12.903 0.269
NP_442970.1_1 Reverse -64 -78 8.89237 0.291
NP_441762.1_7 Forward -235 -223 0.530633 0.0747
NP_441762.1_7 Reverse -224 -236 -6.84419 0.284
NP_442142.1_4 Forward -237 -224 3.65697 0.248
NP_442142.1_4 Reverse -222 -235 3.55864 0.251
NP_442292.1_1 Forward -233 -224 18.486 0.00229
NP_442292.1_1 Reverse -226 -235 17.5026 0.00435
NP_443009.1_5 Reverse -224 -235 14.5128 0.02
NP_443009.1_5 Forward -235 -224 10.1862 0.0792
NP_440125.1_10 Reverse -72 -91 17.5024 0.138
NP_441715.1_4 Reverse -226 -236 16.7946 0.0106
NP_441715.1_4 Forward -233 -223 7.94484 0.107
NP_441715.1_4 Reverse -46 -56 5.09324 0.233
NP_440881.1_4 Forward -213 -194 1.37609 0.226
NP_441448.1_1 Forward -281 -262 4.52268 0.278
NP_440464.1_10 Forward -233 -223 13.0082 0.169
NP_441468.1_1 Forward -233 -226 15.8704 0.0124
NP_441468.1_1 Reverse -226 -233 15.8704 0.0124
NP_441020.2_6 Reverse -252 -269 6.82368 0.251
NP_441673.1_1 Forward -234 -225 20.8459 0.000698
NP_441673.1_1 Reverse -225 -234 20.8459 0.000698
NP_441330.1_1 Forward -239 -220 -2.85214 0.0791
NP_441330.1_1 Forward -59 -40 -5.70374 0.129
NP_441330.1_1 Forward -176 -157 -8.85033 0.183
NP_441637.1_9 Forward -223 -205 -1.16082 0.292
NP_442868.1_6 Forward -236 -226 10.4031 0.038
NP_442868.1_6 Reverse -223 -233 9.81313 0.038
NP_441612.1_2 Forward -234 -224 8.54929 0.21
NP_442361.1_3 Forward -228 -215 8.57408 0.285
NP_442427.1_8 Forward -243 -224 20.059 0.0251
NP_442808.1_1 Forward -235 -225 8.73102 0.0481
NP_442808.1_1 Reverse -224 -234 8.63269 0.0481
NP_441290.1_3 Forward -303 -284 17.109 0.187
NP_442050.1_5 Forward -236 -226 15.9091 0.0091
NP_442050.1_5 Reverse -223 -233 7.64939 0.243
NP_440558.1_2 Forward -297 -278 3.83436 0.153
NP_441878.1_6 Forward -235 -225 10.5014 0.0176
NP_441878.1_6 Reverse -224 -234 10.4031 0.0176
NP_441878.1_6 Reverse -248 -258 -7.68978 0.255
NP_441036.1_8 Forward -235 -225 15.713 0.00724
NP_441036.1_8 Reverse -224 -234 8.33817 0.174
NP_441557.1_5 Forward -234 -225 19.9609 0.000699
NP_441557.1_5 Reverse -225 -234 19.9609 0.000699
NP_441445.1_1 Reverse -216 -235 6.58763 0.146
NP_442066.2_9 Forward -238 -225 12.409 0.154
NP_441914.1_10 Reverse -349 -368 8.06178 0.293
NP_442183.1_1 Forward -19 -5 4.22782 0.271
NP_442397.1_9 Reverse -10 -29 6.78429 0.246
NP_441574.1_1 Forward -263 -244 -3.83545 0.245
NP_442347.1_2 Forward -233 -224 12.4878 0.056
NP_442347.1_2 Forward -337 -328 6.39124 0.17
NP_442347.1_2 Reverse -226 -235 3.34298 0.284
NP_442645.1_2 Reverse -8 -27 -20.945 0.289
NP_442645.1_2 Forward -242 -223 -21.6334 0.29
NP_442645.1_2 Reverse -217 -236 -22.42 0.291
NP_441037.1_4 Reverse -223 -233 7.9999 0.237
NP_441037.1_4 Forward -236 -226 7.22024 0.237
NP_441037.1_4 Reverse -247 -257 6.05075 0.283
NP_440690.1_1 Forward -243 -224 8.25926 0.249
NP_441633.1_3 Reverse -223 -236 1.10092 0.109
NP_441633.1_3 Forward -236 -223 -3.71729 0.177
NP_440136.1_2 Forward -233 -226 15.9687 0.0123
NP_440136.1_2 Reverse -226 -233 15.9687 0.0123
NP_442998.1_10 Forward -232 -225 15.5754 0.0102
NP_442998.1_10 Reverse -227 -234 15.5754 0.0102
NP_442998.1_10 Reverse -12 -19 3.97235 0.297
NP_440899.1_8 Reverse -378 -397 -7.4737 0.246
NP_440299.1_1 Reverse -221 -234 13.0967 0.0319
NP_441799.1_1 Reverse -221 -235 14.5519 0.0228
NP_441799.1_1 Forward -238 -224 12.487 0.043
NP_441799.1_1 Forward -267 -253 4.12889 0.266
NP_442802.1_6 Forward -235 -216 -0.688862 0.204
NP_440256.1_1 Reverse -222 -241 2.94938 0.0587
NP_440256.1_1 Forward -237 -218 -5.9004 0.196
NP_441090.1_6 Reverse -242 -256 10.6193 0.226
NP_441559.1_8 Forward -239 -225 2.16287 0.147
NP_441559.1_8 Reverse -250 -264 -5.70361 0.27
NP_440915.1_6 Reverse -250 -264 3.44117 0.101
NP_440915.1_6 Reverse -221 -235 2.94952 0.11
NP_440915.1_6 Forward -238 -224 0.786239 0.153
NP_442158.1_4 Forward -376 -366 12.5664 0.245
NP_442785.1_7 Forward -236 -222 10.7177 0.228
NP_441704.1_8 Reverse -214 -233 10.3234 0.16
NP_440134.1_2 Forward -112 -93 -0.590531 0.298
NP_440134.1_2 Forward -161 -142 -0.688862 0.298
NP_442452.1_4 Forward -21 -2 13.3725 0.165
NP_441464.1_8 Forward -234 -220 4.91614 0.26
NP_441199.1_7 Forward -360 -341 8.75091 0.159
NP_442993.1_1 Reverse -225 -241 -9.87289 0.197
NP_442386.1_9 Reverse -224 -233 13.8639 0.0289
NP_442386.1_9 Forward -235 -226 6.39082 0.219
NP_441340.1_5 Forward -233 -226 15.6737 0.0124
NP_441340.1_5 Reverse -226 -233 15.6737 0.0124
NP_442484.1_2 Reverse -214 -233 -0.590531 0.267
NP_440586.1_8 Forward -233 -226 13.2151 0.026
NP_440586.1_8 Reverse -226 -233 13.2151 0.026
NP_440586.1_8 Forward -250 -243 9.08521 0.178
NP_442251.1_6 Forward -233 -226 15.2804 0.0124
NP_442251.1_6 Reverse -226 -233 15.2804 0.0124
NP_440684.1_9 Forward -302 -288 9.73436 0.216
NP_441262.1_3 Reverse -225 -232 14.7888 0.0223
NP_441262.1_3 Forward -234 -227 14.7888 0.0223
NP_443051.1_1 Forward -235 -226 19.5676 0.00335
NP_443051.1_1 Reverse -224 -233 10.4228 0.00754
NP_443051.1_5 Forward -391 -372 3.53937 0.298
NP_439937.1_9 Reverse -224 -241 -14.8098 0.287
NP_440439.1_1 Forward -237 -224 3.65753 0.11
NP_439943.1_7 Reverse -220 -239 2.45773 0.293
NP_440372.1_2 Forward -233 -226 16.3621 0.0124
NP_440372.1_2 Reverse -226 -233 16.3621 0.0124
NP_441138.1_5 Reverse -379 -392 8.36957 0.247
NP_441572.1_7 Reverse -243 -262 -5.80207 0.273
NP_442384.1_10 Reverse -225 -238 10.2457 0.0465
NP_442384.1_10 Forward -234 -221 8.77074 0.0608
NP_441877.1_7 Forward -59 -40 2.85027 0.218
NP_442262.1_10 Forward -233 -226 14.1988 0.0123
NP_442262.1_10 Reverse -226 -233 14.1988 0.0123
NP_442262.1_10 Forward -250 -243 9.38056 0.202
NP_441689.1_5 Forward -236 -226 8.3377 0.132
NP_441689.1_5 Reverse -223 -233 5.78111 0.197
NP_440344.1_10 Forward -241 -224 -6.35267 0.113
NP_440531.1_6 Reverse -271 -290 -5.40875 0.297
NP_441965.1_10 Forward -237 -221 3.10679 0.274
NP_442529.1_4 Reverse -216 -235 7.37428 0.289
NP_440297.1_4 Forward -214 -195 17.5024 0.0538
NP_440297.1_9 Forward -287 -277 3.91327 0.253
NP_440297.1_9 Forward -233 -223 -0.118297 0.282
NP_440297.1_9 Reverse -226 -236 -0.216628 0.282
NP_440894.1_7 Reverse -264 -283 7.66846 0.298
NP_440999.1_2 Forward -227 -208 9.24257 0.284
NP_440999.1_5 Forward -295 -276 6.29183 0.291
NP_440888.1_2 Reverse -225 -239 14.2569 0.0193
NP_440888.1_2 Forward -234 -220 9.04542 0.139
NP_440600.1_4 Reverse -217 -235 0.805796 0.135
NP_440600.1_4 Forward -242 -224 -6.96235 0.291
NP_440179.1_6 Forward -233 -214 7.66927 0.209
NP_442948.1_4 Reverse -251 -265 18.1908 0.21
NP_440575.1_8 Forward -383 -364 10.7175 0.0794
NP_441543.1_2 Forward -233 -224 16.9127 0.00359
NP_441543.1_2 Reverse -226 -235 15.9293 0.00518
NP_442845.1_2 Reverse -248 -262 7.37441 0.195
NP_442845.1_2 Reverse -323 -337 4.42448 0.259
NP_442845.1_2 Reverse -236 -250 3.73617 0.279
NP_442845.1_2 Reverse -219 -233 3.24451 0.298
NP_441469.1_8 Forward -264 -255 10.0295 0.227
NP_441469.1_8 Forward -235 -226 6.5879 0.227
NP_441469.1_8 Reverse -224 -233 6.48957 0.227
NP_443064.1_6 Forward -234 -224 12.5669 0.0796
NP_443064.1_6 Reverse -225 -235 10.8217 0.13
NP_442337.1_8 Forward -374 -355 -2.26216 0.297
NP_442578.1_7 Forward -233 -226 14.5921 0.026
NP_442578.1_7 Reverse -226 -233 14.5921 0.026
NP_441462.1_2 Reverse -225 -235 20.2362 0.000805
NP_441462.1_2 Forward -234 -224 11.5831 0.00406
NP_443062.1_1 Reverse -242 -260 8.54592 0.152
NP_443062.1_1 Reverse -225 -243 8.15589 0.159
NP_443062.1_6 Reverse -271 -290 6.68596 0.18
NP_442204.1_1 Forward -238 -227 1.92696 0.266
NP_442780.1_3 Reverse -371 -390 6.54077 0.269
NP_440516.1_8 Forward -234 -225 16.9127 0.00442
NP_440516.1_8 Reverse -225 -234 16.9127 0.00442
NP_440516.1_8 Forward -19 -10 -0.590259 0.283
NP_442428.1_5 Forward -233 -226 15.8704 0.0124
NP_442428.1_5 Reverse -226 -233 15.8704 0.0124
NP_440673.1_2 Reverse -215 -234 11.6578 0.167
NP_440673.1_3 Forward -232 -225 12.4288 0.0426
NP_440673.1_3 Reverse -227 -234 12.4288 0.0426
NP_441052.1_2 Forward -234 -224 19.9412 0.00106
NP_441052.1_2 Reverse -225 -235 10.4031 0.0285
NP_441052.1_2 Reverse -287 -297 4.40493 0.159
NP_442219.1_8 Reverse -215 -234 11.1627 0.188
NP_442219.1_8 Reverse -283 -302 6.23444 0.3
NP_442219.1_9 Forward -233 -224 17.7976 0.00718
NP_442219.1_9 Reverse -226 -235 8.25953 0.0681
NP_442219.1_9 Forward -337 -328 2.35967 0.28
NP_440436.1_4 Forward -233 -224 17.2072 0.00233
NP_440436.1_4 Reverse -226 -235 9.24241 0.0871
NP_440314.1_9 Reverse -226 -245 8.84924 0.0349
NP_440314.1_9 Forward -233 -214 -8.65367 0.251
NP_441719.1_4 Forward -233 -226 16.3621 0.0124
NP_441719.1_4 Reverse -226 -233 16.3621 0.0124
NP_440746.1_3 Forward -298 -279 0.786102 0.267
NP_442366.1_5 Reverse -222 -232 15.4175 0.0374
NP_442873.1_3 Reverse -15 -34 3.53858 0.287
NP_443054.1_2 Forward -236 -222 -0.393733 0.294
NP_441851.1_10 Reverse -224 -234 15.8113 0.00552
NP_441851.1_10 Forward -235 -225 8.53483 0.114
NP_441668.1_4 Forward -273 -254 -2.85214 0.297
NP_442515.1_1 Reverse -224 -238 12.291 0.0339
NP_442515.1_1 Forward -235 -221 3.44117 0.119
NP_442515.1_1 Reverse -278 -292 -0.983719 0.241
NP_441396.1_5 Reverse -243 -252 7.37455 0.279
NP_441982.1_6 Forward -153 -144 15.2546 0.274
NP_442689.1_2 Forward -110 -91 15.5357 0.212
NP_442689.1_8 Forward -157 -140 -5.95935 0.279
NP_442689.1_8 Reverse -131 -148 -6.05768 0.28
NP_441349.1_10 Forward -244 -225 0.392778 0.0889
NP_441409.1_6 Forward -240 -221 -14.3569 0.255
NP_440432.1_9 Reverse -226 -241 4.50312 0.0691
NP_440432.1_9 Forward -233 -218 -1.39674 0.167
NP_442843.1_1 Forward -233 -214 -9.93197 0.272
NP_442944.1_2 Reverse -128 -147 15.2101 0.25
NP_440474.1_8 Reverse -226 -240 3.93223 0.296
NP_440431.1_3 Forward -235 -216 -4.03212 0.178
NP_440431.1_7 Reverse -375 -394 -0.000545616 0.251
NP_442450.1_5 Reverse -223 -233 7.55152 0.13
NP_442450.1_5 Reverse -27 -37 4.79825 0.287
NP_441570.1_1 Forward -234 -216 -7.45401 0.0895
NP_441078.1_4 Forward -234 -225 19.6659 0.0007
NP_441078.1_4 Reverse -225 -234 19.6659 0.0007
NP_440526.1_3 Forward -233 -222 1.04151 0.267
NP_441432.1_8 Reverse -224 -233 16.8143 0.00595
NP_441432.1_8 Forward -235 -226 16.8143 0.00595
NP_441432.1_8 Reverse -278 -287 12.2911 0.0444
NP_442320.1_8 Forward -240 -226 -1.67204 0.0821
NP_442320.1_8 Reverse -219 -233 -3.24533 0.113
NP_441732.1_2 Forward -238 -222 -15.5761 0.151
NP_440760.1_1 Forward -234 -215 -14.7502 0.135
NP_441072.1_2 Forward -73 -54 13.6675 0.159
NP_440713.1_4 Reverse -244 -263 7.57094 0.18
NP_440713.1_4 Reverse -215 -234 0.884433 0.3
NP_442489.1_7 Forward -234 -225 20.1576 0.000695
NP_442489.1_7 Reverse -225 -234 20.1576 0.000695
NP_442079.1_7 Reverse -226 -245 4.42435 0.192
NP_442079.1_7 Forward -233 -214 1.86774 0.24
NP_440559.1_1 Forward -233 -224 17.4043 0.00658
NP_440559.1_1 Reverse -226 -235 8.65285 0.0586
NP_441659.2_8 Reverse -225 -235 20.9245 0.000805
NP_441659.2_8 Forward -234 -224 18.1713 0.00133
NP_441022.1_1 Forward -306 -297 13.2728 0.216
NP_442346.1_5 Reverse -224 -234 16.6963 0.00248
NP_442346.1_5 Forward -235 -225 16.303 0.00248
NP_440545.1_3 Reverse -221 -238 -6.64766 0.285
NP_440004.1_5 Reverse -173 -192 14.3558 0.293
NP_440459.1_2 Reverse -240 -257 10.6586 0.193
NP_440459.1_2 Reverse -153 -170 8.98696 0.243
NP_441653.1_2 Reverse -214 -233 4.78586 0.253
NP_440847.1_8 Reverse -220 -239 11.9958 0.277
NP_441888.1_4 Forward -95 -76 13.3725 0.258
NP_441948.1_4 Reverse -218 -236 6.214 0.0652
NP_441833.1_4 Forward -233 -226 15.9687 0.0124
NP_441833.1_4 Reverse -226 -233 15.9687 0.0124
NP_441329.1_3 Reverse -146 -156 12.3037 0.273
NP_442162.1_9 Forward -233 -226 16.2637 0.0124
NP_442162.1_9 Reverse -226 -233 16.2637 0.0124
NP_442199.1_5 Forward -242 -223 7.17762 0.0719
NP_442199.1_5 Forward -116 -97 -6.49039 0.275
NP_442140.1_3 Forward -233 -223 12.2714 0.0632
NP_442140.1_3 Reverse -226 -236 4.69992 0.238
NP_441671.1_1 Reverse -14 -33 -0.0988766 0.273
NP_440875.1_9 Reverse -227 -237 7.69067 0.255
NP_441813.1_5 Forward -236 -226 18.1713 0.00743
NP_441813.1_5 Reverse -223 -233 8.63316 0.0367
NP_440594.1_8 Reverse -226 -239 12.1134 0.152
NP_441774.1_1 Forward -87 -68 18.4857 0.0306
NP_440590.1_4 Forward -233 -220 9.75405 0.0335
NP_440590.1_4 Reverse -226 -239 3.26421 0.0749
NP_440590.1_4 Reverse -243 -256 -1.45568 0.22
NP_442497.1_10 Reverse -226 -235 17.601 0.00813
NP_442497.1_10 Forward -233 -224 10.4228 0.0087
NP_440821.1_4 Reverse -223 -233 9.41981 0.0286
NP_440821.1_4 Forward -236 -226 2.24165 0.131
NP_441239.1_9 Forward -236 -224 13.0187 0.0389
NP_441239.1_9 Forward -260 -248 6.82381 0.175
NP_441239.1_9 Reverse -223 -235 3.38223 0.285
NP_441727.1_3 Forward -295 -276 3.14605 0.292
NP_441892.1_1 Reverse -216 -233 -5.36936 0.279
NP_442669.1_1 Forward -369 -350 1.86774 0.209
NP_440212.1_9 Forward -392 -373 6.80832 0.169
NP_441526.1_3 Reverse -15 -34 13.0766 0.272
NP_440546.1_4 Reverse -225 -235 13.5365 0.0459
NP_440546.1_4 Forward -234 -224 10.046 0.109
NP_440462.1_6 Forward -236 -226 18.7612 0.00454
NP_440462.1_6 Reverse -223 -233 1.35667 0.294
NP_442465.1_9 Forward -392 -378 12.4876 0.22
NP_440868.1_4 Forward -238 -226 7.70879 0.0648
NP_440868.1_4 Reverse -221 -233 5.84051 0.0879
NP_442479.1_9 Forward -147 -128 -9.14533 0.266
NP_441848.1_4 Reverse -129 -145 13.3757 0.195
NP_441084.1_6 Forward -236 -222 17.1007 0.0523
NP_442039.1_4 Forward -233 -226 15.1821 0.0124
NP_442039.1_4 Reverse -226 -233 15.1821 0.0124
NP_441811.1_1 Reverse -1 -20 5.30933 0.28
NP_441811.1_8 Forward -218 -204 6.6861 0.265
NP_441926.1_3 Reverse -225 -241 5.76173 0.17
NP_440825.1_7 Forward -233 -223 12.9096 0.152
NP_442837.1_3 Forward -233 -226 15.7721 0.0124
NP_442837.1_3 Reverse -226 -233 15.7721 0.0124
NP_442053.1_1 Forward -234 -225 18.3876 0.0007
NP_442053.1_1 Reverse -225 -234 18.3876 0.0007
NP_440505.1_3 Forward -236 -226 17.188 0.00332
NP_440505.1_3 Reverse -223 -233 9.22315 0.122
NP_441408.2_7 Forward -236 -217 -3.04881 0.272
NP_440914.1_1 Forward -234 -224 17.5935 0.000537
NP_440914.1_1 Reverse -225 -235 16.3248 0.00196
NP_440914.1_1 Forward -287 -277 8.41992 0.191
NP_441011.1_8 Reverse -226 -235 16.6177 0.00602
NP_441011.1_8 Forward -233 -224 8.25953 0.144
NP_442533.1_6 Forward -234 -225 17.2076 0.00137
NP_442533.1_6 Reverse -225 -234 17.2076 0.00137
NP_442533.1_6 Forward -263 -254 5.01461 0.16
NP_440263.1_5 Reverse -121 -135 8.35772 0.294
NP_441482.1_7 Forward -240 -226 -4.7203 0.156
NP_441482.1_7 Forward -25 -11 -9.63684 0.208
NP_441482.1_7 Reverse -219 -233 -10.6202 0.211
NP_439944.1_9 Forward -233 -223 10.5014 0.0887
NP_439944.1_9 Reverse -226 -236 9.12481 0.1
NP_441697.1_5 Forward -392 -373 -8.92892 0.268
NP_440116.1_8 Reverse -226 -245 2.0644 0.0894
NP_440116.1_8 Forward -233 -214 -3.73712 0.158
NP_440115.1_6 Forward -237 -227 4.79825 0.282
NP_440007.1_9 Forward -23 -9 10.9143 0.163
NP_441347.1_5 Reverse -248 -262 8.55376 0.285
NP_442673.1_5 Reverse -302 -320 11.0322 0.28
NP_441972.1_5 Reverse -243 -262 -2.65548 0.187
NP_441972.1_5 Forward -233 -214 -3.83545 0.201
NP_441972.1_5 Reverse -310 -329 -3.93378 0.201
NP_441106.1_1 Forward -235 -226 18.486 0.0028
NP_441106.1_1 Reverse -224 -233 9.63616 0.0311
NP_441869.1_2 Forward -241 -222 11.4058 0.236
NP_439903.1_6 Forward -148 -129 5.80018 0.176
NP_439903.1_6 Forward -237 -218 0.981987 0.255
NP_442306.1_10 Forward -239 -220 -9.44032 0.11
NP_441286.1_1 Reverse -224 -236 5.93884 0.0258
NP_441286.1_1 Forward -235 -223 3.48056 0.0467
NP_441286.1_1 Forward -297 -285 1.02229 0.0996
NP_442674.1_2 Forward -140 -121 9.43923 0.216
NP_440670.1_8 Forward -234 -225 18.3876 0.000699
NP_440670.1_8 Reverse -225 -234 18.3876 0.000699
NP_440886.1_7 Forward -235 -225 8.04271 0.0805
NP_440886.1_7 Reverse -224 -234 7.94438 0.0805
NP_440886.1_7 Forward -252 -242 5.28945 0.188
NP_441001.1_10 Reverse -177 -196 7.07928 0.249
NP_440197.1_8 Reverse -313 -332 22.9106 0.0253
NP_439899.1_5 Forward -59 -40 17.7974 0.209
NP_441403.1_3 Forward -243 -229 21.1401 0.0651
NP_440907.2_8 Reverse -226 -236 9.616 0.103
NP_440907.2_8 Forward -233 -223 7.64939 0.117
NP_440841.1_4 Reverse -223 -242 -5.9004 0.209
NP_440841.1_4 Reverse -277 -296 -6.1954 0.215
NP_441463.1_3 Reverse -215 -234 -7.96535 0.262
NP_441463.1_3 Reverse -289 -308 -8.45701 0.27
NP_441626.1_2 Forward -233 -226 15.7721 0.0124
NP_441626.1_2 Reverse -226 -233 15.7721 0.0124
NP_442794.1_1 Reverse -221 -233 9.38042 0.0795
NP_442615.1_1 Reverse -216 -234 13.6872 0.0112
NP_442615.1_1 Forward -243 -225 -2.63579 0.146
NP_442615.1_1 Reverse -245 -263 -3.32411 0.159
NP_440387.1_1 Forward -234 -218 -3.8747 0.169
NP_440387.1_1 Reverse -287 -303 -6.62797 0.298
NP_441431.1_2 Forward -237 -223 7.17714 0.247
NP_441836.1_2 Forward -240 -221 -6.09707 0.291
NP_441993.1_1 Reverse -219 -238 2.92126 0.246
NP_440114.1_10 Reverse -225 -239 13.7659 0.0502
NP_440114.1_10 Reverse -249 -263 7.47274 0.235
NP_441500.1_8 Forward -35 -21 14.7264 0.275
NP_440287.1_6 Reverse -216 -235 10.0292 0.142
NP_440766.1_5 Forward -154 -142 10.0431 0.275
NP_440766.1_5 Forward -105 -93 7.5603 0.29
NP_441237.1_9 Forward -233 -223 14.828 0.0242
NP_442930.1_1 Reverse -373 -383 12.1726 0.239
NP_442930.1_1 Forward -381 -371 11.1893 0.26
NP_439910.1_2 Reverse -217 -234 -13.8258 0.163
NP_439910.1_2 Forward -242 -225 -22.184 0.215
NP_440457.1_1 Reverse -245 -257 0.923956 0.25
NP_440457.1_1 Forward -23 -11 -0.256015 0.259
NP_440457.1_1 Forward -238 -226 -0.551008 0.268
NP_442680.1_5 Forward -398 -379 3.78447 0.227
NP_442297.1_4 Reverse -221 -240 15.7394 0.145
NP_440473.1_9 Reverse -231 -250 -8.752 0.258
NP_442509.1_9 Forward -62 -52 12.2709 0.0995
NP_442509.1_9 Forward -234 -224 8.14104 0.192
NP_442509.1_9 Reverse -225 -235 8.04271 0.192
NP_441489.1_3 Forward -156 -142 9.56081 0.232
NP_441253.1_8 Forward -30 -16 10.4745 0.282
NP_440524.1_2 Forward -286 -267 4.03102 0.198
NP_442936.1_10 Forward -306 -292 8.11542 0.269
NP_440554.1_4 Reverse -226 -236 17.9746 0.0131
NP_442862.1_3 Reverse -60 -77 8.49531 0.241
NP_442862.1_3 Forward -145 -128 5.74204 0.268
NP_441885.1_5 Forward -234 -224 20.9245 0.000538
NP_441885.1_5 Reverse -225 -235 11.3864 0.00668
NP_442341.1_7 Reverse -308 -322 3.04785 0.237
NP_442341.1_7 Reverse -9 -23 2.85119 0.243
NP_442341.1_9 Forward -236 -222 12.6836 0.0984
NP_442341.1_9 Forward -260 -246 6.29216 0.233
NP_443000.1_7 Forward -236 -226 20.3345 0.00223
NP_443000.1_7 Reverse -223 -233 10.3048 0.0345
NP_440552.1_8 Reverse -137 -154 12.5616 0.226
NP_440275.1_3 Forward -236 -226 16.1063 0.0155
NP_440275.1_3 Reverse -223 -233 8.04317 0.0602
NP_440091.1_1 Reverse -221 -233 -0.452677 0.273
NP_442638.1_3 Forward -104 -85 13.3207 0.298
NP_441635.1_1 Forward -391 -372 4.15348 0.275
NP_440804.1_7 Forward -144 -127 12.5261 0.175
NP_440149.1_8 Forward -234 -215 -1.57384 0.162
NP_441105.1_3 Forward -245 -226 -2.0655 0.156
NP_441105.1_3 Forward -269 -250 -6.68705 0.239
NP_440216.1_1 Reverse -225 -239 14.9459 0.00425
NP_440216.1_1 Forward -234 -220 -2.65535 0.0539
NP_440216.1_9 Reverse -366 -375 7.57121 0.286
NP_440172.1_1 Reverse -225 -235 17.5813 0.00421
NP_440172.1_1 Forward -234 -224 15.0247 0.00945
NP_442015.1_10 Reverse -221 -234 1.49425 0.204
NP_441226.1_1 Reverse -252 -266 17.6985 0.211
NP_441226.1_7 Forward -233 -226 14.4934 0.0123
NP_441226.1_7 Reverse -226 -233 14.4934 0.0123
NP_441757.1_3 Forward -235 -216 0.0977854 0.198
NP_441111.1_7 Forward -233 -225 18.7023 0.00294
NP_441111.1_7 Reverse -226 -234 18.7023 0.00294
NP_442379.1_10 Reverse -247 -264 -0.551145 0.223
NP_441766.1_2 Forward -234 -225 17.5026 0.00297
NP_441766.1_2 Reverse -225 -234 17.5026 0.00297
NP_440416.1_1 Reverse -225 -244 -11.5053 0.272
NP_440261.1_5 Reverse -226 -239 -4.60227 0.158
NP_440261.1_5 Forward -233 -220 -12.2721 0.277
NP_440988.1_10 Forward -208 -194 7.90002 0.212
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

TCAAGTATGAAAAAGCAGAAAATTATTTACCTTGGAATGAATTTGTAAAGTGGACTAAAGAACCTGATCCCGATTCTCCTATGGTTATTGAAATCAAAGACTTTGTTGATCGTGCCAATGCCATTATGGAAAAGTTGGGACATCCCTTCGCCCATCGAGTTTATCAGGCGATCGCCAAATATGTCGTGAATTATCCCGGTGCGGAGCAAGATCTGCAAATACGTCGTCAAGCTATTGCAGATCAGTTTGGTCAAAAATTATTGCCTAAATTACGGGGAATACGTATAGATGAAGCTAGCACAGAACTTGACGAAATGAAGCGACTAATTCAGGAACTAGATGATCCGGCACTCACAGAAGCTTTTGATCGAGCTAAGCAAGGGCGATACGGACAATTCCA

CDS

ATGGAAGGGGATGTTGTACAGCTAATTATGAAAATTTACGCTAACCTCGGAACCTATTTACAAAATGAGCCATTACAACTGCTTGACGCTGTTCTTGATAGTGCTGATCGGCCAATTTTAGTTTTAGATAACGATGAAGAATTGAGTCAAACGCCAGGTTTTTTAATTCCACTAGAAGATAAAAATAGTTATGAAATTGGTTTTCCTTTGGTATCTATTTCTGATTGGGATAGTTATCAAATTCTTTGTCAGAAGTCATCGTTAAAATTACAAAAAAATAACGAAGAAACTTCTTTTAAAATATCTATAAAAGATCTTATTTTGGATTCAACCCAAGTCAATGATGAAAGTACTCATAATCGTTTAAACAATGAATTAAATAATAGTTATGATCGTCATACTGCGGAGACTATTGCCGTATTTATTGGTTTATTTCAAGGTATGCGCTCTGGTAGACGTATCAAGCAGATTAAATTCCCCTTACTAAATCTACCTGAATATTTTCACGAGCTCAGCAGTGAAGATGCGAGATTACCATTAGTGGTCTCCTTAGATCGACGTTATGAATTACGTCATAAACTAGAATCTATTACTACGAAACTTAGATCTCAATTAAATCGAACCGTTGAGATGATACCCCTGGCCCGTATTCACGAAATGGATGCCTATTGTCTCCGTGACTATGTTCGTCGTCCGGGCAGAAATGCAATAGAAAAAGCTGGGGCAAGACAGGAATTGCTAGGGATTAAACGCTTTCAAAATTTTAATACACCAGAAAATAGATTTTTAAAAGGGTTTTGCGAATTATTACACCTCGAATGTCAAGAGTATAGTAAAAATCGAGAAGCAGAACTTTTAGGTCAAAGTATTAATTATTTTCGTCAAAATGAAACAGTACAGACAGTTAAAAGATCTGTATCTTTATTAGACAAGCCTAATTATGTCCTTGAACAAAATCCAATTTATCGGAGTTTTTATCAGGCTTATTTAGACTACGTTCATCGTCTTTCAGATAAAGAAAAACTATGGAGTTATCGCCAAAGACTGTGCAGTGATGTAATTGCAGTATTATTAATGACTAGTTTTTTATATTTTCAGGGTAGCTATGCTAGCGCCCTGAGTGATTTATCGATTTTAGATAATCCCCTTTTTGGTCGTTATCTTGAAAATGACTCCATGCCGGTTATTCAATGTTTTTTACAAAATTATGTTGTATCATTTCAATTGAATCGTAGTTCAAGTATTAGGCAAGGCGATTGGCTATTAATAATTAAACAACAAAAAATTAATTCCTTGGAAGTTAAAACGTTGCAAATACCGATCTGGATATTTTGGTATCGTCCAAGTCTAAAATTGATTAATAAAAATAACTTCAAACGAGCCTTATATTTTTATCTTTGTGAACGCCCTGAGACTAATAATTATAGCCAATGGATCACAAAAATAGATCACAGTCTTATGATTCGTTTACCTGATTTAAAGGAAAATAATTTGCAGACAATTATAATATTTTTAAATGATATATTTTGTAAATATTTGAAGGAATATTTTTCATGA

Protein

No sequence available