Your browser is old and dusty. Try Google Chrome!

Details for slr6012

ORF slr6012
Accession NP_942455.1
Symbol
Category
Definition
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_442711.1_3 Forward -325 -306 11.806 0.288
NP_440557.1_1 Forward -101 -82 0.0977854 0.265
NP_440795.1_10 Reverse -248 -267 13.7649 0.217
NP_441453.1_8 Reverse -331 -348 6.52869 0.293
NP_441623.1_1 Reverse -236 -254 -2.0458 0.241
NP_441630.1_6 Forward -147 -128 18.0247 0.243
NP_441098.1_3 Forward -312 -293 -4.68348 0.28
NP_442062.1_3 Forward -310 -291 4.42435 0.198
NP_441035.1_5 Reverse -245 -263 15.5554 0.296
NP_440769.1_8 Forward -313 -294 7.37428 0.272
NP_440438.2_8 Reverse -310 -329 16.3224 0.0472
NP_440438.2_8 Forward -20 -1 5.11266 0.206
NP_441209.1_8 Reverse -302 -320 16.4046 0.0793
NP_442145.1_4 Forward -21 -2 18.2863 0.062
NP_442145.1_4 Reverse -49 -68 2.7211 0.299
NP_441014.1_10 Forward -214 -195 -3.04956 0.292
NP_442848.1_4 Forward -283 -269 7.37441 0.282
NP_442687.1_7 Forward -334 -324 9.81313 0.0994
NP_440887.1_4 Forward -240 -221 16.8229 0.161
NP_441317.1_4 Forward -52 -38 16.8168 0.136
NP_442685.1_2 Reverse -6 -16 16.598 0.121
NP_442816.1_7 Reverse -378 -397 4.34446 0.275
NP_442690.1_1 Forward -326 -307 -10.6203 0.217
NP_442690.1_1 Forward -55 -36 -12.6852 0.247
NP_442690.1_1 Reverse -7 -26 -15.4385 0.28
NP_442690.1_1 Reverse -284 -303 -17.1101 0.297
NP_440388.1_7 Forward -124 -105 0.687771 0.251
NP_440345.1_5 Forward -319 -305 15.6709 0.263
NP_439966.1_9 Forward -192 -183 3.7363 0.253
NP_440647.1_9 Reverse -77 -95 9.55725 0.198
NP_442288.1_3 Forward -36 -19 5.25038 0.284
NP_442933.1_1 Forward -186 -167 6.92274 0.257
NP_442671.1_2 Reverse -79 -98 0.697247 0.268
NP_442554.1_9 Reverse -378 -397 12.2158 0.281
NP_441637.1_9 Reverse -49 -67 -0.275845 0.292
NP_441379.1_4 Reverse -33 -52 14.0608 0.29
NP_442903.1_2 Reverse -30 -49 2.14815 0.293
NP_442998.1_5 Forward -255 -245 7.64985 0.287
NP_442158.1_5 Reverse -167 -186 19.2809 0.234
NP_440733.1_2 Reverse -47 -65 19.4823 0.102
NP_441866.1_4 Forward -51 -38 15.5792 0.273
NP_440329.1_4 Forward -183 -169 16.2503 0.255
NP_441340.1_2 Forward -400 -381 14.5282 0.277
NP_440168.1_9 Reverse -117 -136 -2.0655 0.28
NP_440210.1_9 Reverse -311 -330 9.88382 0.245
NP_442114.1_8 Reverse -36 -50 10.0287 0.234
NP_441689.1_4 Forward -359 -340 11.3154 0.278
NP_440350.1_5 Reverse -377 -396 1.96607 0.158
NP_440350.1_5 Forward -42 -23 -5.01543 0.289
NP_440350.1_5 Forward -54 -35 -6.68705 0.297
NP_442710.1_7 Reverse -90 -109 -3.47446 0.263
NP_440454.1_2 Reverse -171 -185 14.3354 0.227
NP_440673.1_3 Forward -339 -332 7.41394 0.263
NP_441884.1_2 Forward -376 -362 15.8633 0.239
NP_442366.1_3 Forward -191 -173 -5.58572 0.289
NP_442176.1_1 Forward -310 -291 0.884433 0.294
NP_441115.1_4 Forward -138 -120 8.6715 0.24
NP_440728.1_1 Forward -380 -361 13.175 0.216
NP_442430.1_6 Forward -308 -289 7.07928 0.271
NP_441542.1_4 Reverse -122 -136 12.1926 0.239
NP_442689.1_8 Reverse -141 -158 -5.95935 0.279
NP_442689.1_8 Forward -322 -305 -6.05768 0.28
NP_442689.1_8 Forward -51 -34 -8.71262 0.296
NP_441409.1_8 Forward -267 -248 9.81228 0.229
NP_440431.1_4 Forward -387 -368 -7.01908 0.262
NP_440431.1_4 Forward -382 -363 -7.30556 0.262
NP_441432.1_9 Reverse -381 -394 9.18011 0.28
NP_441432.1_9 Reverse -250 -263 8.59837 0.287
NP_443024.1_4 Reverse -173 -187 19.1735 0.12
NP_441333.1_1 Forward -51 -41 11.5899 0.241
NP_442079.1_6 Reverse -196 -215 14.5524 0.273
NP_442008.1_9 Reverse -169 -188 8.6416 0.249
NP_440335.1_9 Reverse -33 -51 10.2456 0.28
NP_442346.1_5 Reverse -331 -341 5.09324 0.262
NP_441329.1_1 Forward -319 -300 10.3605 0.194
NP_441329.1_1 Reverse -300 -319 7.20922 0.24
NP_442028.1_2 Forward -145 -132 17.9155 0.187
NP_442568.1_5 Reverse -176 -195 12.8808 0.177
NP_442568.1_8 Forward -382 -368 8.45605 0.287
NP_441508.1_4 Reverse -174 -188 13.094 0.297
NP_441698.1_2 Reverse -299 -318 17.9933 0.137
NP_440573.1_3 Reverse -164 -177 18.6827 0.0806
NP_440573.1_3 Forward -183 -170 18.3962 0.0831
NP_440212.1_9 Forward -64 -45 6.13556 0.169
NP_442679.1_1 Forward -396 -377 -0.0988766 0.215
NP_442679.1_1 Reverse -33 -52 -1.86883 0.24
NP_441959.1_1 Reverse -179 -197 19.1929 0.118
NP_440013.1_1 Forward -63 -44 8.75009 0.259
NP_441482.1_7 Reverse -224 -238 -3.73699 0.138
NP_442203.1_3 Forward -57 -38 6.8957 0.258
NP_441697.1_5 Forward -305 -286 -9.69285 0.273
NP_441028.1_6 Reverse -390 -400 11.4843 0.192
NP_441028.1_6 Forward -93 -83 7.15773 0.23
NP_441028.1_6 Reverse -249 -259 4.60114 0.278
NP_441527.1_4 Forward -396 -377 3.00757 0.123
NP_441527.1_4 Reverse -209 -228 -5.30023 0.198
NP_441527.1_4 Forward -397 -378 -6.8281 0.226
NP_441527.1_4 Reverse -198 -217 -8.64244 0.248
NP_441527.1_4 Reverse -20 -39 -9.02441 0.254
NP_441527.1_4 Reverse -35 -54 -10.8388 0.275
NP_441527.1_4 Reverse -28 -47 -10.8388 0.275
NP_441527.1_4 Reverse -81 -100 -11.2207 0.278
NP_441527.1_4 Forward -393 -374 -11.8892 0.284
NP_441106.1_3 Forward -330 -311 11.4058 0.217
NP_439903.1_6 Forward -216 -197 0.195343 0.268
NP_441186.1_5 Forward -396 -377 15.8035 0.252
NP_441286.1_1 Forward -240 -228 0.628964 0.109
NP_441930.1_3 Reverse -178 -197 6.32874 0.263
NP_441463.1_3 Forward -243 -224 -9.93197 0.287
NP_442842.1_10 Reverse -371 -390 2.98944 0.251
NP_442357.1_8 Forward -398 -379 7.66927 0.241
NP_442936.1_10 Forward -18 -4 12.3264 0.216
NP_442369.1_6 Reverse -170 -180 16.5414 0.127
NP_439906.1_4 Reverse -146 -165 13.3082 0.292
NP_441397.1_8 Reverse -84 -97 13.0487 0.245
NP_441207.1_7 Reverse -175 -189 10.514 0.262
NP_441207.1_7 Reverse -88 -102 7.90002 0.293
NP_440804.1_7 Forward -74 -57 12.6244 0.175
NP_442015.1_10 Forward -243 -230 9.16406 0.053
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

ATAGAGAAAAACCAATAGAAAGAAGCTAAAAGCAAGGTTTATCCTTATAAATGAATTTTAGTCATTGCGTAAACGTTTAGATTTATTACAGTTTTAGAAAAGTTAGGAATCATTATTTTGTTTCTGCACTAACATCCAAACATAGAGTAAAAATCTACGCTTAGGATCGTCCTAGTTCTTAATTACTGTTCTTTGCCTTTACTGAATTGCTTGGATTGTTTTTTTGATTAAAATAATACGATTCTATATTAAACAAAAAAGGATGCAATTACGTCCAAAAGCAGTGAAGTAATAGATGGTCATTTACTTTTACCCTATTATCGATTTATTTTAGGTAAATAAACCATACTTTTTTGCTTTATTGTTCGTGTTCCCTTGTATAGCAACAATTTTTTAAATT

CDS

ATGGACAGCCCCCGGCAATTGTCATCGCCTACCTTGACGAACGTTATTCCTCTTGCAGCAGGGATAATTGTCGCATTAGTAGGAATAGCCGCAAAAATTCAACCGCTTCAATCTGGAATAATGGGATTTACCGCAGGAGTCAGCGGGGCGGCAACAGCAAGTTTAGCGACAAAAAAAGAAAGGGAAATTTTGCTCTTAGCAGAACAGGAGCTTAGCAAAACAAAAATTAACAATACGCTTTCTGAGTTACAAGAACAGAAAAAAATAATTGATAAAGATATCACTCGATTAGAAGAACGCCGGAGCCAATCAGAAAAAATTGCTGGGGAGTTAGAGATTCGGCAGGCAAAGCGGGATAGCATCGAAGCCGAAATTAAAAATTTACAAGCGGTACAACAAAATTTAGAGAGTCGTGTTGCCGAAATTAATAAAGCCAATCCAACTCTGGAGAATTTAGAGATCCGTCAGAAAGAAATTTCTCGATTACAAAGTATTATTAAGCAGCTAGAAGGTGAGTTATTTGCCTATAAAAGTAAGATTGCTGAAATGGAACAAAAAAAAGCTGGCCTTGAAGAAAAAGAGGCTTTATATTTAAAACGGGAAATAGAAATAAAAGAAATTTCTGAACAAATTCAGCAGGGACAAGTAAAACTAAAAGATCTTAACCGTCAGGCTGTGGAATTGGAGTTATTACGCAACACCTATGATGCTTTAGAGCGAGAAAAGCAGACCTATGAATCCCAGAAAGAACATCTTTATGCTGAAGTGATCAGATTGGGGGCAGAAAAAGACCGTATCTTAGCAGAAATTAAAGAGTTGGAGGGAAGAGCGCAAGAGAGTGATCGCCTGAGGGCTGAAATTGCCGATTTAAAAGCCAAGCGTCGCATAGCGGAAGATTTGTTGCGAGATATTCAGCGAGAAATAGAGCAACATGAAATTATCAAAGATAATCTTATTAATGACATCGCCCGTAAGGATGCTGAGATCAACCGCAAAAAGAATAATGTGAGCGAATTAGAACAAAGAATTCGTGAACTCAAACAAGAAATATCAGATCTTGAGGATAGTGCTCGAGTAGCATTACAGACTTTAGAAGAGCCCATCAAGGATTTAATTCCGGTTCAAAGGCAAGGTATTAACGAAGATGATTTCCTTAACCAGTTTAGTAATTCCCTAAAAGTAAAGGGCTTAGACTTTCATGAACGTATCGTTAAAGCCTTTCATACTTCTCTAAAAGTACAAGATATTTCGGCATTAGTAATTTTAGCCGGAATTAGCGGTACAGGAAAAAGTGAATTACCCCAAAAATATGCGGATTTCATTGGTGCTCCACTCGTCATGTTGCCGGTACAACCCCGTTGGGATTCTCCCCAAGATTTACAGGGTTTTTATAATTATATTGAAAAAAAGTATAAGCCAACTCAATTAATGCATTATCTCTATCAATATCAGCAGGATAGAAAAATGCATGGCAGAATCATCATGGTGCTACTTGATGAGATGAATCTAGCTCGGGTTGAGTATTATTTTAGTGATTTCCTTTCTAAACTCGAAACACGACGTAGTAAGCCAACCTATTTATCATTGGACGTAGGTAGTTTAAAACTTCCTGAGAAACAACGAGATATTCTGATTCCCGAAGAATTCCTGTTTATTGGCACCATGAATGAAGATGAAACCACTCAATCCTTATCCGATAAAGTGTTAGACCGAGCCAATGTCTTAACTTTTGGTCGTCCAAATGAATTGAAATTACGGGGAAGAAAAATCAAGTATGAAAAAGCAGAAAATTATTTACCTTGGAATGAATTTGTAAAGTGGACTAAAGAACCTGATCCCGATTCTCCTATGGTTATTGAAATCAAAGACTTTGTTGATCGTGCCAATGCCATTATGGAAAAGTTGGGACATCCCTTCGCCCATCGAGTTTATCAGGCGATCGCCAAATATGTCGTGAATTATCCCGGTGCGGAGCAAGATCTGCAAATACGTCGTCAAGCTATTGCAGATCAGTTTGGTCAAAAATTATTGCCTAAATTACGGGGAATACGTATAGATGAAGCTAGCACAGAACTTGACGAAATGAAGCGACTAATTCAGGAACTAGATGATCCGGCACTCACAGAAGCTTTTGATCGAGCTAAGCAAGGGCGATACGGACAATTCCAATGGAAGGGGATGTTGTACAGCTAA

Protein

No sequence available