Your browser is old and dusty. Try Google Chrome!

Details for slr6008

ORF slr6008
Accession NP_942451.1
Symbol
Category
Definition
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_441061.1_2 Forward -193 -179 0.786239 0.199
NP_441061.1_2 Reverse -186 -200 0.589577 0.205
NP_440557.1_1 Forward -220 -201 -0.0988766 0.265
NP_440795.1_7 Forward -193 -186 14.6904 0.0123
NP_440795.1_7 Reverse -186 -193 14.6904 0.0123
NP_441418.1_6 Reverse -185 -204 -21.1417 0.139
NP_441418.1_6 Forward -194 -175 -29.8932 0.245
NP_442291.1_5 Forward -195 -179 -2.39974 0.215
NP_441453.1_1 Forward -201 -183 12.1131 0.0985
NP_441453.1_4 Reverse -185 -193 16.539 0.00633
NP_441453.1_4 Forward -194 -186 16.539 0.00633
NP_442151.1_6 Reverse -185 -199 12.4876 0.0722
NP_442151.1_6 Forward -194 -180 8.45605 0.172
NP_441818.1_1 Forward -193 -182 10.1862 0.232
NP_441818.1_6 Forward -201 -187 11.3077 0.253
NP_441818.1_9 Forward -335 -316 -2.0655 0.201
NP_440226.1_1 Forward -194 -175 4.81767 0.178
NP_440226.1_1 Reverse -185 -204 2.26107 0.271
NP_441465.1_8 Reverse -167 -185 7.68896 0.235
NP_442169.1_1 Reverse -297 -316 -1.27885 0.265
NP_441630.1_3 Reverse -177 -196 9.3409 0.0975
NP_440259.1_4 Forward -81 -67 9.50354 0.278
NP_442623.1_1 Forward -151 -132 -17.7985 0.292
NP_442173.1_1 Forward -193 -185 15.4574 0.00633
NP_442173.1_1 Reverse -186 -194 15.4574 0.00633
NP_442752.1_4 Forward -194 -187 13.8055 0.0199
NP_442752.1_4 Reverse -185 -192 13.8055 0.0199
NP_443027.1_4 Forward -196 -186 15.3197 0.0437
NP_441812.1_3 Reverse -184 -198 16.8142 0.0639
NP_442975.1_10 Forward -198 -184 19.6651 0.00325
NP_442975.1_10 Reverse -181 -195 10.9137 0.0516
NP_442975.1_10 Forward -132 -118 1.5723 0.296
NP_440784.1_7 Forward -193 -186 15.9687 0.0123
NP_440784.1_7 Reverse -186 -193 15.9687 0.0123
NP_442861.1_1 Forward -296 -277 9.43923 0.298
NP_440061.1_9 Reverse -183 -197 13.5686 0.079
NP_440928.1_5 Reverse -369 -387 7.39397 0.243
NP_442062.1_8 Forward -194 -184 17.3846 0.00193
NP_442062.1_8 Reverse -185 -195 10.3048 0.0493
NP_441859.1_3 Forward -195 -176 7.4718 0.157
NP_442972.1_1 Reverse -53 -71 7.38575 0.291
NP_441802.1_1 Reverse -170 -189 11.0125 0.197
NP_440304.1_4 Forward -196 -186 18.9579 0.00406
NP_440304.1_4 Reverse -183 -193 1.84832 0.299
NP_442242.1_4 Forward -193 -186 14.3954 0.0124
NP_442242.1_4 Reverse -186 -193 14.3954 0.0124
NP_440044.1_8 Forward -193 -174 18.4857 0.0159
NP_440044.1_8 Reverse -186 -205 10.5209 0.0551
NP_442762.1_10 Forward -339 -320 -12.0953 0.284
NP_440011.1_1 Forward -336 -317 16.0274 0.166
NP_439918.1_2 Forward -334 -315 -2.16383 0.242
NP_441200.1_4 Reverse -168 -187 8.16093 0.257
NP_441208.1_9 Reverse -182 -196 15.4376 0.0854
NP_441594.1_6 Forward -203 -184 -0.197208 0.298
NP_441594.1_7 Forward -261 -242 19.5664 0.187
NP_442375.1_5 Reverse -245 -259 12.8803 0.289
NP_442110.1_7 Reverse -185 -199 8.84938 0.0807
NP_441925.1_2 Reverse -292 -311 3.24438 0.262
NP_440769.1_8 Forward -373 -354 9.14423 0.216
NP_441083.1_5 Forward -194 -184 20.3345 0.00053
NP_441083.1_5 Reverse -185 -195 11.2881 0.0159
NP_441083.1_5 Forward -353 -343 -1.10161 0.295
NP_442827.1_8 Forward -202 -183 5.40686 0.12
NP_441738.1_2 Forward -192 -185 15.28 0.0102
NP_441738.1_2 Reverse -187 -194 15.28 0.0102
NP_441558.1_5 Reverse -183 -202 4.32602 0.283
NP_440209.1_1 Reverse -185 -193 18.1123 0.00295
NP_440209.1_1 Forward -194 -186 18.1123 0.00295
NP_442889.1_8 Forward -197 -183 9.83206 0.0943
NP_441770.1_5 Forward -202 -183 1.37609 0.238
NP_440178.1_7 Reverse -184 -203 -11.0136 0.0862
NP_442570.1_3 Reverse -365 -384 -3.63879 0.224
NP_442570.1_3 Forward -336 -317 -5.21209 0.241
NP_442570.1_3 Forward -210 -191 -8.65367 0.291
NP_441792.1_5 Reverse -314 -330 18.4464 0.122
NP_442111.1_4 Reverse -184 -198 10.521 0.0535
NP_440906.1_5 Forward -193 -186 15.8704 0.0124
NP_440906.1_5 Reverse -186 -193 15.8704 0.0124
NP_440747.1_10 Reverse -182 -194 14.9853 0.00221
NP_440747.1_10 Forward -197 -185 -1.92764 0.0192
NP_440747.1_10 Reverse -341 -353 -12.1541 0.227
NP_441130.1_7 Reverse -338 -352 14.8469 0.287
NP_441130.1_10 Reverse -183 -197 7.27608 0.164
NP_442973.1_5 Reverse -176 -195 11.9958 0.218
NP_441486.1_1 Reverse -182 -196 6.19444 0.0344
NP_441486.1_1 Forward -197 -183 6.19444 0.0344
NP_442634.1_4 Reverse -183 -197 -3.34366 0.161
NP_442634.1_4 Forward -196 -182 -3.54032 0.161
NP_441639.1_3 Reverse -184 -203 3.14605 0.264
NP_442848.1_1 Reverse -179 -193 -2.36035 0.263
NP_442848.1_1 Forward -200 -186 -2.95034 0.263
NP_443018.1_3 Forward -193 -186 14.8871 0.0123
NP_443018.1_3 Reverse -186 -193 14.8871 0.0123
NP_441634.1_8 Reverse -183 -197 5.80112 0.114
NP_441634.1_8 Forward -358 -344 -1.8687 0.295
NP_440376.1_1 Forward -194 -185 19.4693 0.000692
NP_440376.1_1 Reverse -185 -194 19.4693 0.000692
NP_440376.1_1 Reverse -344 -353 5.50626 0.131
NP_440376.1_1 Forward -389 -380 1.08137 0.258
NP_441857.1_6 Forward -390 -380 15.0247 0.215
NP_441588.1_4 Forward -192 -182 18.1713 0.0143
NP_442687.1_7 Forward -195 -185 9.02648 0.0994
NP_442687.1_7 Reverse -184 -194 8.92815 0.0994
NP_441422.1_7 Reverse -183 -200 -5.27103 0.247
NP_442296.1_9 Forward -193 -174 7.7676 0.0981
NP_442658.1_1 Forward -196 -186 15.9091 0.00966
NP_442658.1_1 Reverse -183 -193 6.76441 0.214
NP_440141.1_9 Forward -31 -12 2.0644 0.27
NP_442205.1_9 Forward -200 -184 17.3648 0.0219
NP_441414.1_9 Forward -194 -175 -5.01543 0.166
NP_440720.1_1 Forward -205 -186 10.2259 0.154
NP_441487.1_9 Reverse -310 -329 -1.7705 0.287
NP_441478.1_5 Reverse -33 -52 15.6341 0.236
NP_442937.1_5 Reverse -180 -199 15.5357 0.0581
NP_441958.1_5 Forward -195 -185 21.2195 0.000805
NP_441958.1_5 Reverse -184 -194 12.2714 0.00183
NP_442836.1_10 Forward -390 -380 9.7148 0.269
NP_440203.1_5 Forward -179 -169 10.4026 0.225
NP_439905.1_1 Reverse -186 -199 9.55739 0.216
NP_440984.1_7 Forward -199 -185 9.5377 0.127
NP_440984.1_7 Reverse -180 -194 5.30946 0.259
NP_442911.1_2 Reverse -175 -194 1.27776 0.0601
NP_440153.1_5 Reverse -186 -200 5.1128 0.193
NP_440993.1_2 Forward -199 -183 1.14018 0.29
NP_440934.1_2 Reverse -194 -213 1.76941 0.265
NP_440138.1_6 Forward -193 -174 2.45694 0.267
NP_441294.1_7 Forward -198 -184 16.0658 0.0176
NP_441294.1_7 Reverse -181 -195 14.434 0.0428
NP_441646.1_1 Reverse -178 -197 3.6377 0.206
NP_442438.1_10 Forward -199 -185 4.71948 0.142
NP_440879.1_6 Forward -62 -43 -3.54046 0.279
NP_441000.1_1 Reverse -123 -141 16.5932 0.184
NP_441000.1_6 Forward -195 -181 -4.52363 0.245
NP_441000.1_6 Reverse -184 -198 -5.50694 0.279
NP_440147.1_4 Reverse -183 -196 20.1771 0.00228
NP_440147.1_4 Forward -196 -183 3.75586 0.181
NP_441550.1_7 Forward -148 -129 15.3242 0.246
NP_441550.1_8 Forward -196 -186 17.4824 0.00754
NP_441550.1_8 Reverse -183 -193 14.6309 0.0132
NP_441916.1_7 Reverse -185 -195 18.9579 0.00144
NP_441916.1_7 Forward -194 -184 10.3048 0.0261
NP_440206.1_4 Reverse -315 -334 0.686995 0.289
NP_441041.1_4 Reverse -42 -61 -10.817 0.237
NP_441041.1_7 Reverse -182 -194 11.8878 0.0689
NP_441041.1_7 Forward -197 -185 8.97244 0.125
NP_442004.1_6 Reverse -185 -199 8.16106 0.149
NP_441725.1_5 Reverse -186 -196 8.92815 0.0553
NP_441725.1_5 Forward -193 -183 2.04498 0.115
NP_439966.1_7 Forward -196 -186 13.8442 0.0234
NP_439966.1_7 Reverse -183 -193 7.25606 0.15
NP_439966.1_9 Forward -196 -187 0.983037 0.253
NP_440736.1_3 Forward -196 -177 -0.983855 0.282
NP_442941.1_3 Forward -193 -183 11.0914 0.0116
NP_442941.1_3 Reverse -186 -196 10.9931 0.0116
NP_440289.1_2 Forward -197 -184 2.2809 0.1
NP_440289.1_2 Reverse -182 -195 -2.24233 0.253
NP_440983.1_5 Reverse -188 -207 -8.65367 0.295
NP_441678.1_9 Forward -334 -315 0.196116 0.225
NP_442281.1_1 Reverse -180 -194 18.5835 0.00414
NP_442281.1_1 Forward -199 -185 5.40719 0.159
NP_442281.1_1 Reverse -375 -389 4.8172 0.18
NP_442281.1_1 Reverse -321 -335 1.67063 0.293
NP_441334.1_7 Reverse -183 -202 -10.3253 0.12
NP_441079.1_7 Forward -149 -130 -1.27961 0.201
NP_442256.1_2 Forward -196 -178 -0.374176 0.14
NP_440479.1_6 Reverse -246 -260 14.2569 0.231
NP_441644.1_6 Reverse -185 -195 19.0557 0.000803
NP_441644.1_6 Forward -194 -184 17.3841 0.00127
NP_442215.1_2 Forward -196 -180 -4.26803 0.23
NP_442215.1_2 Forward -384 -368 -6.92296 0.281
NP_440253.1_2 Forward -194 -176 8.96727 0.0526
NP_440929.1_8 Forward -194 -185 19.2726 0.000701
NP_440929.1_8 Reverse -185 -194 19.2726 0.000701
NP_442933.1_10 Forward -194 -185 17.601 0.00325
NP_442933.1_10 Reverse -185 -194 17.601 0.00325
NP_441751.2_8 Forward -193 -179 -3.147 0.134
NP_441751.2_8 Reverse -186 -200 -4.4253 0.173
NP_442554.1_8 Reverse -186 -196 19.1546 0.00369
NP_442554.1_8 Forward -193 -183 15.3197 0.00882
NP_441762.1_7 Reverse -184 -196 2.59558 0.0676
NP_441762.1_7 Forward -195 -183 0.530633 0.0747
NP_442142.1_4 Reverse -182 -195 11.5234 0.0552
NP_442142.1_4 Forward -197 -184 3.7553 0.246
NP_442292.1_1 Forward -193 -184 18.486 0.00229
NP_442292.1_1 Reverse -186 -195 17.5026 0.00435
NP_440122.1_2 Forward -342 -323 -0.0988766 0.265
NP_440919.1_1 Forward -173 -154 -8.752 0.296
NP_442381.1_8 Forward -197 -178 -14.8485 0.288
NP_443009.1_5 Reverse -184 -195 14.5128 0.02
NP_443009.1_5 Forward -195 -184 10.1862 0.0792
NP_441715.1_4 Forward -193 -183 7.94484 0.107
NP_441715.1_4 Reverse -186 -196 7.25653 0.108
NP_441448.1_1 Forward -373 -354 8.94757 0.198
NP_441448.1_1 Reverse -293 -312 6.68596 0.245
NP_441198.1_5 Forward -192 -179 12.7034 0.216
NP_441198.1_8 Forward -196 -186 15.4199 0.0427
NP_440464.1_10 Forward -193 -183 13.0082 0.169
NP_441468.1_1 Forward -193 -186 15.8704 0.0124
NP_441468.1_1 Reverse -186 -193 15.8704 0.0124
NP_441020.2_6 Forward -196 -179 11.2486 0.124
NP_441020.2_7 Reverse -320 -339 8.65176 0.26
NP_441015.1_10 Forward -199 -180 -5.01543 0.215
NP_441673.1_1 Forward -194 -185 20.8459 0.000698
NP_441673.1_1 Reverse -185 -194 20.8459 0.000698
NP_441673.1_1 Forward -353 -344 -7.76842 0.168
NP_441673.1_1 Reverse -344 -353 -8.06341 0.254
NP_441339.1_4 Reverse -367 -386 -5.80207 0.28
NP_441172.1_3 Forward -375 -356 17.699 0.124
NP_442490.1_9 Forward -206 -187 -8.65367 0.293
NP_442868.1_6 Reverse -183 -193 9.81313 0.038
NP_442868.1_6 Forward -196 -186 8.63316 0.0555
NP_442868.1_6 Reverse -342 -352 0.471689 0.226
NP_442719.1_2 Forward -157 -139 -2.24319 0.185
NP_442719.1_2 Forward -158 -140 -11.7812 0.296
NP_441612.1_2 Forward -194 -184 8.54929 0.21
NP_443058.1_7 Reverse -361 -380 10.0292 0.206
NP_442427.1_3 Forward -199 -181 3.16574 0.171
NP_442808.1_1 Forward -195 -185 8.73102 0.0481
NP_442808.1_1 Reverse -184 -194 8.63269 0.0481
NP_442542.1_2 Forward -355 -342 8.9674 0.142
NP_442542.1_9 Forward -201 -187 11.2087 0.111
NP_442050.1_5 Forward -196 -186 17.1874 0.00812
NP_442050.1_5 Reverse -183 -193 7.64939 0.243
NP_441518.1_3 Forward -204 -185 -11.6036 0.261
NP_441878.1_6 Forward -195 -185 10.5014 0.0176
NP_441878.1_6 Reverse -184 -194 10.4031 0.0176
NP_441036.1_8 Forward -195 -185 15.713 0.00724
NP_441036.1_8 Reverse -184 -194 8.33817 0.174
NP_441036.1_8 Forward -354 -344 5.87989 0.253
NP_441557.1_5 Forward -194 -185 19.9609 0.000699
NP_441557.1_5 Reverse -185 -194 19.9609 0.000699
NP_441557.1_8 Reverse -337 -347 10.3043 0.289
NP_441445.1_1 Forward -203 -184 4.12936 0.2
NP_441445.1_1 Reverse -176 -195 1.96607 0.245
NP_441590.1_4 Reverse -319 -338 3.14526 0.29
NP_442066.2_4 Forward -362 -343 -8.06369 0.293
NP_442066.2_9 Reverse -340 -353 8.18076 0.19
NP_442066.2_9 Forward -255 -242 7.49244 0.224
NP_442579.1_6 Forward -151 -132 17.5024 0.043
NP_441308.1_8 Forward -196 -186 12.4681 0.218
NP_442183.1_1 Reverse -185 -199 13.6676 0.0415
NP_442183.1_1 Forward -194 -180 7.76774 0.131
NP_441407.1_5 Forward -204 -185 11.3075 0.147
NP_440248.1_2 Forward -83 -65 17.8626 0.124
NP_442397.1_1 Reverse -141 -155 13.9243 0.291
NP_441549.1_9 Reverse -181 -199 -7.749 0.212
NP_442170.1_5 Reverse -185 -204 9.14423 0.0687
NP_442347.1_2 Forward -193 -184 12.4878 0.056
NP_442347.1_2 Reverse -186 -195 3.34298 0.284
NP_441037.1_4 Forward -196 -186 16.5761 0.0168
NP_441037.1_4 Reverse -183 -193 7.9999 0.237
NP_442594.1_8 Forward -335 -316 2.75272 0.293
NP_442317.1_6 Reverse -180 -199 9.24257 0.211
NP_441633.1_3 Reverse -183 -196 10.8357 0.0286
NP_440136.1_2 Forward -193 -186 15.9687 0.0123
NP_440136.1_2 Reverse -186 -193 15.9687 0.0123
NP_442998.1_5 Forward -366 -356 9.7148 0.236
NP_442998.1_5 Forward -13 -3 9.12481 0.252
NP_442998.1_5 Forward -152 -142 8.53483 0.261
NP_442998.1_10 Forward -192 -185 15.5754 0.0102
NP_442998.1_10 Reverse -187 -194 15.5754 0.0102
NP_440899.1_8 Forward -255 -236 3.04771 0.124
NP_440299.1_1 Reverse -181 -194 4.44361 0.207
NP_441799.1_1 Forward -198 -184 15.2402 0.0197
NP_441799.1_1 Reverse -181 -195 14.5519 0.0228
NP_441007.1_10 Forward -199 -186 13.1956 0.0499
NP_441007.1_10 Reverse -180 -193 0.412608 0.23
NP_442201.1_10 Reverse -174 -193 -14.1602 0.28
NP_440256.1_1 Reverse -182 -201 12.3892 0.0121
NP_441559.1_8 Reverse -167 -181 -7.76856 0.299
NP_440915.1_6 Reverse -181 -195 3.93283 0.1
NP_440915.1_6 Forward -344 -330 -1.77037 0.246
NP_441704.1_8 Forward -205 -186 9.63507 0.175
NP_441464.1_8 Reverse -185 -199 11.996 0.178
NP_441464.1_8 Forward -194 -180 4.91614 0.26
NP_441939.1_3 Reverse -186 -205 12.0942 0.103
NP_441494.1_6 Forward -199 -186 9.85238 0.227
NP_442993.1_1 Reverse -185 -201 -11.3479 0.244
NP_442386.1_9 Reverse -184 -193 13.8639 0.0289
NP_442386.1_9 Forward -195 -186 6.39082 0.219
NP_442386.1_9 Reverse -308 -317 5.9975 0.23
NP_442386.1_9 Reverse -372 -381 5.21086 0.262
NP_440570.1_5 Reverse -364 -383 4.81767 0.207
NP_441340.1_5 Forward -193 -186 15.6737 0.0124
NP_441340.1_5 Reverse -186 -193 15.6737 0.0124
NP_441297.1_8 Forward -249 -231 12.8014 0.152
NP_440327.1_6 Reverse -174 -193 2.26107 0.298
NP_441132.1_2 Reverse -5 -24 7.37428 0.163
NP_440161.1_3 Forward -196 -177 10.1275 0.232
NP_440586.1_8 Forward -193 -186 13.2151 0.026
NP_440586.1_8 Reverse -186 -193 13.2151 0.026
NP_442251.1_6 Forward -193 -186 15.2804 0.0124
NP_442251.1_6 Reverse -186 -193 15.2804 0.0124
NP_440684.1_9 Reverse -179 -193 12.0943 0.168
NP_441262.1_3 Reverse -185 -192 14.7888 0.0223
NP_441262.1_3 Forward -194 -187 14.7888 0.0223
NP_440027.1_3 Reverse -320 -338 1.5917 0.3
NP_443051.1_1 Forward -195 -186 19.5676 0.00335
NP_443051.1_1 Reverse -184 -193 10.4228 0.00754
NP_439937.1_9 Reverse -351 -368 -16.678 0.287
NP_442294.1_3 Reverse -137 -151 13.8636 0.252
NP_440626.1_1 Forward -193 -174 9.53674 0.258
NP_440439.1_1 Forward -197 -184 12.6056 0.0238
NP_442239.1_8 Forward -333 -314 6.29264 0.266
NP_440372.1_2 Forward -193 -186 16.3621 0.0124
NP_440372.1_2 Reverse -186 -193 16.3621 0.0124
NP_441138.1_5 Forward -90 -77 6.8417 0.261
NP_441789.1_7 Reverse -316 -335 4.91521 0.193
NP_442384.1_10 Reverse -185 -198 1.9859 0.24
NP_442384.1_10 Forward -194 -181 1.10092 0.268
NP_441018.1_7 Forward -333 -314 8.35759 0.249
NP_442790.1_4 Reverse -176 -195 -9.63698 0.19
NP_442262.1_10 Forward -193 -186 14.1988 0.0123
NP_442262.1_10 Reverse -186 -193 14.1988 0.0123
NP_441689.1_5 Forward -196 -186 8.43603 0.132
NP_441689.1_5 Reverse -183 -193 5.78111 0.197
NP_440344.1_10 Reverse -178 -195 -1.63279 0.0557
NP_440344.1_10 Forward -201 -184 -2.02611 0.06
NP_440282.1_10 Reverse -316 -335 -9.93197 0.29
NP_440531.1_6 Forward -202 -183 -3.04881 0.26
NP_442123.1_3 Reverse -185 -204 19.8623 0.0449
NP_442910.1_1 Reverse -178 -197 -7.67036 0.258
NP_441965.1_10 Forward -197 -181 4.0901 0.249
NP_442556.1_10 Forward -255 -236 12.2685 0.217
NP_440297.1_9 Forward -193 -183 -0.118297 0.282
NP_440297.1_9 Reverse -186 -196 -0.314959 0.282
NP_440350.1_5 Forward -41 -22 -4.42544 0.273
NP_441592.1_4 Reverse -48 -67 -0.885524 0.247
NP_440700.1_8 Forward -346 -332 13.4709 0.232
NP_442078.1_2 Forward -251 -232 18.4857 0.102
NP_440999.1_9 Forward -198 -184 2.45787 0.149
NP_440888.1_2 Reverse -185 -199 15.2402 0.0118
NP_440888.1_2 Reverse -344 -358 9.14375 0.137
NP_440888.1_2 Forward -194 -180 7.66879 0.186
NP_440888.1_2 Forward -57 -43 5.1122 0.293
NP_440600.1_4 Reverse -177 -195 -1.35749 0.163
NP_441543.1_2 Forward -193 -184 16.9127 0.00359
NP_441543.1_2 Reverse -186 -195 15.9293 0.00518
NP_442845.1_2 Forward -200 -186 5.50613 0.231
NP_441178.1_6 Reverse -316 -335 3.24359 0.269
NP_442710.1_1 Reverse -313 -332 7.96426 0.23
NP_441469.1_8 Forward -195 -186 6.5879 0.227
NP_441469.1_8 Reverse -184 -193 6.48957 0.227
NP_442637.1_1 Reverse -365 -384 -0.197208 0.156
NP_443064.1_6 Forward -194 -184 12.5669 0.0796
NP_443064.1_6 Reverse -185 -195 10.8217 0.13
NP_442578.1_7 Forward -193 -186 14.5921 0.026
NP_442578.1_7 Reverse -186 -193 14.5921 0.026
NP_441462.1_2 Reverse -185 -195 20.2362 0.000805
NP_441462.1_2 Forward -194 -184 11.5831 0.00406
NP_441621.1_7 Reverse -183 -197 -5.31028 0.25
NP_443062.1_1 Reverse -362 -380 4.15809 0.272
NP_443062.1_1 Forward -194 -176 3.86557 0.282
NP_443062.1_6 Reverse -177 -196 1.37609 0.276
NP_441410.1_3 Reverse -176 -195 9.83255 0.191
NP_442204.1_1 Forward -375 -364 0.94365 0.281
NP_442204.1_1 Forward -198 -187 0.451995 0.281
NP_440516.1_8 Forward -194 -185 16.9127 0.00442
NP_440516.1_8 Reverse -185 -194 16.9127 0.00442
NP_441033.1_2 Reverse -175 -194 2.16274 0.135
NP_442428.1_5 Forward -193 -186 15.8704 0.0124
NP_442428.1_5 Reverse -186 -193 15.8704 0.0124
NP_442859.1_6 Forward -156 -137 13.6666 0.0659
NP_441867.1_2 Reverse -219 -238 -11.8986 0.239
NP_440673.1_2 Forward -204 -185 14.4868 0.0986
NP_440673.1_3 Forward -192 -185 12.4288 0.0426
NP_440673.1_3 Reverse -187 -194 12.4288 0.0426
NP_440673.1_3 Forward -55 -48 8.98723 0.203
NP_441052.1_2 Forward -194 -184 19.9412 0.00106
NP_441052.1_2 Reverse -185 -195 10.4031 0.0285
NP_442219.1_8 Reverse -138 -157 6.23444 0.3
NP_442219.1_9 Forward -193 -184 17.7976 0.00718
NP_442219.1_9 Reverse -186 -195 8.25953 0.0681
NP_440436.1_4 Forward -193 -184 17.2072 0.00233
NP_440436.1_4 Reverse -186 -195 9.24241 0.0871
NP_440436.1_4 Forward -56 -47 7.76745 0.124
NP_441884.1_9 Reverse -182 -201 -11.8986 0.133
NP_441884.1_9 Forward -197 -178 -23.2067 0.284
NP_441719.1_4 Forward -193 -186 16.3621 0.0124
NP_441719.1_4 Reverse -186 -193 16.3621 0.0124
NP_442366.1_3 Forward -195 -177 12.8022 0.0272
NP_442366.1_5 Reverse -182 -192 14.8275 0.0375
NP_442873.1_2 Forward -201 -182 10.0284 0.266
NP_442694.1_4 Reverse -140 -149 13.3727 0.225
NP_440328.1_4 Reverse -179 -198 10.3242 0.0866
NP_443054.1_2 Forward -196 -182 1.86788 0.245
NP_441851.1_10 Reverse -184 -194 15.8113 0.00552
NP_441851.1_10 Forward -195 -185 8.53483 0.114
NP_441851.1_10 Reverse -308 -318 7.05986 0.149
NP_441851.1_10 Forward -383 -373 3.91327 0.296
NP_442939.1_4 Forward -90 -72 17.7179 0.193
NP_441542.1_4 Forward -155 -141 5.1128 0.264
NP_441542.1_4 Reverse -136 -150 3.73617 0.264
NP_441542.1_4 Forward -368 -354 3.44117 0.282
NP_441668.1_4 Reverse -175 -194 5.80098 0.164
NP_442515.1_1 Reverse -184 -198 12.291 0.0339
NP_442515.1_1 Reverse -343 -357 -3.54032 0.292
NP_441982.1_6 Forward -153 -144 12.6763 0.274
NP_440165.1_5 Forward -195 -176 -6.98204 0.256
NP_441349.1_10 Reverse -175 -194 9.93088 0.0234
NP_440432.1_9 Reverse -186 -201 9.518 0.0423
NP_440432.1_9 Forward -193 -178 0.569883 0.159
NP_442843.1_1 Forward -370 -351 7.37428 0.135
NP_440474.1_8 Reverse -186 -200 14.8469 0.0595
NP_440431.1_4 Reverse -70 -89 -8.92892 0.275
NP_442450.1_5 Reverse -183 -193 7.55152 0.13
NP_440195.1_4 Forward -365 -346 4.22769 0.297
NP_440195.1_5 Forward -200 -181 3.34271 0.273
NP_440040.1_8 Forward -153 -134 5.0129 0.239
NP_440040.1_8 Reverse -68 -87 4.34446 0.264
NP_441570.1_1 Reverse -185 -203 0.0191479 0.0424
NP_441570.1_1 Forward -194 -176 -10.3056 0.166
NP_441570.1_1 Reverse -263 -281 -12.5672 0.215
NP_440078.1_10 Forward -382 -363 5.30933 0.226
NP_441078.1_4 Forward -194 -185 19.6659 0.0007
NP_441078.1_4 Reverse -185 -194 19.6659 0.0007
NP_440793.1_1 Forward -126 -112 10.717 0.284
NP_440526.1_3 Forward -193 -182 10.2846 0.0646
NP_440526.1_3 Forward -56 -45 7.33466 0.153
NP_440526.1_3 Reverse -186 -197 2.31981 0.267
NP_441432.1_8 Reverse -184 -193 16.8143 0.00595
NP_441432.1_8 Forward -195 -186 16.8143 0.00595
NP_441432.1_8 Reverse -47 -56 5.40793 0.158
NP_443024.1_4 Reverse -82 -96 18.7801 0.129
NP_442320.1_8 Reverse -179 -193 3.63784 0.0578
NP_442320.1_8 Forward -200 -186 -1.18038 0.0817
NP_441732.1_2 Reverse -181 -197 -6.52964 0.0495
NP_441732.1_2 Forward -198 -182 -6.7263 0.0495
NP_440199.1_10 Reverse -182 -192 7.25653 0.231
NP_441072.1_2 Reverse -174 -193 9.43923 0.218
NP_442400.1_10 Forward -148 -135 8.17859 0.279
NP_440713.1_4 Forward -204 -185 2.26107 0.266
NP_442489.1_7 Forward -194 -185 20.1576 0.000695
NP_442489.1_7 Reverse -185 -194 20.1576 0.000695
NP_440559.1_1 Forward -193 -184 17.4043 0.00658
NP_440559.1_1 Reverse -186 -195 8.65285 0.0586
NP_441659.2_8 Reverse -185 -195 20.9245 0.000805
NP_441659.2_8 Forward -194 -184 18.1713 0.00133
NP_442913.1_10 Reverse -176 -195 2.65439 0.123
NP_442913.1_10 Forward -203 -184 0.58944 0.153
NP_439912.1_5 Reverse -293 -312 8.55425 0.274
NP_440708.1_6 Reverse -364 -383 -10.1286 0.277
NP_440779.1_5 Forward -194 -177 3.38209 0.073
NP_440779.1_5 Reverse -185 -202 -4.77938 0.116
NP_442346.1_5 Reverse -184 -194 16.6963 0.00248
NP_442346.1_5 Forward -195 -185 16.303 0.00248
NP_442346.1_5 Reverse -47 -57 11.2881 0.0706
NP_440545.1_3 Reverse -181 -198 4.6604 0.0679
NP_440025.1_1 Reverse -181 -200 14.5524 0.147
NP_440486.1_6 Forward -207 -188 7.66927 0.261
NP_440010.1_10 Forward -206 -187 3.6377 0.25
NP_442311.1_5 Reverse -287 -306 1.96607 0.254
NP_442603.1_10 Forward -331 -314 18.4522 0.13
NP_441050.1_5 Reverse -44 -62 -1.84914 0.271
NP_441948.1_4 Reverse -178 -196 -2.0458 0.158
NP_441833.1_4 Forward -193 -186 15.9687 0.0124
NP_441833.1_4 Reverse -186 -193 15.9687 0.0124
NP_442799.1_8 Reverse -303 -322 11.3026 0.172
NP_441112.1_6 Forward -204 -185 2.45773 0.241
NP_442162.1_9 Forward -193 -186 16.2637 0.0124
NP_442162.1_9 Reverse -186 -193 16.2637 0.0124
NP_442055.1_8 Reverse -183 -202 11.405 0.254
NP_442073.1_6 Forward -203 -184 1.17943 0.25
NP_442199.1_5 Forward -202 -183 4.81767 0.101
NP_442140.1_3 Forward -193 -183 12.2714 0.0632
NP_442140.1_3 Reverse -186 -196 7.94484 0.124
NP_441671.1_10 Forward -205 -186 12.5858 0.137
NP_440875.1_9 Reverse -187 -197 14.5042 0.0411
NP_441813.1_5 Forward -196 -186 8.73149 0.0367
NP_441813.1_5 Reverse -183 -193 8.63316 0.0367
NP_442089.1_1 Reverse -182 -201 -0.4922 0.261
NP_440590.1_4 Reverse -186 -199 3.16588 0.0756
NP_440590.1_4 Forward -193 -180 2.2809 0.0939
NP_440567.1_1 Reverse -186 -200 12.1926 0.0248
NP_440567.1_1 Forward -193 -179 4.52282 0.118
NP_442497.1_10 Reverse -186 -195 17.601 0.00813
NP_442497.1_10 Forward -193 -184 10.4228 0.0087
NP_440821.1_4 Forward -196 -186 10.7964 0.0146
NP_440821.1_4 Reverse -183 -193 9.41981 0.0286
NP_441239.1_9 Forward -196 -184 14.887 0.0247
NP_441239.1_9 Reverse -183 -195 3.38223 0.285
NP_442568.1_8 Forward -148 -134 16.4209 0.192
NP_441727.1_3 Reverse -178 -197 16.3224 0.116
NP_441727.1_3 Forward -201 -182 3.83436 0.275
NP_441892.1_1 Forward -203 -186 4.6604 0.108
NP_441892.1_1 Reverse -176 -193 -0.157821 0.179
NP_441892.1_10 Forward -258 -239 14.2574 0.262
NP_440876.1_5 Reverse -187 -206 5.50599 0.283
NP_440546.1_4 Reverse -185 -195 13.5365 0.0459
NP_440546.1_4 Forward -194 -184 10.046 0.109
NP_442349.1_6 Reverse -182 -201 1.27776 0.214
NP_440462.1_6 Forward -196 -186 19.4496 0.00371
NP_440462.1_6 Reverse -183 -193 1.35667 0.294
NP_442340.1_3 Reverse -187 -206 -5.40875 0.223
NP_440868.1_4 Forward -198 -186 16.7552 0.0136
NP_440868.1_4 Reverse -181 -193 5.93884 0.0879
NP_442479.1_9 Forward -373 -354 -8.55534 0.266
NP_441474.1_1 Reverse -316 -335 3.14526 0.242
NP_442402.1_4 Forward -117 -98 -8.16275 0.278
NP_441084.1_6 Forward -196 -182 13.9011 0.115
NP_441084.1_6 Forward -59 -45 13.0285 0.146
NP_441084.1_6 Reverse -28 -42 12.1559 0.169
NP_441843.2_9 Reverse -187 -205 12.1455 0.205
NP_442039.1_4 Forward -193 -186 15.1821 0.0124
NP_442039.1_4 Reverse -186 -193 15.1821 0.0124
NP_442039.1_7 Forward -155 -145 7.55152 0.275
NP_440753.1_5 Forward -320 -301 13.8641 0.122
NP_442679.1_1 Reverse -72 -91 3.53937 0.147
NP_440825.1_7 Forward -193 -183 12.9096 0.152
NP_442696.1_2 Reverse -184 -202 11.7205 0.157
NP_442837.1_3 Forward -193 -186 15.7721 0.0124
NP_442837.1_3 Reverse -186 -193 15.7721 0.0124
NP_440805.1_4 Reverse -63 -82 17.4269 0.0839
NP_442053.1_1 Forward -194 -185 18.3876 0.0007
NP_442053.1_1 Reverse -185 -194 18.3876 0.0007
NP_442053.1_1 Reverse -344 -353 4.22796 0.261
NP_440505.1_3 Forward -196 -186 15.418 0.0114
NP_440505.1_3 Reverse -183 -193 9.22315 0.122
NP_440505.1_3 Reverse -46 -56 4.60159 0.277
NP_440505.1_7 Forward -327 -308 -2.36049 0.289
NP_441203.1_1 Forward -193 -174 -20.2567 0.297
NP_442532.1_7 Reverse -185 -199 13.2743 0.0849
NP_440914.1_1 Forward -194 -184 17.5935 0.000537
NP_440914.1_1 Reverse -185 -195 16.3248 0.00196
NP_441699.1_7 Reverse -145 -164 6.48849 0.255
NP_441011.1_8 Reverse -186 -195 16.6177 0.00602
NP_441011.1_8 Forward -193 -184 8.25953 0.144
NP_442533.1_1 Forward -338 -319 -2.95047 0.14
NP_442533.1_6 Forward -194 -185 17.2076 0.00137
NP_442533.1_6 Reverse -185 -194 17.2076 0.00137
NP_442533.1_6 Reverse -326 -335 1.86802 0.284
NP_442322.1_4 Reverse -317 -334 3.08639 0.205
NP_442229.1_1 Forward -196 -182 9.24208 0.184
NP_443016.1_1 Reverse -179 -198 -1.7705 0.223
NP_441482.1_7 Forward -200 -186 -10.5218 0.209
NP_439944.1_9 Reverse -186 -196 17.7779 0.00341
NP_439944.1_9 Forward -193 -183 10.5014 0.0887
NP_441028.1_6 Forward -306 -296 6.0761 0.232
NP_441028.1_6 Forward -126 -116 5.38779 0.255
NP_441028.1_6 Reverse -7 -17 5.38779 0.255
NP_441527.1_4 Reverse -75 -94 -9.1199 0.255
NP_441527.1_4 Reverse -71 -90 -11.0297 0.278
NP_441527.1_7 Forward -44 -25 8.4551 0.282
NP_440115.1_6 Forward -197 -187 16.008 0.0325
NP_439965.1_5 Reverse -272 -291 8.75009 0.299
NP_442492.1_2 Forward -194 -175 2.0644 0.224
NP_443045.1_9 Reverse -318 -336 7.09821 0.279
NP_441106.1_1 Forward -195 -186 18.486 0.0028
NP_441106.1_1 Reverse -184 -193 9.63616 0.0311
NP_442306.1_10 Reverse -339 -358 -20.8467 0.231
NP_441286.1_1 Reverse -184 -196 14.6903 0.00418
NP_441286.1_1 Forward -195 -183 3.48056 0.0467
NP_440670.1_8 Forward -194 -185 18.3876 0.000699
NP_440670.1_8 Reverse -185 -194 18.3876 0.000699
NP_441930.1_3 Reverse -160 -179 2.58046 0.295
NP_440886.1_7 Forward -195 -185 8.04271 0.0805
NP_440886.1_7 Reverse -184 -194 7.94438 0.0805
NP_442614.1_2 Forward -353 -339 6.98109 0.276
NP_440513.1_6 Forward -204 -185 10.52 0.225
NP_442401.1_2 Reverse -184 -203 11.5033 0.163
NP_440907.2_8 Reverse -186 -196 19.1541 0.00362
NP_440907.2_8 Forward -193 -183 7.64939 0.117
NP_441021.1_1 Forward -193 -174 -9.14533 0.209
NP_441021.1_8 Reverse -180 -198 8.18062 0.181
NP_440841.1_4 Forward -196 -177 -2.85214 0.174
NP_441463.1_3 Forward -204 -185 -2.0655 0.149
NP_441463.1_3 Reverse -175 -194 -8.45701 0.27
NP_442842.1_7 Forward -255 -236 14.2574 0.283
NP_442842.1_10 Forward -86 -67 5.12514 0.208
NP_441626.1_2 Forward -193 -186 15.7721 0.0124
NP_441626.1_2 Reverse -186 -193 15.7721 0.0124
NP_442794.1_1 Reverse -181 -193 2.69391 0.286
NP_442615.1_1 Reverse -176 -194 7.4923 0.0317
NP_442615.1_1 Forward -203 -185 7.00065 0.0331
NP_441962.1_4 Forward -199 -180 -8.26035 0.198
NP_440387.1_1 Reverse -185 -201 7.53169 0.0282
NP_440387.1_1 Forward -194 -178 -2.39974 0.147
NP_440387.1_1 Reverse -344 -360 -5.74299 0.249
NP_441431.1_2 Forward -197 -183 16.2235 0.0387
NP_441431.1_2 Reverse -315 -329 6.39049 0.272
NP_441993.1_1 Forward -334 -315 4.96787 0.21
NP_440114.1_10 Reverse -185 -199 18.6825 0.00487
NP_440114.1_10 Forward -194 -180 9.5377 0.169
NP_441206.1_7 Reverse -179 -197 5.42735 0.2
NP_440287.1_6 Forward -59 -40 0.982764 0.286
NP_441720.1_2 Forward -198 -179 6.09517 0.217
NP_440293.1_3 Forward -336 -317 -3.93378 0.256
NP_440293.1_9 Forward -328 -314 12.6971 0.228
NP_440766.1_5 Forward -154 -142 8.89719 0.277
NP_441237.1_9 Forward -193 -183 14.828 0.0242
NP_442743.1_1 Reverse -353 -372 7.66846 0.264
NP_442278.1_3 Forward -275 -257 13.5482 0.256
NP_440457.1_1 Forward -198 -186 0.333971 0.25
NP_440798.1_6 Reverse -186 -199 10.1474 0.0808
NP_442680.1_5 Forward -155 -136 -0.220842 0.278
NP_441984.1_3 Reverse -314 -332 13.2938 0.153
NP_441332.1_6 Reverse -342 -352 11.2595 0.261
NP_441436.1_8 Reverse -47 -66 10.7175 0.262
NP_442509.1_9 Forward -194 -184 8.14104 0.192
NP_442509.1_9 Reverse -185 -195 8.04271 0.192
NP_441253.1_8 Reverse -180 -194 15.113 0.122
NP_442514.1_5 Reverse -318 -337 -5.01617 0.254
NP_440554.1_4 Reverse -186 -196 15.418 0.0199
NP_442862.1_3 Reverse -357 -374 4.95539 0.28
NP_441885.1_5 Forward -194 -184 20.9245 0.000538
NP_441885.1_5 Reverse -185 -195 11.3864 0.00668
NP_441885.1_5 Forward -353 -343 -0.216628 0.189
NP_442341.1_7 Reverse -184 -198 2.65453 0.249
NP_442341.1_9 Forward -196 -182 10.8154 0.133
NP_442341.1_9 Forward -337 -323 4.91554 0.287
NP_441173.1_9 Forward -118 -110 14.0803 0.17
NP_441173.1_9 Reverse -145 -153 13.2937 0.17
NP_441173.1_9 Forward -117 -109 10.9338 0.242
NP_443000.1_7 Forward -196 -186 10.7964 0.0345
NP_443000.1_7 Reverse -183 -193 10.3048 0.0345
NP_442513.1_5 Forward -202 -183 7.4718 0.282
NP_440727.1_8 Forward -138 -124 14.0489 0.274
NP_441842.1_10 Forward -201 -187 17.2075 0.0253
NP_441842.1_10 Reverse -178 -192 13.7659 0.0689
NP_440275.1_3 Forward -196 -186 18.6629 0.0082
NP_440275.1_3 Reverse -183 -193 8.04317 0.0602
NP_440091.1_1 Reverse -181 -193 8.88877 0.0567
NP_440091.1_1 Forward -198 -186 8.39711 0.0653
NP_442275.1_1 Reverse -139 -158 0.58944 0.285
NP_443010.1_10 Forward -197 -180 7.60248 0.167
NP_442495.1_4 Forward -336 -326 14.4347 0.16
NP_440149.1_8 Reverse -185 -204 -4.03212 0.201
NP_442373.1_2 Forward -336 -317 -0.590531 0.198
NP_440216.1_1 Reverse -185 -199 6.29277 0.0156
NP_440216.1_1 Forward -194 -180 -1.77037 0.0383
NP_440172.1_1 Reverse -185 -195 17.5813 0.00421
NP_440172.1_1 Forward -194 -184 15.0247 0.00945
NP_440172.1_1 Reverse -48 -58 4.0116 0.208
NP_442015.1_10 Reverse -181 -194 1.59258 0.204
NP_441226.1_7 Forward -193 -186 14.4934 0.0123
NP_441226.1_7 Reverse -186 -193 14.4934 0.0123
NP_441226.1_7 Forward -352 -345 7.1186 0.218
NP_441226.1_7 Reverse -344 -351 6.82361 0.246
NP_441111.1_7 Forward -193 -185 18.7023 0.00294
NP_441111.1_7 Reverse -186 -194 18.7023 0.00294
NP_442379.1_10 Forward -201 -184 -3.40274 0.259
NP_441766.1_2 Forward -194 -185 17.5026 0.00297
NP_441766.1_2 Reverse -185 -194 17.5026 0.00297
NP_440416.1_1 Reverse -185 -204 -14.5535 0.291
NP_440416.1_9 Reverse -336 -355 -9.24366 0.129
NP_440416.1_9 Reverse -178 -197 -15.3402 0.189
NP_443052.1_8 Forward -204 -185 2.94938 0.0531
NP_443052.1_8 Reverse -175 -194 -10.4236 0.208
NP_443052.1_9 Reverse -316 -335 -7.27704 0.295
NP_440885.1_6 Reverse -139 -158 6.92008 0.237
NP_442403.1_1 Reverse -136 -155 17.0099 0.145
NP_440261.1_5 Reverse -186 -199 -2.83231 0.0932
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

GATGAAGCTAAGGAGTTGGGCCATTCCAAAGCGTTGGACAGAATTGCGGCGGACGGCAGAAAGTATGGGCTGGGCCTGTGGGTGGCTTCCCAGTCTTCCCGCCATATTTCCAAGGATGTGCTAACCAATACGTTCACTAAGCTGATTCTGCCGGTTGATTCTTCCGAGTTACCCCTAACTGCCCGCACCTTTAGGTTTTCCGAGGAGGCGATCGCCAATTTGAATCCCCTGGAATCATTGGTACGCTTTGGCAAAAATGCCAATAAAGTTAACATTGTCCCCTTTTACCAAAGGAATACACCATGATTGGTTCTTTGATTATTCTTTCTTTAGTTGGTATGCAAACCATTGCCACTTGTCTGCTCCTCGCTTTTTTAGTTCTTAGGGAGGACAAAATGCT

CDS

ATGAATTGGCGGGCTTTACTGTTGGCGGTAATCCTCGGCACTGTGGTCTTTGGCGGCCTCCATGCCCAAACCAACACTACTAATACCCCTAGCAATAATTCTTCCCTCACTACTCCCAACCGGCTCAAAATTAATCTCACCCTAGGTGACCCCACGGAACTGAAGGTGCGGGAAGGGGATACGGTTAACCGCGGTCAGGTGCTATCGGACAAAGAAGCGGAACGCTCCCGACTAGAACGGGATCAACGGGAACGCCTCCTGGCGATCGCCAATGTGGAAGGTCAATTGGTGCCCACCCTACAACCGGCCCCAGCTTTGCGGGAATTGCCCCCCGTTTCCTACACCGTGGAAGAAACCGCCATTCAATTAGCGGAAATTAAGCTAGCCCAGGCCCAACGGAATCTCGCCACGGCGATCGAGGCTGACCCCTTCATTTCTGCCAAGGCCAAGGTAGAACGTTCCCTAGCTGATGTGGAAGCGGCCCACCGGGCTTTTGAGTTACAGCAACGCAAACTAGATGCGGTCAATGGTTTGAAGGGTTTGCCGCCGGAGATGTTGACCCACGAAACGGAAAAGTTACGCCAGGTCAGGACGGCATTGGAGGGTAAGGAAGCGGAGTATAAATTTTTCCAAGCGGAATATTTCCAGGTGGAAGCAGACCGCCGCAAAGAGTTAACTGATCTGCAAAGTAAGGTCAGCATTGCCCGGGGGGAATTGGAACAGGCCCAGTCCAGGTTACGGGCGGCCAAGGAAAACCGAGAACTGGCGGAATATAACCACCGCATCACCATTTCCCGCCGAGCGGAGGAAGAAAATCAGGTGGCCATTAATGTGGCCAATCAAAAATTAGACCGGGAGTTCAAGTTGGCCCAGCTCCGGGAGCAATTATCCGCTGTGGAGGAAAAGCTCAATGGCATTGTTCAAATCAAAAGTCCTTACTCTGGCACTATTCGCCGCATTAAGTTTGACCGCCAAACCGACGGTAAGCTGGCCGTTACCCTCTACCTCGACACTACTAACCCAAATCCCTAG

Protein

No sequence available