Your browser is old and dusty. Try Google Chrome!

Details for slr6004

ORF slr6004
Accession NP_942447.1
Symbol
Category
Definition
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_442711.1_1 Forward -342 -328 11.0127 0.256
NP_441605.1_6 Forward -235 -216 4.42435 0.207
NP_442291.1_5 Reverse -185 -201 6.05672 0.0727
NP_442272.1_2 Forward -224 -205 10.7424 0.241
NP_441453.1_4 Forward -195 -187 4.14932 0.264
NP_442328.1_9 Reverse -338 -357 17.5024 0.0215
NP_440561.1_8 Forward -22 -3 14.4541 0.24
NP_443027.1_4 Reverse -184 -194 5.78156 0.298
NP_442062.1_3 Forward -80 -61 0.687771 0.233
NP_442062.1_8 Forward -195 -185 5.97822 0.143
NP_442062.1_8 Forward -342 -332 4.60159 0.206
NP_442062.1_8 Reverse -186 -196 3.22496 0.279
NP_442062.1_8 Reverse -110 -120 3.02829 0.289
NP_440304.1_4 Forward -357 -347 2.83163 0.299
NP_441208.1_9 Forward -345 -331 9.93102 0.197
NP_440769.1_8 Reverse -245 -264 10.1275 0.188
NP_441083.1_5 Reverse -333 -343 4.79825 0.13
NP_441083.1_5 Reverse -35 -45 0.57002 0.223
NP_442827.1_8 Forward -46 -27 -2.26292 0.272
NP_440209.1_1 Forward -195 -187 5.0343 0.194
NP_441770.1_10 Forward -344 -325 13.5691 0.213
NP_440747.1_10 Forward -345 -333 -12.2524 0.254
NP_441486.1_1 Forward -198 -184 1.57289 0.106
NP_441014.1_8 Reverse -339 -358 -5.70374 0.274
NP_441014.1_10 Forward -196 -177 11.2084 0.118
NP_442848.1_1 Forward -201 -187 -3.54032 0.268
NP_443018.1_3 Reverse -187 -194 11.5438 0.0752
NP_443018.1_3 Reverse -111 -118 6.62729 0.168
NP_441634.1_9 Forward -287 -268 7.96345 0.294
NP_440376.1_1 Forward -342 -333 3.63797 0.2
NP_442687.1_7 Reverse -332 -342 3.81494 0.286
NP_440642.1_10 Reverse -351 -365 1.67063 0.29
NP_442658.1_1 Reverse -184 -194 5.58445 0.262
NP_442496.1_5 Forward -209 -191 4.54237 0.289
NP_442685.1_2 Reverse -370 -380 14.0414 0.275
NP_439990.1_7 Forward -102 -83 12.0942 0.18
NP_443055.1_6 Reverse -345 -363 -1.84987 0.284
NP_442002.1_9 Forward -356 -349 11.3472 0.185
NP_442002.1_9 Reverse -332 -339 9.08556 0.289
NP_440411.1_10 Forward -343 -324 11.14 0.265
NP_441646.1_1 Forward -299 -280 0.0977854 0.254
NP_440147.1_4 Reverse -40 -53 0.412608 0.255
NP_441550.1_8 Reverse -3 -13 4.7978 0.283
NP_441916.1_7 Forward -195 -185 3.32329 0.22
NP_441041.1_7 Reverse -330 -342 10.916 0.0864
NP_439966.1_7 Forward -197 -187 9.91099 0.0968
NP_442941.1_3 Reverse -187 -197 0.471689 0.203
NP_440260.1_7 Reverse -339 -358 1.0811 0.241
NP_441514.1_4 Forward -222 -203 19.2984 0.0744
NP_442281.1_1 Forward -200 -186 1.96562 0.282
NP_442281.1_1 Reverse -328 -342 1.67063 0.293
NP_441058.2_6 Reverse -357 -376 14.3558 0.253
NP_440375.1_8 Forward -194 -175 2.0644 0.233
NP_441644.1_6 Reverse -186 -196 3.71617 0.267
NP_442177.1_3 Forward -211 -192 16.0274 0.221
NP_442933.1_10 Forward -195 -186 5.3096 0.203
NP_442933.1_10 Reverse -186 -195 4.62128 0.227
NP_439922.1_3 Reverse -250 -269 9.31004 0.288
NP_442554.1_8 Reverse -187 -197 5.38824 0.15
NP_442142.1_4 Forward -198 -185 6.41022 0.168
NP_440775.1_6 Forward -269 -250 20.8646 0.0338
NP_443009.1_5 Forward -196 -185 5.66304 0.193
NP_443009.1_5 Forward -343 -332 5.07306 0.218
NP_440379.1_2 Reverse -176 -195 23.8939 0.0226
NP_441468.1_1 Reverse -187 -194 4.07068 0.263
NP_439939.1_4 Reverse -343 -362 2.0644 0.199
NP_441826.1_2 Forward -201 -187 0.982901 0.167
NP_442868.1_6 Reverse -130 -140 6.56821 0.107
NP_441251.1_8 Reverse -313 -326 13.9081 0.254
NP_442808.1_1 Reverse -129 -139 2.63453 0.26
NP_442542.1_2 Reverse -331 -344 5.82081 0.247
NP_440038.1_7 Forward -131 -112 22.8122 0.0369
NP_440558.1_2 Forward -286 -267 -2.65548 0.229
NP_441878.1_6 Forward -343 -333 -7.59145 0.245
NP_441878.1_10 Forward -88 -74 11.701 0.289
NP_441036.1_8 Reverse -185 -195 6.66654 0.22
NP_441557.1_5 Forward -195 -186 -0.983583 0.272
NP_441433.1_8 Reverse -355 -374 4.12936 0.188
NP_441467.1_5 Reverse -316 -326 15.9097 0.232
NP_442645.1_2 Forward -203 -184 -17.2085 0.25
NP_442998.1_5 Forward -309 -299 13.2547 0.158
NP_442998.1_5 Reverse -365 -375 11.6814 0.179
NP_442998.1_5 Reverse -319 -329 7.94484 0.278
NP_440731.1_2 Forward -185 -166 4.12936 0.295
NP_440299.1_6 Reverse -116 -135 8.06259 0.237
NP_441799.1_1 Reverse -1 -15 6.0955 0.183
NP_443042.1_5 Reverse -186 -205 12.5432 0.264
NP_441559.1_8 Reverse -126 -140 -4.4253 0.223
NP_440915.1_6 Reverse -329 -343 11.2093 0.0267
NP_442158.1_4 Reverse -357 -367 11.2881 0.28
NP_441866.1_2 Reverse -210 -229 19.0502 0.159
NP_441704.1_9 Reverse -327 -341 19.2725 0.079
NP_440695.1_6 Forward -108 -94 15.6471 0.166
NP_441199.1_6 Forward -145 -126 -0.787193 0.282
NP_442993.1_1 Forward -335 -319 -10.3645 0.217
NP_442386.1_9 Reverse -185 -194 4.91586 0.276
NP_441297.1_8 Forward -333 -315 12.8997 0.152
NP_441160.1_1 Reverse -338 -357 -3.63879 0.236
NP_440586.1_8 Reverse -187 -194 10.9535 0.119
NP_440586.1_8 Reverse -21 -28 8.88855 0.205
NP_439937.1_9 Forward -343 -326 -3.40342 0.157
NP_440439.1_1 Forward -345 -332 -1.849 0.285
NP_440171.1_3 Forward -345 -326 1.17943 0.294
NP_441572.1_7 Reverse -327 -346 -4.81876 0.244
NP_440267.1_2 Reverse -109 -123 7.07881 0.21
NP_442262.1_10 Reverse -187 -194 11.7405 0.0841
NP_442262.1_10 Reverse -111 -118 10.1672 0.162
NP_440531.1_6 Reverse -275 -294 5.30933 0.115
NP_442750.1_1 Forward -229 -210 7.4718 0.261
NP_442556.1_10 Forward -350 -331 8.54434 0.284
NP_440297.1_9 Reverse -187 -197 -0.708283 0.294
NP_441103.1_2 Reverse -322 -340 10.5398 0.156
NP_440894.1_10 Forward -294 -275 9.63589 0.159
NP_440999.1_9 Reverse -329 -343 0.491246 0.183
NP_440888.1_2 Forward -342 -328 14.0603 0.0211
NP_440888.1_2 Reverse -353 -367 11.2087 0.0729
NP_440888.1_2 Reverse -144 -158 6.58715 0.228
NP_440888.1_2 Reverse -131 -145 5.01387 0.298
NP_440792.1_1 Forward -59 -40 2.65439 0.286
NP_442147.1_6 Forward -197 -183 15.4369 0.254
NP_442077.1_9 Reverse -205 -224 1.0811 0.218
NP_441543.1_2 Reverse -187 -196 5.50626 0.197
NP_442845.1_2 Forward -20 -6 5.70279 0.225
NP_441304.1_10 Forward -358 -349 15.4377 0.164
NP_440982.1_1 Reverse -5 -24 3.44025 0.297
NP_443064.1_6 Reverse -333 -343 10.6277 0.141
NP_442578.1_7 Reverse -187 -194 5.15232 0.291
NP_440148.1_1 Forward -220 -201 -5.80207 0.236
NP_441462.1_2 Reverse -333 -343 -1.19994 0.291
NP_441929.1_3 Reverse -367 -386 4.32602 0.266
NP_443062.1_1 Forward -195 -177 6.98581 0.188
NP_442204.1_5 Reverse -280 -299 0.884433 0.251
NP_441560.1_8 Reverse -341 -360 12.6814 0.248
NP_442428.1_5 Reverse -187 -194 4.46401 0.267
NP_440455.1_2 Reverse -257 -270 16.6179 0.225
NP_442120.1_10 Forward -361 -342 -15.1435 0.289
NP_440673.1_2 Forward -296 -277 8.73121 0.263
NP_440673.1_3 Forward -193 -186 13.2155 0.0426
NP_440673.1_3 Forward -27 -20 10.9539 0.106
NP_441052.1_2 Reverse -186 -196 4.99491 0.135
NP_440436.1_4 Forward -194 -185 4.32588 0.272
NP_441719.1_4 Reverse -187 -194 3.77569 0.285
NP_441733.1_10 Reverse -330 -343 5.62415 0.21
NP_441004.1_2 Forward -140 -121 -4.42544 0.291
NP_442366.1_1 Reverse -314 -327 15.8506 0.245
NP_440296.1_6 Reverse -204 -222 12.034 0.295
NP_443054.1_2 Forward -344 -330 17.1092 0.0417
NP_441851.1_10 Forward -343 -333 4.69992 0.254
NP_441501.1_6 Reverse -176 -195 11.7992 0.299
NP_442843.1_5 Reverse -210 -229 16.7027 0.194
NP_443047.1_8 Forward -95 -77 21.2586 0.069
NP_442243.1_1 Forward -368 -350 0.215075 0.235
NP_441078.1_4 Reverse -333 -342 -1.86856 0.272
NP_441078.1_4 Reverse -186 -195 -2.06522 0.295
NP_441432.1_9 Reverse -250 -263 14.6097 0.14
NP_441333.1_1 Forward -71 -61 11.3993 0.261
NP_442320.1_8 Reverse -327 -341 -5.01529 0.2
NP_442447.1_6 Forward -200 -186 17.818 0.205
NP_442815.1_2 Forward -140 -122 11.6222 0.144
NP_440199.1_10 Forward -198 -188 8.53483 0.231
NP_441805.1_1 Forward -367 -348 2.94938 0.124
NP_442510.1_9 Reverse -329 -343 18.4858 0.158
NP_442489.1_7 Reverse -186 -195 -1.57357 0.213
NP_442489.1_7 Forward -342 -333 -1.77023 0.247
NP_440559.1_1 Reverse -187 -196 4.62128 0.24
NP_439956.1_7 Forward -288 -269 0.982764 0.292
NP_442346.1_5 Forward -196 -186 5.19158 0.256
NP_441329.1_3 Forward -273 -263 14.3283 0.256
NP_441609.1_1 Forward -170 -151 0.982764 0.202
NP_441609.1_1 Reverse -299 -318 0.491109 0.21
NP_441813.1_3 Reverse -331 -350 14.7221 0.238
NP_441813.1_5 Reverse -184 -194 -0.806614 0.285
NP_442028.1_1 Reverse -212 -225 9.89744 0.251
NP_440590.1_4 Forward -341 -328 1.00259 0.136
NP_441239.1_9 Forward -53 -41 3.97222 0.269
NP_441727.1_8 Forward -140 -121 0.294447 0.27
NP_440400.1_1 Reverse -337 -356 4.03023 0.22
NP_441508.1_4 Reverse -64 -78 15.0993 0.258
NP_442772.1_6 Reverse -98 -117 16.7536 0.196
NP_440833.1_6 Reverse -344 -358 16.0269 0.134
NP_440833.1_6 Reverse -161 -175 7.3738 0.278
NP_441509.1_1 Reverse -211 -230 12.9791 0.209
NP_440462.1_6 Reverse -184 -194 3.61828 0.234
NP_440462.1_6 Reverse -108 -118 2.7333 0.278
NP_442402.1_4 Reverse -72 -91 -5.60616 0.245
NP_442402.1_10 Reverse -179 -189 12.4676 0.212
NP_441848.1_4 Forward -210 -194 7.83714 0.288
NP_441848.1_7 Forward -378 -359 -1.96793 0.258
NP_440505.1_3 Reverse -331 -341 7.55152 0.151
NP_441252.1_6 Forward -9 -2 11.9372 0.25
NP_442533.1_6 Forward -195 -186 5.80125 0.128
NP_442541.1_10 Reverse -126 -140 2.5556 0.255
NP_439944.1_9 Reverse -187 -197 7.25653 0.149
NP_441602.1_3 Forward -347 -328 -3.3438 0.245
NP_442673.1_7 Reverse -28 -47 15.6125 0.159
NP_441106.1_1 Reverse -185 -194 4.42462 0.226
NP_442249.1_10 Reverse -114 -133 8.55425 0.286
NP_441869.1_2 Reverse -103 -122 10.2259 0.264
NP_442674.1_2 Forward -89 -70 15.0441 0.174
NP_442072.1_9 Forward -343 -325 -3.6191 0.0368
NP_442615.1_6 Forward -306 -292 17.3987 0.298
NP_441962.1_4 Forward -140 -121 -6.88371 0.183
NP_442698.1_10 Forward -280 -261 6.09597 0.233
NP_441720.1_6 Forward -27 -8 14.2574 0.25
NP_439911.1_2 Forward -339 -320 19.174 0.0179
NP_440798.1_6 Reverse -111 -124 3.26421 0.151
NP_440801.1_8 Reverse -337 -356 -1.57384 0.278
NP_442509.1_9 Reverse -333 -343 10.8943 0.152
NP_441489.1_3 Forward -115 -101 11.7571 0.211
NP_442582.1_3 Reverse -60 -74 12.9985 0.284
NP_440554.1_4 Forward -194 -184 5.97822 0.128
NP_442703.1_9 Reverse -308 -326 6.11567 0.244
NP_442341.1_7 Forward -343 -329 8.45605 0.0881
NP_442395.2_4 Reverse -332 -351 11.405 0.0907
NP_441359.1_5 Forward -345 -326 15.1424 0.0536
NP_442638.1_3 Forward -215 -196 14.6576 0.274
NP_440149.1_8 Forward -201 -182 -3.63879 0.193
NP_441105.1_3 Forward -353 -334 -5.80207 0.224
NP_440216.1_6 Reverse -326 -342 9.00665 0.118
NP_442371.1_1 Forward -268 -258 13.2542 0.206
NP_442417.1_5 Reverse -16 -30 5.21113 0.271
NP_440416.1_9 Reverse -326 -345 -17.8968 0.248
NP_442116.1_2 Forward -388 -369 11.11 0.289
NP_442116.1_6 Reverse -245 -262 9.41035 0.227
NP_440261.1_5 Forward -140 -127 -11.9771 0.268
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

TACACCGTTTGTCCAGCGAAAACAAGATTTTGTCCACTGGAAAAGGGCAATTTGTCCGGCGGATTGCCGCTGGATTTTTACTCCTTTACGTTGGACAAATTTAAGTTCAGCGTTGGACAGCATTGGACTTGACAGAAAAAAATTGTCATATAGAATCCCCTAAACGACAAGTTCCACAAAAAAATATTTGGGAGATTAAAAAAATGTCCATCGCTGGAAAGTCCAAAGGTGACGTTGTACAACAACTGGAAAAGTCCTACGGGGTAGCCCGGACAACGGTGTTCAATCGGCTGAAATATTTAGGCTATTCGTTGGACAAAGTTGATGATTTGTTCAGTTTGTCCAATGAACAAATGGCTGAACTCGATAAACTTCATCGCTGGATAAGTGATGGGGCAAA

CDS

ATGGCCGATTATCCCAAACCAGGACAATTGACCATGATCACCGATGAAGGAGAACTAGAACAATATGGGGAAGTGATTAATTTTGATGCCCTAGAAGGGGATGAGGAACTGGGTCACGCTGAGCTGATCCGGGCCGCCCAAAATCAAGCGGCGGGGATCTTAATTGCCCAGAATTTACTAACTGCTGAAATCCTGAAAAATCCCCAACATTTACCGGCGGATCTCCAAGCCCAGGTGGAGCAGTCTAAGGTGGCCATCGCCCCAAAGCCCCAGAACCCGTTAGTGATCGCTTCCCAATGGATTACGAAGGCGAAGGCTTACCAGAGCAACCAGAACCATGGTCAACTGGCGGCCTAG

Protein

No sequence available