Your browser is old and dusty. Try Google Chrome!

Details for slr5124

ORF slr5124
Accession NP_942280.1
Symbol
Category
Definition
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_440557.1_1 Reverse -16 -35 -1.47551 0.273
NP_440795.1_7 Forward -23 -16 14.6904 0.0123
NP_440795.1_7 Reverse -16 -23 14.6904 0.0123
NP_440795.1_7 Reverse -391 -398 8.00392 0.218
NP_441418.1_6 Reverse -15 -34 -29.7948 0.238
NP_441418.1_6 Forward -184 -165 -30.1882 0.262
NP_443032.1_7 Forward -232 -213 20.2556 0.123
NP_441453.1_4 Reverse -15 -23 16.539 0.00633
NP_441453.1_4 Forward -24 -16 16.539 0.00633
NP_441453.1_4 Forward -184 -176 5.32929 0.147
NP_441453.1_7 Reverse -378 -385 11.9372 0.298
NP_441623.1_1 Forward -357 -339 -5.19239 0.284
NP_441960.1_3 Reverse -13 -32 12.8414 0.291
NP_442151.1_6 Reverse -15 -29 14.6509 0.0321
NP_442151.1_6 Forward -24 -10 8.55439 0.171
NP_442328.1_9 Forward -260 -241 11.6025 0.0851
NP_441818.1_1 Forward -23 -12 18.446 0.0046
NP_441818.1_9 Reverse -336 -355 -9.83364 0.291
NP_440226.1_1 Forward -24 -5 16.2241 0.022
NP_440226.1_1 Reverse -15 -34 13.4708 0.0356
NP_440226.1_1 Reverse -175 -194 3.34271 0.229
NP_442169.1_1 Reverse -33 -52 6.58763 0.26
NP_441630.1_3 Reverse -167 -186 4.52268 0.163
NP_440996.1_5 Reverse -92 -101 16.8124 0.146
NP_442173.1_1 Forward -23 -15 15.4574 0.00633
NP_442173.1_1 Reverse -16 -24 15.4574 0.00633
NP_442752.1_4 Forward -24 -17 13.8055 0.0199
NP_442752.1_4 Reverse -15 -22 13.8055 0.0199
NP_442752.1_4 Reverse -369 -376 5.25066 0.256
NP_442752.1_4 Reverse -175 -182 4.56234 0.265
NP_443027.1_4 Forward -26 -16 16.2046 0.0437
NP_443027.1_4 Reverse -13 -23 11.0914 0.107
NP_441812.1_3 Reverse -14 -28 19.1741 0.0453
NP_442975.1_10 Forward -28 -14 4.22722 0.245
NP_440784.1_7 Forward -23 -16 15.9687 0.0123
NP_440784.1_7 Reverse -16 -23 15.9687 0.0123
NP_440061.1_9 Forward -26 -12 10.9137 0.121
NP_440061.1_9 Reverse -367 -381 6.48882 0.244
NP_441054.1_4 Reverse -5 -23 2.0841 0.169
NP_442062.1_8 Forward -24 -14 17.3846 0.00193
NP_442062.1_8 Reverse -15 -25 10.3048 0.0493
NP_442062.1_8 Forward -184 -174 3.81494 0.252
NP_440761.1_4 Reverse -10 -29 5.01433 0.0718
NP_441995.1_6 Forward -238 -219 18.879 0.163
NP_441859.1_3 Forward -25 -6 6.68515 0.171
NP_441859.1_3 Forward -178 -159 1.08032 0.296
NP_440304.1_4 Forward -26 -16 19.9412 0.00364
NP_440304.1_4 Reverse -13 -23 1.84832 0.299
NP_442242.1_4 Forward -23 -16 14.3954 0.0124
NP_442242.1_4 Reverse -16 -23 14.3954 0.0124
NP_441581.1_6 Forward -387 -368 13.9464 0.283
NP_440893.1_6 Reverse -17 -36 16.9115 0.223
NP_441208.1_9 Reverse -12 -26 4.71948 0.291
NP_440132.1_1 Forward -220 -202 8.57394 0.269
NP_442110.1_7 Reverse -15 -29 11.701 0.0593
NP_440014.1_6 Forward -33 -14 8.06259 0.254
NP_440330.1_2 Reverse -302 -321 10.9142 0.292
NP_440856.1_4 Forward -326 -307 6.68596 0.0735
NP_441083.1_5 Forward -24 -14 20.3345 0.00053
NP_441083.1_5 Reverse -15 -25 11.2881 0.0159
NP_442827.1_8 Reverse -167 -186 4.12856 0.139
NP_442115.2_7 Reverse -294 -311 10.3636 0.149
NP_441738.1_2 Forward -22 -15 15.28 0.0102
NP_441738.1_2 Reverse -17 -24 15.28 0.0102
NP_441738.1_2 Forward -182 -175 11.7401 0.0647
NP_441558.1_5 Forward -26 -7 8.25926 0.155
NP_440209.1_1 Reverse -15 -23 18.1123 0.00295
NP_440209.1_1 Forward -24 -16 18.1123 0.00295
NP_442889.1_8 Reverse -12 -26 3.24392 0.284
NP_440447.1_6 Reverse -7 -25 5.72234 0.145
NP_441713.1_1 Reverse -9 -28 -4.13045 0.113
NP_441770.1_4 Forward -67 -48 -9.34199 0.25
NP_440178.1_7 Reverse -14 -33 -22.5183 0.267
NP_441716.1_1 Forward -24 -10 4.71948 0.252
NP_441327.1_5 Reverse -48 -57 12.7828 0.29
NP_442111.1_4 Reverse -14 -28 11.0127 0.0518
NP_440906.1_5 Forward -23 -16 15.8704 0.0124
NP_440906.1_5 Reverse -16 -23 15.8704 0.0124
NP_440747.1_10 Reverse -12 -24 16.8536 0.00143
NP_440747.1_10 Forward -27 -15 7.80712 0.00223
NP_441130.1_10 Forward -26 -12 10.4227 0.113
NP_441130.1_10 Forward -151 -137 5.70279 0.218
NP_441486.1_1 Reverse -12 -26 4.22782 0.0475
NP_441486.1_1 Forward -27 -13 -3.44199 0.178
NP_441486.1_1 Reverse -172 -186 -6.29359 0.288
NP_442634.1_4 Reverse -13 -27 17.2075 0.01
NP_443018.1_3 Forward -23 -16 14.8871 0.0123
NP_443018.1_3 Reverse -16 -23 14.8871 0.0123
NP_443018.1_3 Reverse -391 -398 4.07068 0.299
NP_441316.1_7 Reverse -13 -28 -1.5934 0.238
NP_441634.1_8 Reverse -13 -27 -3.34366 0.295
NP_440376.1_1 Forward -24 -15 19.4693 0.000692
NP_440376.1_1 Reverse -15 -24 19.4693 0.000692
NP_441857.1_5 Reverse -8 -26 4.6407 0.222
NP_441588.1_4 Forward -22 -12 8.73149 0.14
NP_442687.1_7 Reverse -174 -184 10.0098 0.0994
NP_442687.1_7 Forward -25 -15 9.02648 0.0994
NP_442687.1_7 Reverse -14 -24 8.92815 0.0994
NP_442485.1_3 Forward -86 -67 2.16274 0.215
NP_440642.1_10 Forward -56 -42 7.96378 0.215
NP_440642.1_10 Reverse -225 -239 2.65393 0.277
NP_441422.1_7 Reverse -13 -30 -3.79607 0.235
NP_440667.1_2 Forward -302 -283 9.43923 0.189
NP_442658.1_1 Forward -26 -16 13.0576 0.04
NP_442658.1_1 Reverse -13 -23 7.94438 0.199
NP_442782.1_2 Reverse -15 -29 1.67122 0.281
NP_442205.1_9 Forward -30 -14 2.51681 0.212
NP_442544.1_6 Forward -31 -12 -7.08038 0.298
NP_441414.1_9 Forward -24 -5 -1.08219 0.0977
NP_441414.1_9 Reverse -15 -34 -4.91709 0.164
NP_441487.1_9 Reverse -211 -230 -1.27885 0.274
NP_441958.1_5 Forward -25 -15 21.2195 0.000805
NP_441958.1_5 Reverse -14 -24 12.2714 0.00183
NP_441958.1_5 Reverse -174 -184 -0.708283 0.221
NP_442836.1_5 Forward -305 -286 2.55606 0.255
NP_440203.1_5 Reverse -18 -28 12.5659 0.146
NP_439905.1_1 Forward -23 -10 9.65572 0.216
NP_440984.1_6 Forward -234 -215 17.3057 0.195
NP_440984.1_7 Forward -29 -15 11.701 0.122
NP_440984.1_7 Reverse -10 -24 8.94771 0.133
NP_439990.1_5 Reverse -10 -23 18.7022 0.0112
NP_442690.1_1 Reverse -91 -110 -14.0619 0.268
NP_442911.1_2 Reverse -5 -24 4.03102 0.0401
NP_442911.1_2 Forward -34 -15 1.57275 0.0576
NP_441580.1_6 Forward -195 -176 -8.85033 0.275
NP_440153.1_5 Reverse -16 -30 3.53951 0.208
NP_442064.1_1 Reverse -10 -29 1.86774 0.146
NP_440993.1_2 Forward -189 -173 2.91013 0.262
NP_440993.1_2 Forward -29 -13 1.43517 0.279
NP_440993.1_3 Forward -34 -15 0.686995 0.247
NP_440993.1_3 Forward -361 -342 -1.27961 0.28
NP_442210.1_9 Reverse -11 -29 8.08229 0.277
NP_441099.1_5 Reverse -5 -24 -11.8003 0.29
NP_442002.1_9 Reverse -174 -181 10.5605 0.214
NP_440809.1_9 Forward -33 -15 -6.96235 0.225
NP_440809.1_9 Reverse -6 -24 -8.14232 0.227
NP_440475.1_1 Reverse -6 -25 15.2531 0.134
NP_441294.1_7 Forward -375 -361 10.5945 0.181
NP_442438.1_10 Forward -29 -15 3.04785 0.166
NP_442431.1_10 Reverse -339 -357 0.904127 0.264
NP_441000.1_6 Forward -25 -11 -3.24533 0.221
NP_440484.1_3 Reverse -13 -27 10.1277 0.242
NP_441674.1_5 Forward -361 -342 -0.983855 0.152
NP_440147.1_4 Forward -26 -13 11.3273 0.0326
NP_440147.1_4 Reverse -13 -26 8.08242 0.0561
NP_441550.1_8 Reverse -13 -23 15.1225 0.0132
NP_441550.1_8 Forward -26 -16 13.0576 0.0273
NP_441916.1_7 Reverse -15 -25 18.9579 0.00144
NP_441916.1_7 Forward -24 -14 10.3048 0.0261
NP_441916.1_10 Reverse -44 -63 0.196116 0.288
NP_441041.1_4 Reverse -66 -85 -11.3086 0.244
NP_441041.1_7 Reverse -12 -24 10.8188 0.0864
NP_441041.1_7 Forward -27 -15 6.34865 0.211
NP_442396.1_5 Forward -131 -118 7.98409 0.169
NP_440569.1_6 Forward -214 -195 2.75272 0.26
NP_442004.1_3 Forward -398 -379 16.5191 0.156
NP_442004.1_6 Reverse -15 -29 5.30946 0.191
NP_441725.1_4 Forward -324 -310 2.06395 0.297
NP_441725.1_5 Reverse -16 -26 11.1898 0.0247
NP_441725.1_5 Forward -23 -13 2.04498 0.115
NP_439966.1_7 Reverse -13 -23 15.3192 0.0152
NP_439966.1_7 Forward -26 -16 14.8275 0.0177
NP_439966.1_7 Forward -321 -311 4.7978 0.258
NP_439966.1_9 Reverse -339 -348 4.42462 0.253
NP_442941.1_3 Reverse -16 -26 19.9412 0.00262
NP_442941.1_3 Forward -23 -13 19.2529 0.00262
NP_440289.1_2 Reverse -12 -25 5.82081 0.0605
NP_440289.1_2 Forward -27 -14 3.85419 0.0735
NP_441514.1_6 Reverse -253 -260 12.7238 0.29
NP_440802.1_3 Reverse -357 -376 8.55425 0.276
NP_442281.1_1 Forward -29 -15 16.3219 0.00832
NP_442281.1_1 Reverse -10 -24 7.76712 0.0927
NP_442256.1_2 Reverse -13 -31 -0.570838 0.14
NP_440437.1_1 Forward -30 -11 5.50599 0.0868
NP_440498.1_1 Forward -33 -15 1.19912 0.208
NP_442982.1_5 Forward -34 -15 2.0644 0.223
NP_441644.1_6 Reverse -15 -25 19.0557 0.000803
NP_441644.1_6 Forward -24 -14 17.3841 0.00127
NP_442215.1_2 Reverse -13 -29 3.59845 0.094
NP_442029.1_5 Reverse -14 -33 17.5736 0.217
NP_440253.1_2 Forward -24 -6 10.3439 0.0401
NP_440929.1_8 Forward -24 -15 19.2726 0.000701
NP_440929.1_8 Reverse -15 -24 19.2726 0.000701
NP_440780.1_1 Reverse -80 -99 7.4002 0.276
NP_442933.1_10 Forward -24 -15 17.601 0.00325
NP_442933.1_10 Reverse -15 -24 17.601 0.00325
NP_441751.2_8 Forward -23 -9 9.93102 0.0307
NP_441751.2_8 Reverse -16 -30 6.29277 0.0368
NP_441751.2_8 Forward -398 -384 -3.63866 0.152
NP_442554.1_8 Reverse -16 -26 16.9913 0.0065
NP_442554.1_8 Forward -23 -13 16.2046 0.0065
NP_441762.1_7 Forward -25 -13 -6.64753 0.284
NP_441762.1_7 Reverse -14 -26 -6.94252 0.284
NP_441762.1_7 Forward -185 -173 -7.33585 0.287
NP_442142.1_4 Forward -27 -14 14.8666 0.0302
NP_442142.1_4 Reverse -12 -25 12.8017 0.0409
NP_442292.1_1 Forward -23 -14 18.486 0.00229
NP_442292.1_1 Reverse -16 -25 17.5026 0.00435
NP_442476.1_6 Forward -23 -9 4.62115 0.142
NP_442476.1_6 Reverse -16 -30 2.35953 0.186
NP_440895.1_6 Reverse -9 -22 10.5407 0.202
NP_443009.1_2 Forward -22 -3 -0.197208 0.216
NP_443009.1_5 Reverse -14 -25 14.5128 0.02
NP_443009.1_5 Forward -25 -14 10.1862 0.0792
NP_442408.2_1 Forward -184 -165 -5.01543 0.267
NP_442408.2_1 Reverse -15 -34 -5.80207 0.277
NP_441715.1_4 Forward -23 -13 17.3846 0.0106
NP_441715.1_4 Reverse -16 -26 14.238 0.0295
NP_440881.1_6 Reverse -351 -370 20.354 0.0882
NP_440183.1_9 Forward -392 -373 -15.8318 0.273
NP_441198.1_8 Forward -26 -16 13.2713 0.108
NP_440379.1_5 Forward -221 -202 -3.93378 0.207
NP_441468.1_1 Forward -23 -16 15.8704 0.0124
NP_441468.1_1 Reverse -16 -23 15.8704 0.0124
NP_441468.1_1 Reverse -391 -398 10.2655 0.0906
NP_439939.1_4 Reverse -184 -203 1.47442 0.199
NP_441673.1_1 Forward -24 -15 20.8459 0.000698
NP_441673.1_1 Reverse -15 -24 20.8459 0.000698
NP_441731.1_7 Forward -183 -164 8.16093 0.199
NP_441826.1_2 Forward -30 -16 4.91614 0.0979
NP_442868.1_6 Reverse -13 -23 19.2529 0.00563
NP_442868.1_6 Forward -26 -16 1.06167 0.205
NP_442719.1_2 Forward -68 -50 -2.73484 0.192
NP_441612.1_2 Forward -24 -14 8.54929 0.21
NP_442227.1_2 Reverse -295 -314 -1.67217 0.264
NP_442427.1_8 Reverse -6 -25 9.53756 0.18
NP_442808.1_1 Forward -25 -15 8.73102 0.0481
NP_442808.1_1 Reverse -14 -24 8.63269 0.0481
NP_442808.1_1 Reverse -80 -90 1.06124 0.296
NP_442542.1_9 Reverse -168 -182 5.89884 0.256
NP_442113.1_10 Reverse -289 -308 -2.95047 0.214
NP_442113.1_10 Reverse -286 -305 -3.24547 0.214
NP_442050.1_5 Forward -26 -16 18.0724 0.00365
NP_442050.1_5 Reverse -13 -23 14.3359 0.0206
NP_442050.1_5 Forward -186 -176 10.9926 0.116
NP_441878.1_6 Forward -25 -15 10.5014 0.0176
NP_441878.1_6 Reverse -14 -24 10.4031 0.0176
NP_441036.1_8 Forward -25 -15 15.713 0.00724
NP_441036.1_8 Reverse -14 -24 8.33817 0.174
NP_441557.1_5 Forward -24 -15 19.9609 0.000699
NP_441557.1_5 Reverse -15 -24 19.9609 0.000699
NP_441557.1_5 Reverse -175 -184 -0.491928 0.193
NP_441445.1_1 Forward -33 -14 4.12936 0.2
NP_441445.1_1 Reverse -6 -25 1.76941 0.247
NP_442066.2_9 Reverse -11 -24 17.9155 0.0209
NP_441308.1_8 Forward -26 -16 13.353 0.218
NP_440101.1_3 Forward -29 -10 3.53937 0.227
NP_441458.1_10 Forward -33 -14 7.86593 0.192
NP_442183.1_1 Reverse -15 -29 10.521 0.0829
NP_441574.1_1 Reverse -317 -336 -3.44213 0.238
NP_441549.1_9 Reverse -11 -29 14.1788 0.0304
NP_442347.1_2 Forward -23 -14 12.4878 0.056
NP_442347.1_2 Reverse -16 -25 3.34298 0.284
NP_442888.1_6 Reverse -55 -74 6.09597 0.228
NP_442888.1_6 Reverse -4 -23 4.42435 0.228
NP_441037.1_4 Forward -26 -16 7.31769 0.237
NP_442594.1_8 Reverse -353 -372 1.86774 0.295
NP_441633.1_3 Reverse -13 -26 3.26421 0.0709
NP_442764.1_6 Forward -182 -164 2.87075 0.242
NP_440136.1_2 Forward -23 -16 15.9687 0.0123
NP_440136.1_2 Reverse -16 -23 15.9687 0.0123
NP_440136.1_2 Reverse -391 -398 4.26735 0.218
NP_441728.2_4 Reverse -93 -112 12.9387 0.263
NP_442998.1_5 Reverse -49 -59 12.7631 0.159
NP_442998.1_10 Forward -22 -15 15.5754 0.0102
NP_442998.1_10 Reverse -17 -24 15.5754 0.0102
NP_442998.1_10 Forward -182 -175 6.0373 0.205
NP_440299.1_1 Forward -28 -15 3.46031 0.243
NP_440299.1_1 Reverse -11 -24 2.28034 0.292
NP_441799.1_1 Forward -28 -14 15.3386 0.0187
NP_441799.1_1 Reverse -11 -25 14.5519 0.0228
NP_441799.1_1 Forward -188 -174 5.21053 0.218
NP_441007.1_10 Forward -29 -16 10.934 0.0646
NP_441007.1_10 Reverse -10 -23 2.87088 0.183
NP_442201.1_10 Reverse -164 -183 -5.60541 0.167
NP_442333.2_5 Forward -195 -176 -7.08038 0.227
NP_440256.1_1 Reverse -12 -31 9.24257 0.021
NP_440256.1_1 Forward -27 -8 -1.57384 0.105
NP_440256.1_1 Reverse -172 -191 -6.49039 0.213
NP_441559.1_8 Reverse -10 -24 -5.80194 0.27
NP_440915.1_6 Reverse -11 -25 10.7177 0.0301
NP_441296.1_7 Reverse -224 -243 13.9625 0.267
NP_442785.1_7 Forward -26 -12 10.816 0.228
NP_442785.1_7 Forward -186 -172 10.7177 0.228
NP_441838.1_10 Forward -307 -288 12.3892 0.259
NP_440695.1_5 Reverse -15 -34 0.0977854 0.284
NP_441494.1_6 Forward -29 -16 5.82081 0.292
NP_442993.1_1 Forward -24 -8 -9.47957 0.186
NP_442993.1_1 Reverse -15 -31 -11.1512 0.235
NP_442993.1_1 Reverse -66 -82 -12.0362 0.265
NP_440677.1_6 Reverse -381 -400 9.14423 0.27
NP_442386.1_9 Reverse -14 -23 13.8639 0.0289
NP_442386.1_9 Forward -400 -391 8.35743 0.201
NP_442386.1_9 Forward -25 -16 6.39082 0.219
NP_442386.1_9 Reverse -389 -398 4.7192 0.289
NP_441340.1_5 Forward -23 -16 15.6737 0.0124
NP_441340.1_5 Reverse -16 -23 15.6737 0.0124
NP_441340.1_5 Reverse -176 -183 4.07068 0.239
NP_442484.1_2 Reverse -4 -23 0.491109 0.247
NP_440768.1_1 Reverse -164 -178 7.66941 0.279
NP_442240.1_2 Reverse -16 -35 -13.3736 0.167
NP_440161.1_3 Reverse -13 -32 7.7676 0.287
NP_440586.1_8 Forward -23 -16 13.2151 0.026
NP_440586.1_8 Reverse -16 -23 13.2151 0.026
NP_440586.1_8 Reverse -141 -148 5.93863 0.283
NP_442251.1_6 Forward -23 -16 15.2804 0.0124
NP_442251.1_6 Reverse -16 -23 15.2804 0.0124
NP_441262.1_3 Reverse -15 -22 14.7888 0.0223
NP_441262.1_3 Forward -24 -17 14.7888 0.0223
NP_441262.1_3 Reverse -175 -182 5.34899 0.181
NP_443051.1_1 Forward -25 -16 19.5676 0.00335
NP_443051.1_1 Reverse -14 -23 10.4228 0.00754
NP_439937.1_9 Forward -25 -8 -14.6131 0.287
NP_440439.1_1 Forward -27 -14 9.06573 0.0475
NP_440439.1_1 Reverse -12 -25 1.69091 0.147
NP_440439.1_1 Reverse -172 -185 0.117615 0.202
NP_440372.1_2 Forward -23 -16 16.3621 0.0124
NP_440372.1_2 Reverse -16 -23 16.3621 0.0124
NP_440372.1_2 Reverse -176 -183 4.36568 0.205
NP_441803.1_2 Forward -29 -10 5.01433 0.171
NP_439977.1_5 Reverse -9 -28 4.81767 0.15
NP_441572.1_7 Forward -30 -11 -4.32711 0.232
NP_441572.1_7 Forward -241 -222 -5.60541 0.265
NP_440267.1_2 Forward -29 -15 8.65209 0.162
NP_442384.1_10 Reverse -15 -28 13.589 0.0195
NP_442384.1_10 Forward -24 -11 11.6223 0.0341
NP_441018.1_7 Reverse -11 -30 7.07928 0.277
NP_442790.1_4 Reverse -6 -25 -10.7186 0.217
NP_442262.1_10 Forward -23 -16 14.1988 0.0123
NP_442262.1_10 Reverse -16 -23 14.1988 0.0123
NP_441689.1_5 Forward -26 -16 17.8758 0.0158
NP_441689.1_5 Forward -186 -176 8.3377 0.132
NP_441689.1_5 Reverse -13 -23 5.78111 0.197
NP_440344.1_10 Reverse -8 -25 -6.25434 0.113
NP_440282.1_10 Forward -34 -15 -7.86702 0.254
NP_440531.1_6 Forward -32 -13 -0.688862 0.218
NP_441965.1_10 Reverse -12 -28 14.0215 0.0935
NP_441965.1_10 Forward -27 -11 3.10679 0.274
NP_442556.1_1 Forward -239 -220 18.0924 0.0604
NP_440297.1_9 Reverse -16 -26 9.22315 0.0917
NP_440297.1_9 Forward -23 -13 -0.118297 0.282
NP_441896.1_3 Reverse -6 -25 1.27776 0.218
NP_440650.1_6 Forward -359 -340 12.1925 0.19
NP_440999.1_9 Reverse -11 -25 5.50613 0.111
NP_440999.1_9 Forward -28 -14 0.392915 0.187
NP_440999.1_9 Forward -85 -71 -0.787057 0.217
NP_440999.1_9 Reverse -292 -306 -2.55701 0.27
NP_440999.1_9 Reverse -71 -85 -2.95034 0.281
NP_440888.1_2 Forward -24 -10 14.7486 0.0152
NP_440888.1_2 Reverse -15 -29 12.9786 0.0354
NP_441543.1_2 Forward -23 -14 16.9127 0.00359
NP_441543.1_2 Reverse -16 -25 15.9293 0.00518
NP_441543.1_2 Forward -74 -65 7.57121 0.113
NP_442845.1_2 Forward -30 -16 7.37441 0.195
NP_442845.1_2 Reverse -9 -23 4.62115 0.256
NP_442845.1_2 Reverse -384 -398 4.32615 0.261
NP_441304.1_10 Forward -199 -190 13.1761 0.255
NP_441551.1_5 Reverse -11 -27 8.41597 0.238
NP_441178.1_10 Forward -377 -358 18.1898 0.25
NP_440982.1_1 Forward -399 -380 6.09517 0.294
NP_441469.1_8 Forward -25 -16 6.5879 0.227
NP_441469.1_8 Reverse -14 -23 6.48957 0.227
NP_441469.1_8 Forward -400 -391 5.40793 0.272
NP_443064.1_6 Forward -24 -14 12.5669 0.0796
NP_443064.1_6 Reverse -15 -25 10.8217 0.13
NP_442578.1_7 Forward -23 -16 14.5921 0.026
NP_442578.1_7 Reverse -16 -23 14.5921 0.026
NP_442578.1_7 Forward -167 -160 6.72562 0.18
NP_440220.1_4 Reverse -122 -141 -3.14789 0.285
NP_441462.1_2 Reverse -15 -25 20.2362 0.000805
NP_441462.1_2 Forward -24 -14 11.5831 0.00406
NP_441462.1_2 Reverse -175 -185 8.4365 0.0363
NP_441621.1_7 Reverse -13 -27 -5.31028 0.25
NP_443062.1_1 Reverse -15 -33 15.3714 0.0385
NP_443062.1_1 Forward -24 -6 4.45062 0.26
NP_443062.1_6 Reverse -7 -26 10.4225 0.113
NP_441410.1_3 Forward -33 -14 8.35759 0.21
NP_442204.1_1 Forward -28 -17 9.40011 0.0786
NP_442204.1_1 Forward -239 -228 5.27021 0.213
NP_442204.1_1 Forward -323 -312 -0.236322 0.289
NP_442204.1_2 Reverse -5 -24 7.7676 0.269
NP_440255.1_3 Reverse -5 -15 14.918 0.298
NP_440516.1_8 Forward -24 -15 16.9127 0.00442
NP_440516.1_8 Reverse -15 -24 16.9127 0.00442
NP_440516.1_8 Reverse -175 -184 -0.000272808 0.156
NP_442428.1_5 Forward -23 -16 15.8704 0.0124
NP_442428.1_5 Reverse -16 -23 15.8704 0.0124
NP_442428.1_5 Reverse -391 -398 4.66067 0.244
NP_440673.1_3 Forward -22 -15 12.4288 0.0426
NP_440673.1_3 Reverse -17 -24 12.4288 0.0426
NP_441052.1_2 Forward -24 -14 19.9412 0.00106
NP_441052.1_2 Reverse -15 -25 10.4031 0.0285
NP_442219.1_9 Forward -23 -14 17.7976 0.00718
NP_442219.1_9 Reverse -16 -25 8.25953 0.0681
NP_440436.1_4 Forward -23 -14 17.2072 0.00233
NP_440436.1_4 Reverse -16 -25 9.24241 0.0871
NP_440314.1_9 Forward -23 -4 -10.1286 0.286
NP_441719.1_4 Forward -23 -16 16.3621 0.0124
NP_441719.1_4 Reverse -16 -23 16.3621 0.0124
NP_441733.1_10 Reverse -338 -351 4.73917 0.244
NP_442366.1_3 Reverse -14 -32 -4.40575 0.271
NP_442366.1_5 Reverse -366 -376 10.5993 0.251
NP_442873.1_5 Reverse -164 -183 10.815 0.246
NP_441115.1_4 Forward -25 -7 13.9813 0.0645
NP_442206.1_10 Reverse -15 -30 6.27308 0.178
NP_443054.1_2 Forward -26 -12 3.14618 0.24
NP_442586.1_5 Reverse -311 -330 18.0924 0.148
NP_441851.1_7 Reverse -291 -310 7.37428 0.286
NP_441851.1_10 Reverse -14 -24 15.8113 0.00552
NP_441851.1_10 Forward -25 -15 8.53483 0.114
NP_441851.1_10 Reverse -320 -330 6.8632 0.153
NP_441851.1_10 Reverse -174 -184 4.99491 0.233
NP_442011.1_1 Reverse -14 -33 -2.45882 0.273
NP_441668.1_4 Forward -34 -15 2.85105 0.189
NP_442515.1_1 Reverse -14 -28 4.03116 0.109
NP_442515.1_1 Forward -25 -11 2.35953 0.137
NP_440463.1_8 Reverse -220 -239 6.33814 0.27
NP_441349.1_10 Forward -34 -15 6.19431 0.0378
NP_441349.1_10 Reverse -5 -24 -7.76869 0.258
NP_441409.1_6 Reverse -9 -28 2.26107 0.0584
NP_441409.1_6 Forward -30 -11 2.0644 0.0584
NP_441107.1_1 Reverse -335 -354 18.1907 0.174
NP_439960.1_8 Forward -305 -286 11.7992 0.264
NP_439960.1_10 Reverse -165 -183 -4.50408 0.293
NP_442758.1_7 Reverse -224 -243 14.5524 0.295
NP_440431.1_3 Forward -25 -6 12.9791 0.0412
NP_442450.1_5 Forward -26 -16 9.41981 0.115
NP_440588.1_2 Forward -33 -14 -1.18052 0.155
NP_442006.1_2 Reverse -166 -183 -15.4975 0.227
NP_442006.1_2 Forward -212 -195 -18.8407 0.296
NP_441570.1_1 Reverse -15 -33 0.412472 0.0394
NP_441078.1_4 Forward -24 -15 19.6659 0.0007
NP_441078.1_4 Reverse -15 -24 19.6659 0.0007
NP_442348.1_2 Reverse -354 -363 7.57121 0.28
NP_440526.1_3 Forward -23 -12 10.2846 0.0646
NP_441432.1_8 Reverse -14 -23 16.8143 0.00595
NP_441432.1_8 Forward -25 -16 16.8143 0.00595
NP_441432.1_8 Reverse -65 -74 2.94966 0.28
NP_442320.1_8 Reverse -9 -23 -2.36035 0.0871
NP_442320.1_8 Forward -190 -176 -6.09693 0.265
NP_441732.1_2 Forward -28 -12 1.63183 0.0341
NP_442003.1_4 Forward -183 -164 11.4058 0.277
NP_440760.1_1 Reverse -15 -34 -21.535 0.238
NP_440760.1_1 Forward -24 -5 -21.83 0.245
NP_440199.1_10 Reverse -12 -22 7.25653 0.231
NP_441057.1_3 Reverse -214 -233 -13.1769 0.269
NP_440913.1_1 Reverse -13 -31 8.37728 0.185
NP_442489.1_7 Forward -24 -15 20.1576 0.000695
NP_442489.1_7 Reverse -15 -24 20.1576 0.000695
NP_440565.1_2 Forward -181 -167 15.4196 0.292
NP_442079.1_6 Forward -32 -13 16.7157 0.244
NP_440559.1_1 Forward -23 -14 17.4043 0.00658
NP_440559.1_1 Reverse -16 -25 8.65285 0.0586
NP_441659.2_8 Reverse -15 -25 20.9245 0.000805
NP_441659.2_8 Forward -24 -14 18.1713 0.00133
NP_441022.1_1 Forward -102 -93 11.1625 0.284
NP_442913.1_10 Forward -33 -14 4.62101 0.0853
NP_442346.1_5 Reverse -14 -24 16.6963 0.00248
NP_442346.1_5 Forward -25 -15 16.303 0.00248
NP_442346.1_5 Reverse -65 -75 6.8632 0.188
NP_440545.1_3 Reverse -11 -28 -4.09106 0.218
NP_441856.1_3 Reverse -12 -31 7.86593 0.101
NP_440831.1_3 Forward -238 -219 6.19299 0.275
NP_441629.1_3 Forward -191 -172 -3.93454 0.29
NP_442857.1_5 Reverse -255 -274 9.83255 0.291
NP_440459.1_2 Forward -244 -227 10.6586 0.193
NP_442603.1_7 Forward -24 -10 8.84875 0.162
NP_442603.1_7 Reverse -15 -29 8.65209 0.168
NP_441948.1_4 Forward -31 -13 -5.29072 0.26
NP_441833.1_4 Forward -23 -16 15.9687 0.0124
NP_441833.1_4 Reverse -16 -23 15.9687 0.0124
NP_442162.1_9 Forward -23 -16 16.2637 0.0124
NP_442162.1_9 Reverse -16 -23 16.2637 0.0124
NP_442162.1_9 Reverse -176 -183 3.4807 0.246
NP_442162.1_9 Forward -183 -176 3.38237 0.276
NP_440671.1_4 Forward -30 -16 8.35772 0.201
NP_442199.1_5 Forward -192 -173 -6.29373 0.272
NP_442140.1_3 Forward -23 -13 10.3048 0.0902
NP_442140.1_3 Forward -183 -173 4.60159 0.242
NP_440875.1_9 Forward -147 -137 8.76138 0.233
NP_440875.1_9 Reverse -17 -27 8.27469 0.233
NP_440875.1_9 Forward -22 -12 7.69067 0.255
NP_441813.1_5 Reverse -13 -23 18.1713 0.00743
NP_441813.1_5 Forward -26 -16 15.9097 0.01
NP_441813.1_5 Forward -186 -176 2.43831 0.187
NP_440590.1_4 Forward -23 -10 13.294 0.013
NP_440567.1_1 Reverse -16 -30 5.30946 0.104
NP_440567.1_1 Forward -23 -9 -0.000409212 0.261
NP_442497.1_10 Reverse -16 -25 17.601 0.00813
NP_442497.1_10 Forward -23 -14 10.4228 0.0087
NP_440821.1_4 Forward -26 -16 11.0914 0.0146
NP_440821.1_4 Reverse -13 -23 9.41981 0.0286
NP_441239.1_9 Forward -26 -14 12.1337 0.0494
NP_441239.1_9 Reverse -13 -25 5.25052 0.223
NP_441239.1_9 Reverse -388 -400 4.26721 0.256
NP_441727.1_3 Reverse -8 -27 5.01433 0.257
NP_441892.1_1 Forward -387 -370 -3.30441 0.237
NP_441892.1_1 Forward -33 -16 -3.99273 0.253
NP_441892.1_1 Reverse -166 -183 -4.68105 0.266
NP_440604.1_6 Reverse -15 -34 -0.983855 0.192
NP_442044.1_1 Forward -127 -108 -6.58872 0.208
NP_440740.1_2 Reverse -351 -370 12.2908 0.222
NP_440546.1_4 Reverse -15 -25 13.5365 0.0459
NP_440546.1_4 Forward -24 -14 10.046 0.109
NP_440546.1_4 Reverse -175 -185 6.74945 0.282
NP_440675.1_1 Reverse -368 -387 3.14605 0.254
NP_440462.1_4 Reverse -383 -397 9.43936 0.243
NP_440462.1_6 Forward -26 -16 16.893 0.00853
NP_440462.1_6 Reverse -13 -23 9.61647 0.0429
NP_440462.1_6 Reverse -388 -398 6.27322 0.121
NP_440462.1_6 Forward -186 -176 3.71661 0.23
NP_440462.1_6 Forward -384 -374 2.14332 0.294
NP_440868.1_4 Forward -28 -16 15.1819 0.0164
NP_440868.1_4 Reverse -11 -23 10.0687 0.0405
NP_440868.1_4 Reverse -171 -183 6.03717 0.0879
NP_442402.1_4 Forward -32 -13 -3.14789 0.212
NP_442258.1_8 Reverse -334 -353 15.2408 0.0737
NP_441084.1_6 Forward -26 -12 11.0893 0.218
NP_439942.1_7 Reverse -342 -361 -5.99873 0.294
NP_442039.1_4 Forward -23 -16 15.1821 0.0124
NP_442039.1_4 Reverse -16 -23 15.1821 0.0124
NP_442039.1_7 Forward -147 -137 8.04317 0.267
NP_442625.1_2 Reverse -369 -388 28.0238 0.000574
NP_442625.1_3 Reverse -229 -248 17.7974 0.133
NP_442625.1_4 Reverse -342 -361 12.2908 0.0674
NP_442625.1_9 Reverse -288 -307 28.0229 0.000832
NP_442625.1_10 Reverse -264 -283 19.9606 0.0306
NP_440825.1_6 Reverse -354 -373 8.84924 0.285
NP_440825.1_6 Reverse -355 -374 6.98095 0.291
NP_441053.1_7 Forward -283 -264 16.8141 0.11
NP_442837.1_3 Forward -23 -16 15.7721 0.0124
NP_442837.1_3 Reverse -16 -23 15.7721 0.0124
NP_440160.1_9 Reverse -310 -329 8.45592 0.264
NP_442053.1_1 Forward -24 -15 18.3876 0.0007
NP_442053.1_1 Reverse -15 -24 18.3876 0.0007
NP_442053.1_1 Forward -184 -175 3.83464 0.285
NP_440505.1_3 Reverse -13 -23 18.3679 0.00213
NP_440505.1_3 Forward -26 -16 15.123 0.014
NP_440505.1_3 Forward -129 -119 4.60159 0.277
NP_441203.1_1 Reverse -16 -35 -5.80207 0.107
NP_440914.1_1 Forward -24 -14 17.5935 0.000537
NP_440914.1_1 Reverse -15 -25 16.3248 0.00196
NP_440914.1_1 Reverse -390 -400 7.44401 0.237
NP_441011.1_8 Reverse -16 -25 16.6177 0.00602
NP_441011.1_8 Reverse -176 -185 10.8161 0.094
NP_441011.1_8 Reverse -67 -76 9.14451 0.135
NP_441011.1_8 Forward -23 -14 8.25953 0.144
NP_442533.1_6 Forward -24 -15 17.2076 0.00137
NP_442533.1_6 Reverse -15 -24 17.2076 0.00137
NP_442232.1_3 Forward -32 -13 -14.9469 0.288
NP_441482.1_7 Forward -30 -16 7.86607 0.0233
NP_439944.1_9 Reverse -16 -26 17.6796 0.00347
NP_439944.1_9 Forward -23 -13 10.5014 0.0887
NP_442664.1_3 Forward -97 -83 16.5192 0.223
NP_440116.1_8 Forward -23 -4 -4.72043 0.178
NP_441527.1_5 Forward -26 -7 18.1335 0.169
NP_440115.1_6 Forward -27 -17 7.45319 0.147
NP_440115.1_6 Reverse -12 -22 6.8632 0.167
NP_440115.1_6 Forward -381 -371 5.68323 0.227
NP_440007.1_9 Forward -28 -14 8.75105 0.171
NP_440007.1_9 Reverse -11 -25 5.89945 0.242
NP_439965.1_1 Forward -33 -14 0.392778 0.146
NP_441602.1_4 Reverse -55 -74 10.4225 0.278
NP_441106.1_1 Forward -25 -16 18.486 0.0028
NP_441106.1_1 Reverse -14 -23 9.63616 0.0311
NP_439903.1_6 Reverse -12 -31 2.16195 0.231
NP_441286.1_1 Reverse -14 -26 14.3953 0.00424
NP_441286.1_1 Forward -25 -13 3.48056 0.0467
NP_440670.1_8 Forward -24 -15 18.3876 0.000699
NP_440670.1_8 Reverse -15 -24 18.3876 0.000699
NP_440886.1_7 Reverse -295 -305 10.6976 0.0805
NP_440886.1_7 Forward -25 -15 8.04271 0.0805
NP_440886.1_7 Reverse -14 -24 7.94438 0.0805
NP_442614.1_2 Forward -24 -10 15.0442 0.0835
NP_442614.1_2 Reverse -15 -29 10.226 0.234
NP_442072.1_9 Reverse -14 -32 -22.4003 0.234
NP_440907.2_8 Reverse -16 -26 9.51767 0.103
NP_440326.1_5 Reverse -13 -26 16.1456 0.179
NP_440841.1_4 Forward -26 -7 -6.78538 0.215
NP_440176.1_3 Reverse -197 -211 14.0603 0.243
NP_441463.1_3 Reverse -331 -350 -8.16202 0.266
NP_441626.1_2 Forward -23 -16 15.7721 0.0124
NP_441626.1_2 Reverse -16 -23 15.7721 0.0124
NP_441460.1_2 Forward -56 -43 14.5717 0.234
NP_441401.1_5 Forward -33 -14 13.2252 0.297
NP_442615.1_1 Forward -33 -15 16.5388 0.00809
NP_442615.1_1 Reverse -6 -24 3.26407 0.0561
NP_440387.1_1 Reverse -15 -31 3.20513 0.0632
NP_442647.1_7 Forward -343 -330 12.409 0.214
NP_441836.1_2 Reverse -9 -28 -3.93378 0.247
NP_440114.1_10 Reverse -15 -29 9.73436 0.164
NP_440114.1_10 Forward -24 -10 7.9644 0.219
NP_442698.1_10 Forward -88 -69 1.27776 0.297
NP_441510.2_7 Reverse -169 -183 9.6354 0.281
NP_440287.1_6 Reverse -6 -25 7.37428 0.154
NP_439998.1_4 Reverse -10 -29 18.7069 0.176
NP_439910.1_2 Reverse -7 -24 -12.8425 0.103
NP_439910.1_2 Forward -192 -175 -22.6756 0.285
NP_442867.1_8 Forward -183 -164 15.5357 0.154
NP_440457.1_1 Forward -28 -16 1.31728 0.241
NP_440457.1_1 Reverse -11 -23 -0.74767 0.273
NP_440798.1_6 Forward -183 -170 13.294 0.0445
NP_440798.1_6 Reverse -16 -29 1.9859 0.188
NP_442297.1_4 Reverse -317 -336 15.8366 0.145
NP_441332.1_6 Reverse -167 -177 12.1308 0.236
NP_442130.1_8 Forward -345 -326 6.98015 0.235
NP_440473.1_9 Forward -215 -196 -11.8986 0.295
NP_442509.1_9 Forward -24 -14 8.14104 0.192
NP_442509.1_9 Reverse -15 -25 8.04271 0.192
NP_442509.1_9 Forward -229 -219 6.17443 0.286
NP_440554.1_4 Reverse -16 -26 16.1063 0.0189
NP_440554.1_4 Forward -23 -13 8.92815 0.0646
NP_441885.1_5 Forward -24 -14 20.9245 0.000538
NP_441885.1_5 Reverse -15 -25 11.3864 0.00668
NP_441885.1_5 Reverse -175 -185 -1.59326 0.273
NP_442341.1_7 Reverse -14 -28 4.81781 0.177
NP_442341.1_9 Reverse -13 -27 10.1271 0.137
NP_442341.1_9 Forward -26 -12 8.06211 0.179
NP_440409.1_2 Forward -239 -220 8.94757 0.242
NP_443000.1_3 Reverse -36 -55 11.1347 0.255
NP_443000.1_7 Reverse -13 -23 19.9412 0.00223
NP_443000.1_7 Forward -26 -16 17.4829 0.00719
NP_443000.1_7 Forward -186 -176 4.40493 0.199
NP_441842.1_10 Reverse -168 -182 6.19444 0.297
NP_440275.1_3 Reverse -13 -23 15.123 0.0182
NP_440275.1_3 Forward -26 -16 9.12481 0.055
NP_440091.1_1 Reverse -11 -23 1.31728 0.198
NP_443010.1_10 Forward -27 -10 9.43852 0.138
NP_439962.1_4 Forward -358 -339 -1.67217 0.216
NP_439962.1_4 Reverse -377 -396 -6.88371 0.285
NP_441105.1_3 Reverse -4 -23 7.96426 0.0512
NP_441105.1_3 Forward -35 -16 -5.60541 0.222
NP_440216.1_1 Reverse -15 -29 7.27608 0.00942
NP_440216.1_1 Forward -24 -10 0.196253 0.0284
NP_440216.1_1 Forward -184 -170 -5.01529 0.118
NP_440172.1_1 Reverse -15 -25 17.5813 0.00421
NP_440172.1_1 Forward -24 -14 15.0247 0.00945
NP_442015.1_10 Reverse -11 -24 2.77255 0.187
NP_442015.1_10 Forward -28 -15 1.39592 0.204
NP_441226.1_7 Forward -23 -16 14.4934 0.0123
NP_441226.1_7 Reverse -16 -23 14.4934 0.0123
NP_441226.1_7 Forward -398 -391 11.2485 0.0971
NP_441226.1_7 Reverse -176 -183 9.77352 0.131
NP_441757.1_3 Reverse -14 -33 0.392778 0.19
NP_441111.1_7 Forward -23 -15 18.7023 0.00294
NP_441111.1_7 Reverse -16 -24 18.7023 0.00294
NP_441111.1_7 Forward -183 -175 -0.668896 0.274
NP_441766.1_2 Forward -24 -15 17.5026 0.00297
NP_441766.1_2 Reverse -15 -24 17.5026 0.00297
NP_442417.1_5 Reverse -15 -29 7.27608 0.194
NP_440416.1_9 Forward -31 -12 -13.6686 0.169
NP_440416.1_9 Reverse -219 -238 -20.65 0.287
NP_443052.1_8 Forward -85 -66 -1.86883 0.0843
NP_443052.1_8 Forward -388 -369 -11.5053 0.231
NP_440261.1_5 Reverse -16 -29 8.27909 0.0273
NP_440261.1_5 Forward -23 -10 4.93583 0.0478
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

TTGCCATCCCGTGGCTCCAGGGAACGATCCACAATCAAAATATCCCCGGCATGAATCCCGGCTCCAATCATTGAATCCCCAGTCACTCGCACAAAGAAGGTGGCGGCAGGATGTTTGATCAGATATTGATTGAGGTCTAACTTGCCCTCTAAATAGTCCTCCGCCGGAGAGGGAAAACCGGCTGATACCGGACAGGCGTAAAGGGGCAACTCATAAACCGTTCGCCGACTGGGGCGGTAAATTTCTGGTAGCACGTTGGCAGGCATAATTTATGGGGAGAGCTTCACTATCAACTGTACTAAAACTTTTCTGGGTTGGACGTAACAGCCATAACCTATTGAGGATTTTCCCTTCCCGCCAAACTGAAGTTACTCAAGGCGATCGCCAGTAAAATTTGGGT

CDS

ATGTTTGACAATCTCTGCAAATTCCTTGCCGAATCATTTTCCGAAGACTATGCCGCCTGGTTGTTAGGGCGACCAATCAAATTGACCAAGCTCAGTCCAACGGAATTATCCTTGGAGCCAATTCGGGCTGACTCCCTGATTTTGGAGCAATCGGAAGACTTAGTGTTGCATCTGGAATTCCAAACCGAACCTGACCCCACCATGGGTTTTCGCATGTTGGACTATCGGGTAAGGGTTTATCGCCGTTTCCCCCAGAAGACGATGCATCAATTTGTCATCTACTTAAAGCGTAGTAGTAATGACTTGGTTTATCAGGATAGTTTTCAAGTGGGAGAGACTTTGCACCGTTACCAAGCGATTCGGCTTTGGGAGCAACCATCGGAAGCGTTTCTCCAAAGCCCAGGGCTATTGCCCCTAGCGGTATTGACGCAGACCTCTGACCCTACATTAAAATTGAGGGAAGTGGCGACTGCATTGGAACAGATTGAGGATAATCGAGTTAAAGCAAATCTCATGGCAGCGACCTCAGTTTTTGGAGGAATTTTGCTGGCCCCTGAGCTGATCAAGACAATTTTAAGGAGTGAAATTATGAAGGAATCCGCTGTCTATCAAGAAATTTTAGAGGAGGGTAAAATTGCCGGCAAACTGGAGGGTCGGTTGGAAGGAAAATTAGAGGGCAAATTGGAGGGCAAACTAGAAGGTAGGCTGGAGGCGAAACTAGAAACTATACCTCTGCTCAAGAAATTAGGCCTGACAATCACCGAAATTGCCAAGGAATTAGATATTGATGTTGAACTCGTTAATCGGTTTGTCGCTAACCAGAACAATTAA

Protein

No sequence available