Your browser is old and dusty. Try Google Chrome!

Details for slr5111

ORF slr5111
Accession NP_942267.1
Symbol
Category
Definition
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_441061.1_2 Reverse -293 -307 2.2612 0.178
NP_441061.1_2 Forward -300 -286 0.786239 0.199
NP_440795.1_7 Forward -300 -293 14.6904 0.0123
NP_440795.1_7 Reverse -293 -300 14.6904 0.0123
NP_440795.1_7 Reverse -332 -339 7.51227 0.24
NP_441418.1_6 Forward -301 -282 -18.5851 0.0832
NP_440815.1_5 Forward -301 -282 20.649 0.0856
NP_442291.1_5 Forward -302 -286 -0.826444 0.189
NP_440897.1_6 Reverse -231 -250 0.195343 0.18
NP_441453.1_1 Forward -308 -290 2.37835 0.294
NP_441453.1_4 Reverse -292 -300 16.539 0.00633
NP_441453.1_4 Forward -301 -293 16.539 0.00633
NP_442151.1_6 Reverse -292 -306 7.17775 0.206
NP_441818.1_1 Forward -300 -289 10.1862 0.232
NP_441818.1_9 Forward -324 -305 -5.99873 0.258
NP_440226.1_1 Forward -301 -282 13.0775 0.0391
NP_440150.1_6 Forward -369 -350 5.11266 0.231
NP_440996.1_3 Reverse -381 -399 8.96727 0.287
NP_442173.1_1 Forward -300 -292 15.4574 0.00633
NP_442173.1_1 Reverse -293 -301 15.4574 0.00633
NP_442173.1_1 Reverse -383 -391 4.73931 0.258
NP_442752.1_4 Forward -301 -294 13.8055 0.0199
NP_442752.1_4 Reverse -292 -299 13.8055 0.0199
NP_442752.1_4 Forward -312 -305 7.90559 0.144
NP_442752.1_4 Forward -306 -299 4.95566 0.26
NP_443027.1_4 Forward -303 -293 15.3197 0.0437
NP_443027.1_4 Reverse -329 -339 7.45319 0.24
NP_441812.1_3 Reverse -291 -305 6.78443 0.291
NP_442975.1_10 Forward -305 -291 10.9137 0.0516
NP_442975.1_10 Forward -344 -330 6.19383 0.188
NP_442975.1_10 Reverse -288 -302 2.45727 0.274
NP_441225.1_1 Reverse -294 -313 -4.52377 0.197
NP_440784.1_7 Forward -300 -293 15.9687 0.0123
NP_440784.1_7 Reverse -293 -300 15.9687 0.0123
NP_440061.1_9 Reverse -290 -304 10.0287 0.131
NP_440110.1_4 Forward -312 -293 5.11266 0.173
NP_441476.1_5 Reverse -326 -345 -7.4737 0.29
NP_442062.1_8 Forward -301 -291 17.3846 0.00193
NP_442062.1_8 Reverse -292 -302 10.3048 0.0493
NP_441859.1_3 Forward -344 -325 3.44025 0.241
NP_440304.1_4 Forward -303 -293 18.9579 0.00406
NP_440304.1_4 Reverse -356 -366 2.24165 0.299
NP_440304.1_4 Reverse -290 -300 1.84832 0.299
NP_442242.1_4 Forward -300 -293 14.3954 0.0124
NP_442242.1_4 Reverse -293 -300 14.3954 0.0124
NP_440044.1_8 Forward -300 -281 2.45773 0.15
NP_440044.1_8 Reverse -293 -312 -3.3438 0.282
NP_441781.1_7 Forward -301 -282 11.5042 0.138
NP_441619.1_8 Reverse -286 -300 13.372 0.115
NP_441619.1_8 Forward -307 -293 13.1753 0.115
NP_440307.1_1 Reverse -217 -236 19.928 0.191
NP_441208.1_9 Reverse -289 -303 15.4376 0.0854
NP_441594.1_6 Forward -400 -381 6.78429 0.186
NP_442110.1_7 Reverse -292 -306 1.27789 0.233
NP_441925.1_4 Reverse -293 -312 -13.4726 0.257
NP_441925.1_4 Reverse -350 -369 -16.9142 0.287
NP_440273.1_1 Forward -100 -81 13.8937 0.243
NP_441083.1_3 Reverse -381 -391 12.8609 0.242
NP_441083.1_5 Forward -301 -291 20.3345 0.00053
NP_441083.1_5 Reverse -292 -302 11.2881 0.0159
NP_441149.1_9 Reverse -213 -232 -0.197979 0.27
NP_441738.1_2 Forward -299 -292 15.28 0.0102
NP_441738.1_2 Reverse -294 -301 15.28 0.0102
NP_441558.1_5 Forward -303 -284 13.4708 0.0578
NP_441558.1_5 Reverse -290 -309 4.52268 0.28
NP_440209.1_1 Reverse -292 -300 18.1123 0.00295
NP_440209.1_1 Forward -301 -293 18.1123 0.00295
NP_442889.1_8 Forward -304 -290 17.6002 0.0162
NP_441713.1_1 Forward -307 -288 -8.85033 0.159
NP_441713.1_1 Forward -372 -353 -9.93197 0.188
NP_440178.1_7 Reverse -291 -310 -11.2103 0.088
NP_440178.1_7 Forward -302 -283 -22.0267 0.249
NP_441025.1_6 Forward -76 -57 15.6058 0.0963
NP_441716.1_1 Forward -340 -326 15.0442 0.0554
NP_441716.1_1 Reverse -315 -329 4.03116 0.259
NP_441716.1_1 Forward -301 -287 3.93283 0.259
NP_442111.1_4 Reverse -291 -305 19.4691 0.00416
NP_442111.1_4 Forward -205 -191 2.16287 0.286
NP_440343.1_3 Reverse -300 -318 2.67334 0.291
NP_440906.1_5 Forward -300 -293 15.8704 0.0124
NP_440906.1_5 Reverse -293 -300 15.8704 0.0124
NP_440438.2_8 Reverse -60 -79 7.96426 0.139
NP_440747.1_10 Reverse -289 -301 14.9853 0.00221
NP_440747.1_10 Forward -304 -292 -2.02597 0.0196
NP_440747.1_10 Reverse -328 -340 -11.9574 0.178
NP_441486.1_1 Reverse -289 -303 6.19444 0.0344
NP_441486.1_1 Forward -304 -290 -2.45868 0.175
NP_441486.1_1 Reverse -379 -393 -6.39192 0.294
NP_441194.1_1 Forward -80 -61 12.9387 0.238
NP_442145.1_4 Forward -79 -60 4.34446 0.282
NP_442330.1_4 Forward -321 -302 17.1907 0.233
NP_442634.1_4 Reverse -290 -304 -3.24533 0.161
NP_442634.1_4 Forward -303 -289 -3.54032 0.161
NP_441265.1_6 Reverse -342 -361 14.0599 0.224
NP_440842.1_4 Reverse -60 -79 2.58085 0.223
NP_440842.1_10 Forward -304 -290 0.982901 0.296
NP_441695.1_4 Reverse -299 -317 16.4404 0.145
NP_442848.1_1 Reverse -286 -300 5.21113 0.0859
NP_442848.1_1 Reverse -150 -164 4.52282 0.1
NP_442848.1_1 Forward -307 -293 -4.52363 0.294
NP_443018.1_3 Forward -300 -293 14.8871 0.0123
NP_443018.1_3 Reverse -293 -300 14.8871 0.0123
NP_443018.1_3 Forward -333 -326 7.11894 0.16
NP_441634.1_8 Reverse -329 -343 1.76955 0.181
NP_441634.1_8 Reverse -290 -304 -3.147 0.295
NP_440376.1_1 Forward -301 -292 19.4693 0.000692
NP_440376.1_1 Reverse -292 -301 19.4693 0.000692
NP_440376.1_1 Reverse -331 -340 3.93297 0.188
NP_440376.1_1 Reverse -357 -366 0.196389 0.283
NP_441588.1_4 Forward -299 -289 18.1713 0.0143
NP_442687.1_7 Forward -302 -292 9.02648 0.0994
NP_442687.1_7 Reverse -291 -301 8.92815 0.0994
NP_442687.1_7 Forward -241 -231 3.61828 0.299
NP_441077.1_6 Reverse -112 -128 2.31983 0.286
NP_440066.1_8 Reverse -242 -261 16.8141 0.283
NP_441846.1_10 Forward -319 -300 -11.8986 0.19
NP_442958.1_3 Forward -312 -293 0.884433 0.267
NP_441422.1_7 Reverse -290 -307 -5.07437 0.247
NP_442296.1_9 Forward -300 -281 11.0125 0.0897
NP_442658.1_1 Forward -303 -293 15.9091 0.00966
NP_442658.1_1 Reverse -290 -300 6.76441 0.214
NP_442198.1_3 Forward -253 -234 2.55606 0.299
NP_442198.1_3 Forward -252 -233 2.3594 0.299
NP_442205.1_9 Forward -307 -291 15.6932 0.0259
NP_441414.1_9 Forward -301 -282 5.89931 0.0437
NP_441414.1_9 Reverse -292 -311 -3.63879 0.14
NP_440184.1_1 Reverse -109 -128 5.65156 0.206
NP_442937.1_5 Reverse -287 -306 6.19431 0.286
NP_441958.1_5 Forward -302 -292 21.2195 0.000805
NP_441958.1_5 Reverse -291 -301 12.2714 0.00183
NP_440203.1_5 Forward -337 -327 15.5158 0.0791
NP_439905.1_1 Reverse -293 -306 6.80412 0.275
NP_442911.1_2 Forward -311 -292 8.06259 0.0223
NP_442911.1_2 Reverse -282 -301 0.687771 0.0652
NP_440153.1_5 Reverse -293 -307 4.22782 0.199
NP_440153.1_8 Reverse -357 -370 -2.43899 0.238
NP_440993.1_2 Forward -306 -290 3.30346 0.259
NP_440993.1_2 Reverse -287 -303 1.5335 0.279
NP_440993.1_3 Forward -376 -357 -0.984623 0.273
NP_441099.1_5 Reverse -282 -301 5.40766 0.0469
NP_441099.1_5 Forward -311 -292 -1.67217 0.112
NP_442002.1_9 Reverse -393 -400 10.7572 0.185
NP_441294.1_7 Reverse -288 -302 16.5458 0.0138
NP_441294.1_7 Forward -305 -291 9.53859 0.241
NP_440411.1_7 Forward -268 -249 23.9922 0.00872
NP_441646.1_1 Forward -308 -289 3.6377 0.206
NP_441646.1_1 Reverse -285 -304 0.392778 0.251
NP_441646.1_1 Forward -347 -328 -1.18052 0.28
NP_442438.1_10 Forward -306 -292 5.99778 0.123
NP_442438.1_10 Forward -348 -334 5.60446 0.131
NP_442438.1_10 Reverse -287 -301 1.27789 0.2
NP_442431.1_10 Forward -315 -297 -0.0791831 0.284
NP_441000.1_6 Forward -302 -288 -4.22864 0.231
NP_442771.1_1 Reverse -290 -308 -6.76569 0.169
NP_441110.1_1 Reverse -361 -380 5.30933 0.282
NP_440147.1_4 Reverse -290 -303 20.1771 0.00228
NP_440147.1_4 Forward -303 -290 3.75586 0.181
NP_440147.1_4 Forward -296 -283 0.412608 0.255
NP_441550.1_8 Forward -303 -293 17.4824 0.00754
NP_441550.1_8 Reverse -290 -300 14.6309 0.0132
NP_441916.1_7 Reverse -292 -302 18.9579 0.00144
NP_441916.1_7 Forward -301 -291 10.3048 0.0261
NP_441916.1_10 Forward -309 -290 12.4875 0.122
NP_441041.1_4 Forward -301 -282 4.916 0.0542
NP_441041.1_7 Reverse -289 -301 11.8878 0.0689
NP_441041.1_7 Forward -304 -292 8.87526 0.128
NP_442642.1_9 Forward -308 -291 3.48043 0.192
NP_442396.1_5 Reverse -288 -301 10.7374 0.106
NP_440569.1_10 Forward -264 -245 2.24364 0.295
NP_442004.1_6 Reverse -292 -306 6.88276 0.17
NP_441725.1_5 Reverse -293 -303 8.92815 0.0553
NP_441725.1_5 Forward -300 -290 2.04498 0.115
NP_439966.1_7 Forward -303 -293 13.8442 0.0234
NP_439966.1_7 Reverse -290 -300 7.25606 0.15
NP_439966.1_9 Forward -303 -294 0.983037 0.253
NP_440736.1_3 Forward -303 -284 0.0977854 0.282
NP_442941.1_3 Forward -300 -290 11.0914 0.0116
NP_442941.1_3 Reverse -293 -303 10.9931 0.0116
NP_440289.1_2 Forward -304 -291 2.18257 0.102
NP_440289.1_2 Reverse -289 -302 -2.24233 0.253
NP_440983.1_5 Reverse -162 -181 -6.68705 0.278
NP_440260.1_8 Forward -310 -292 -7.35568 0.295
NP_441514.1_1 Forward -102 -92 15.2045 0.274
NP_442281.1_1 Reverse -287 -301 10.2254 0.0608
NP_441334.1_7 Reverse -290 -309 -21.1417 0.29
NP_442575.1_3 Reverse -295 -314 13.3725 0.103
NP_440177.1_9 Forward -309 -290 13.5691 0.226
NP_442256.1_2 Forward -303 -285 -7.35568 0.214
NP_442500.1_8 Reverse -245 -259 14.8059 0.156
NP_442500.1_8 Reverse -111 -125 12.6849 0.228
NP_441457.1_7 Reverse -290 -309 -0.688862 0.293
NP_440498.1_1 Reverse -283 -301 -3.32411 0.261
NP_440375.1_8 Forward -300 -281 7.96426 0.161
NP_443030.1_1 Forward -80 -63 14.4935 0.132
NP_441644.1_6 Reverse -292 -302 19.0557 0.000803
NP_441644.1_6 Forward -301 -291 17.3841 0.00127
NP_441644.1_6 Forward -366 -356 5.09279 0.21
NP_442215.1_2 Forward -303 -287 2.22182 0.12
NP_442215.1_2 Forward -342 -326 0.451859 0.151
NP_442247.1_8 Reverse -290 -304 9.93102 0.247
NP_440253.1_2 Forward -301 -283 -1.84914 0.252
NP_440929.1_8 Forward -301 -292 19.2726 0.000701
NP_440929.1_8 Reverse -292 -301 19.2726 0.000701
NP_442933.1_10 Forward -301 -292 17.601 0.00325
NP_442933.1_10 Reverse -292 -301 17.601 0.00325
NP_441751.2_8 Reverse -293 -307 14.9459 0.0119
NP_441751.2_8 Forward -300 -286 6.3911 0.0354
NP_442554.1_8 Reverse -293 -303 19.1546 0.00369
NP_442554.1_8 Forward -300 -290 15.3197 0.00882
NP_441762.1_7 Reverse -291 -303 2.59558 0.0676
NP_441762.1_7 Forward -302 -290 0.530633 0.0747
NP_442142.1_4 Reverse -289 -302 11.5234 0.0552
NP_442142.1_4 Reverse -300 -313 5.23026 0.197
NP_442142.1_4 Reverse -318 -331 3.65697 0.248
NP_442142.1_4 Forward -304 -291 3.65697 0.248
NP_442142.1_4 Reverse -328 -341 2.96866 0.269
NP_442292.1_1 Forward -300 -291 18.486 0.00229
NP_442292.1_1 Reverse -293 -302 17.5026 0.00435
NP_442292.1_2 Reverse -65 -79 16.1311 0.269
NP_442476.1_6 Reverse -293 -307 2.16287 0.191
NP_440895.1_6 Reverse -68 -81 8.27909 0.284
NP_443009.1_5 Reverse -291 -302 14.5128 0.02
NP_443009.1_5 Forward -302 -291 10.1862 0.0792
NP_443009.1_5 Reverse -333 -344 3.40144 0.296
NP_441715.1_4 Forward -300 -290 7.94484 0.107
NP_441715.1_4 Reverse -293 -303 7.25653 0.108
NP_440015.1_9 Reverse -292 -310 -2.0458 0.299
NP_440183.1_1 Forward -300 -281 4.62101 0.298
NP_440183.1_9 Forward -364 -345 -11.3086 0.25
NP_441198.1_5 Forward -299 -286 13.9817 0.206
NP_441198.1_8 Forward -303 -293 15.4199 0.0427
NP_440379.1_5 Forward -316 -297 -3.73712 0.205
NP_440379.1_5 Forward -310 -291 -5.01543 0.219
NP_440464.1_10 Forward -300 -290 13.0082 0.169
NP_441468.1_1 Forward -300 -293 15.8704 0.0124
NP_441468.1_1 Reverse -293 -300 15.8704 0.0124
NP_441020.2_6 Forward -303 -286 11.5436 0.117
NP_441015.1_8 Reverse -231 -250 2.16274 0.272
NP_441015.1_10 Forward -317 -298 -1.18052 0.171
NP_441673.1_1 Forward -301 -292 20.8459 0.000698
NP_441673.1_1 Reverse -292 -301 20.8459 0.000698
NP_441826.1_2 Reverse -286 -300 2.45787 0.127
NP_441826.1_2 Forward -346 -332 -1.77037 0.254
NP_441826.1_2 Forward -307 -293 -3.04867 0.282
NP_441764.1_4 Forward -79 -62 19.7218 0.0453
NP_442868.1_6 Reverse -290 -300 9.81313 0.038
NP_442868.1_6 Forward -303 -293 8.63316 0.0555
NP_442868.1_6 Forward -393 -383 -0.41329 0.295
NP_442719.1_2 Forward -262 -244 -9.51964 0.266
NP_441251.1_7 Forward -126 -113 12.9006 0.266
NP_441612.1_2 Forward -301 -291 8.54929 0.21
NP_442227.1_2 Reverse -305 -324 9.53756 0.171
NP_441911.1_10 Reverse -146 -165 7.2093 0.28
NP_442808.1_1 Forward -302 -292 8.73102 0.0481
NP_442808.1_1 Reverse -291 -301 8.63269 0.0481
NP_442808.1_1 Forward -341 -331 3.71617 0.227
NP_441849.1_2 Forward -54 -35 7.01823 0.245
NP_440145.1_3 Forward -93 -74 3.34271 0.106
NP_440145.1_3 Forward -311 -292 1.86774 0.122
NP_442050.1_5 Forward -303 -293 17.1874 0.00812
NP_442050.1_5 Reverse -290 -300 7.64939 0.243
NP_442342.1_9 Forward -342 -326 8.12167 0.194
NP_440558.1_2 Forward -370 -351 2.75272 0.165
NP_440558.1_2 Forward -310 -291 -2.26216 0.225
NP_441518.1_3 Reverse -282 -301 -13.8652 0.264
NP_441878.1_6 Forward -302 -292 10.5014 0.0176
NP_441878.1_6 Reverse -291 -301 10.4031 0.0176
NP_441036.1_8 Forward -302 -292 15.713 0.00724
NP_441036.1_8 Reverse -291 -301 8.33817 0.174
NP_441557.1_5 Forward -301 -292 19.9609 0.000699
NP_441557.1_5 Reverse -292 -301 19.9609 0.000699
NP_441590.1_4 Reverse -299 -318 7.17681 0.25
NP_442066.2_4 Reverse -292 -311 -7.4737 0.28
NP_442066.2_9 Forward -305 -292 12.114 0.154
NP_441433.1_8 Forward -237 -218 -3.83545 0.285
NP_441308.1_8 Forward -303 -293 12.4681 0.218
NP_442183.1_1 Reverse -292 -306 10.4227 0.0845
NP_442444.1_6 Forward -309 -291 20.1752 0.0935
NP_441549.1_9 Reverse -288 -306 -5.29072 0.198
NP_442347.1_2 Forward -300 -291 12.4878 0.056
NP_442347.1_2 Forward -339 -330 8.1612 0.108
NP_442347.1_2 Reverse -293 -302 3.34298 0.284
NP_442645.1_2 Forward -309 -290 5.99764 0.0183
NP_442645.1_2 Reverse -284 -303 -12.4886 0.144
NP_441037.1_4 Forward -303 -293 16.5761 0.0168
NP_441037.1_4 Reverse -290 -300 7.9999 0.237
NP_441633.1_3 Reverse -290 -303 10.8357 0.0286
NP_441633.1_3 Forward -345 -332 -4.30728 0.191
NP_440136.1_2 Forward -300 -293 15.9687 0.0123
NP_440136.1_2 Reverse -293 -300 15.9687 0.0123
NP_442998.1_5 Forward -220 -210 8.1415 0.271
NP_442998.1_10 Forward -299 -292 15.5754 0.0102
NP_442998.1_10 Reverse -294 -301 15.5754 0.0102
NP_440299.1_1 Reverse -288 -301 10.3434 0.0573
NP_440299.1_1 Forward -305 -292 9.36014 0.0728
NP_441799.1_1 Reverse -288 -302 15.8302 0.0163
NP_441799.1_1 Forward -305 -291 12.782 0.04
NP_441007.1_10 Forward -306 -293 12.9006 0.0499
NP_441007.1_10 Reverse -287 -300 0.412608 0.23
NP_442201.1_10 Forward -312 -293 -13.3736 0.274
NP_441449.1_8 Reverse -278 -297 15.0503 0.21
NP_442333.2_5 Reverse -347 -366 -15.2418 0.29
NP_440256.1_1 Reverse -289 -308 -3.44213 0.133
NP_440256.1_1 Reverse -369 -388 -8.26035 0.256
NP_441559.1_8 Reverse -326 -340 -6.58858 0.279
NP_440915.1_6 Reverse -288 -302 10.7177 0.0301
NP_440915.1_6 Forward -305 -291 10.3243 0.0322
NP_442158.1_4 Forward -151 -141 10.7964 0.283
NP_442452.1_8 Reverse -315 -329 19.1735 0.257
NP_440748.1_5 Forward -298 -279 2.94938 0.213
NP_441464.1_8 Reverse -292 -306 7.47274 0.206
NP_441939.1_3 Reverse -293 -312 6.78429 0.222
NP_441199.1_6 Reverse -288 -307 -1.47551 0.292
NP_441494.1_6 Reverse -329 -342 5.62415 0.298
NP_442993.1_1 Reverse -292 -308 -10.7579 0.226
NP_442386.1_9 Reverse -291 -300 13.8639 0.0289
NP_442386.1_9 Forward -302 -293 6.39082 0.219
NP_440570.1_5 Reverse -321 -340 -2.16383 0.277
NP_441340.1_5 Forward -300 -293 15.6737 0.0124
NP_441340.1_5 Reverse -293 -300 15.6737 0.0124
NP_441340.1_9 Forward -94 -84 8.93007 0.256
NP_442484.1_2 Reverse -281 -300 -0.39387 0.262
NP_440146.1_2 Forward -307 -293 14.3559 0.23
NP_440586.1_1 Reverse -378 -397 1.17943 0.231
NP_440586.1_8 Forward -300 -293 13.2151 0.026
NP_440586.1_8 Reverse -293 -300 13.2151 0.026
NP_442251.1_6 Forward -300 -293 15.2804 0.0124
NP_442251.1_6 Reverse -293 -300 15.2804 0.0124
NP_440684.1_9 Reverse -286 -300 9.83269 0.216
NP_441262.1_3 Reverse -292 -299 14.7888 0.0223
NP_441262.1_3 Forward -301 -294 14.7888 0.0223
NP_440027.1_3 Reverse -357 -375 16.2429 0.0944
NP_440027.1_8 Reverse -289 -308 4.62021 0.287
NP_443051.1_1 Forward -302 -293 19.5676 0.00335
NP_443051.1_1 Reverse -291 -300 10.4228 0.00754
NP_441232.1_10 Forward -312 -293 1.17943 0.287
NP_439937.1_8 Forward -387 -368 -3.93378 0.276
NP_440439.1_1 Forward -304 -291 3.06754 0.121
NP_440372.1_2 Forward -300 -293 16.3621 0.0124
NP_440372.1_2 Reverse -293 -300 16.3621 0.0124
NP_441789.1_7 Reverse -302 -321 7.76679 0.193
NP_440819.1_5 Reverse -241 -249 7.98423 0.228
NP_440819.1_5 Reverse -107 -115 7.59091 0.272
NP_439977.1_5 Forward -346 -327 -0.000545616 0.217
NP_440139.1_1 Forward -307 -288 3.53858 0.202
NP_441572.1_7 Forward -307 -288 -4.03212 0.224
NP_440267.1_1 Forward -66 -50 19.0097 0.295
NP_442384.1_10 Forward -301 -288 9.06573 0.0574
NP_442384.1_10 Reverse -292 -305 8.67241 0.0625
NP_442384.1_10 Forward -340 -327 4.54251 0.153
NP_442384.1_10 Reverse -231 -244 4.44418 0.157
NP_441980.1_9 Forward -308 -289 13.9625 0.298
NP_441877.1_9 Reverse -59 -76 13.6085 0.127
NP_442262.1_10 Forward -300 -293 14.1988 0.0123
NP_442262.1_10 Reverse -293 -300 14.1988 0.0123
NP_442262.1_10 Forward -333 -326 8.20058 0.25
NP_442262.1_10 Forward -231 -224 7.21728 0.281
NP_441689.1_5 Forward -303 -293 8.43603 0.132
NP_441689.1_5 Reverse -290 -300 5.78111 0.197
NP_440344.1_10 Reverse -285 -302 -10.7776 0.19
NP_442917.1_1 Reverse -41 -60 7.37347 0.254
NP_442910.1_1 Reverse -285 -304 -8.26035 0.289
NP_441965.1_3 Forward -311 -292 4.916 0.161
NP_441965.1_10 Forward -343 -327 8.71166 0.123
NP_441965.1_10 Forward -304 -288 5.76173 0.197
NP_442529.1_4 Reverse -283 -302 13.2741 0.175
NP_440297.1_9 Forward -300 -290 -0.118297 0.282
NP_440297.1_9 Reverse -293 -303 -0.314959 0.282
NP_440298.1_2 Forward -346 -327 3.44104 0.295
NP_440999.1_9 Forward -344 -330 4.22782 0.116
NP_440888.1_2 Reverse -292 -306 17.7968 0.00308
NP_440888.1_2 Forward -340 -326 12.2903 0.0476
NP_440888.1_2 Forward -301 -287 9.53707 0.123
NP_442033.1_10 Forward -342 -323 9.24257 0.0493
NP_441949.1_2 Reverse -282 -301 9.73422 0.261
NP_441949.1_5 Forward -79 -60 21.6703 0.0125
NP_441543.1_2 Forward -300 -291 16.9127 0.00359
NP_441543.1_2 Reverse -293 -302 15.9293 0.00518
NP_442845.1_2 Forward -307 -293 17.2075 0.0608
NP_442845.1_2 Reverse -286 -300 4.12949 0.267
NP_441918.1_7 Forward -205 -186 -3.73712 0.297
NP_441469.1_8 Forward -302 -293 6.5879 0.227
NP_441469.1_8 Reverse -291 -300 6.48957 0.227
NP_441469.1_8 Forward -341 -332 5.21127 0.283
NP_441548.1_3 Forward -365 -346 13.175 0.24
NP_442315.1_1 Forward -317 -299 3.16574 0.294
NP_442315.1_5 Reverse -348 -358 16.008 0.3
NP_443064.1_6 Forward -301 -291 12.5669 0.0796
NP_443064.1_6 Reverse -292 -302 10.8217 0.13
NP_442578.1_7 Forward -300 -293 14.5921 0.026
NP_442578.1_7 Reverse -293 -300 14.5921 0.026
NP_442578.1_7 Reverse -383 -390 8.69224 0.172
NP_440710.1_1 Reverse -349 -367 -0.570838 0.164
NP_440710.1_1 Forward -309 -291 -1.06249 0.179
NP_441462.1_2 Reverse -292 -302 20.2362 0.000805
NP_441462.1_2 Forward -301 -291 11.5831 0.00406
NP_441621.1_7 Reverse -290 -304 -5.21195 0.248
NP_443062.1_1 Forward -301 -283 13.5188 0.0616
NP_443062.1_1 Reverse -292 -310 4.93815 0.244
NP_443062.1_6 Reverse -284 -303 10.6192 0.112
NP_441601.1_4 Reverse -299 -318 5.99764 0.166
NP_442204.1_2 Reverse -218 -237 7.17762 0.287
NP_440544.1_5 Forward -250 -243 14.5681 0.264
NP_440516.1_8 Forward -301 -292 16.9127 0.00442
NP_440516.1_8 Reverse -292 -301 16.9127 0.00442
NP_442428.1_5 Forward -300 -293 15.8704 0.0124
NP_442428.1_5 Reverse -293 -300 15.8704 0.0124
NP_441353.1_1 Forward -89 -70 18.1054 0.166
NP_442859.1_2 Reverse -293 -312 3.44104 0.253
NP_440673.1_2 Forward -311 -292 14.5843 0.0986
NP_440673.1_3 Forward -299 -292 12.4288 0.0426
NP_440673.1_3 Reverse -294 -301 12.4288 0.0426
NP_440673.1_3 Reverse -378 -385 8.20058 0.234
NP_441714.1_3 Forward -308 -290 14.6697 0.171
NP_441052.1_2 Forward -301 -291 19.9412 0.00106
NP_441052.1_2 Forward -340 -330 12.7631 0.0285
NP_441052.1_2 Reverse -292 -302 10.4031 0.0285
NP_442219.1_9 Forward -300 -291 17.7976 0.00718
NP_442219.1_9 Reverse -293 -302 8.25953 0.0681
NP_442219.1_9 Forward -339 -330 1.76968 0.298
NP_440436.1_4 Forward -300 -291 17.2072 0.00233
NP_440436.1_4 Reverse -293 -302 9.24241 0.0871
NP_441884.1_9 Forward -346 -327 -22.3217 0.277
NP_441884.1_9 Forward -304 -285 -23.4033 0.284
NP_442086.1_3 Reverse -293 -312 8.35759 0.231
NP_440314.1_9 Reverse -293 -312 2.3594 0.0855
NP_441719.1_4 Forward -300 -293 16.3621 0.0124
NP_441719.1_4 Reverse -293 -300 16.3621 0.0124
NP_441733.1_10 Forward -304 -291 6.01747 0.203
NP_441004.1_1 Forward -355 -336 -17.6018 0.292
NP_442366.1_3 Forward -302 -284 -4.60241 0.274
NP_442366.1_5 Reverse -289 -299 14.8275 0.0375
NP_439949.1_10 Reverse -79 -98 15.6079 0.23
NP_440129.1_10 Forward -247 -233 4.91614 0.185
NP_442854.1_6 Reverse -292 -311 1.76941 0.279
NP_443054.1_2 Forward -303 -289 1.86788 0.245
NP_443054.1_2 Reverse -329 -343 0.589577 0.258
NP_442308.1_4 Reverse -279 -298 -0.197208 0.285
NP_441851.1_6 Forward -79 -60 13.4617 0.227
NP_441851.1_9 Forward -370 -351 8.25926 0.267
NP_441851.1_10 Reverse -291 -301 15.8113 0.00552
NP_441851.1_10 Forward -302 -292 8.53483 0.114
NP_442515.1_1 Reverse -291 -305 6.78443 0.0974
NP_442515.1_1 Reverse -118 -132 -1.27871 0.251
NP_442515.1_1 Forward -392 -378 -3.24533 0.289
NP_440165.1_5 Forward -302 -283 -7.76869 0.276
NP_440165.1_5 Forward -295 -276 -8.35868 0.298
NP_441046.1_2 Reverse -371 -390 5.01433 0.227
NP_440338.1_4 Reverse -104 -123 7.37347 0.28
NP_441349.1_10 Reverse -282 -301 -7.27704 0.247
NP_441349.1_10 Forward -311 -292 -7.37537 0.248
NP_442314.1_1 Reverse -346 -364 -3.6191 0.25
NP_440432.1_9 Forward -300 -285 -1.10174 0.167
NP_440432.1_9 Reverse -293 -308 -1.98672 0.167
NP_439960.1_10 Reverse -221 -239 -4.50408 0.293
NP_440474.1_8 Reverse -293 -307 19.2718 0.0423
NP_442450.1_5 Reverse -290 -300 7.55152 0.13
NP_442168.1_5 Reverse -293 -312 0.982764 0.241
NP_441031.1_1 Forward -72 -53 3.64132 0.299
NP_443047.1_7 Reverse -293 -312 17.8957 0.0485
NP_441450.1_4 Reverse -71 -89 20.3728 0.207
NP_441570.1_1 Forward -301 -283 0.21581 0.0403
NP_441078.1_4 Forward -301 -292 19.6659 0.0007
NP_441078.1_4 Reverse -292 -301 19.6659 0.0007
NP_441078.1_4 Reverse -4 -13 3.24465 0.145
NP_441078.1_4 Reverse -331 -340 -1.86856 0.272
NP_441078.1_4 Forward -340 -331 -2.06522 0.295
NP_441091.1_5 Forward -344 -325 3.34271 0.286
NP_440526.1_3 Forward -300 -289 10.2846 0.0646
NP_440526.1_3 Reverse -293 -304 2.41814 0.267
NP_441432.1_8 Reverse -291 -300 16.8143 0.00595
NP_441432.1_8 Forward -302 -293 16.8143 0.00595
NP_442320.1_8 Forward -307 -293 -1.08205 0.0817
NP_442320.1_8 Reverse -286 -300 -4.81863 0.188
NP_441732.1_2 Forward -305 -289 -15.5761 0.151
NP_441732.1_2 Reverse -288 -304 -16.2644 0.165
NP_440760.1_1 Reverse -292 -311 -2.0655 0.0329
NP_440760.1_1 Forward -301 -282 -21.535 0.238
NP_442797.1_1 Reverse -299 -318 0.687771 0.212
NP_442797.1_6 Reverse -305 -324 11.7155 0.238
NP_440199.1_10 Reverse -289 -299 7.25653 0.231
NP_441805.1_1 Reverse -141 -160 -5.99873 0.3
NP_442727.1_10 Forward -125 -106 2.3594 0.203
NP_440713.1_4 Forward -376 -357 4.22769 0.231
NP_440713.1_4 Reverse -321 -340 3.6377 0.24
NP_442489.1_7 Forward -301 -292 20.1576 0.000695
NP_442489.1_7 Reverse -292 -301 20.1576 0.000695
NP_442489.1_7 Reverse -331 -340 -1.57357 0.213
NP_440565.1_3 Reverse -298 -317 15.8702 0.218
NP_440559.1_1 Forward -300 -291 17.4043 0.00658
NP_440559.1_1 Reverse -293 -302 8.65285 0.0586
NP_441659.2_8 Reverse -292 -302 20.9245 0.000805
NP_441659.2_8 Forward -301 -291 18.1713 0.00133
NP_441659.2_8 Forward -240 -230 0.275027 0.27
NP_441659.2_8 Forward -391 -381 0.0783647 0.277
NP_442913.1_10 Reverse -283 -302 5.99764 0.0664
NP_441040.1_5 Reverse -347 -366 3.83436 0.268
NP_440708.1_6 Reverse -299 -318 -5.70374 0.234
NP_440118.1_5 Forward -124 -105 7.47261 0.112
NP_442776.1_6 Forward -303 -284 12.5858 0.145
NP_442346.1_5 Reverse -291 -301 16.6963 0.00248
NP_442346.1_5 Forward -302 -292 16.303 0.00248
NP_442346.1_5 Forward -392 -382 5.68323 0.234
NP_440545.1_3 Reverse -288 -305 5.05372 0.0646
NP_440545.1_5 Reverse -288 -305 8.00365 0.21
NP_441856.1_1 Reverse -319 -338 8.94757 0.201
NP_440459.1_2 Reverse -338 -355 8.00365 0.272
NP_442603.1_7 Forward -340 -326 12.3887 0.1
NP_442828.1_2 Forward -75 -56 13.7027 0.242
NP_441833.1_4 Forward -300 -293 15.9687 0.0124
NP_441833.1_4 Reverse -293 -300 15.9687 0.0124
NP_442162.1_9 Forward -300 -293 16.2637 0.0124
NP_442162.1_9 Reverse -293 -300 16.2637 0.0124
NP_442140.1_3 Forward -300 -290 12.2714 0.0632
NP_442140.1_3 Reverse -293 -303 7.94484 0.124
NP_441696.1_6 Reverse -293 -312 0.294447 0.294
NP_440875.1_9 Reverse -294 -304 8.66404 0.233
NP_441813.1_5 Forward -303 -293 8.73149 0.0367
NP_441813.1_5 Reverse -290 -300 8.63316 0.0367
NP_440594.1_8 Reverse -293 -306 10.3434 0.168
NP_440590.1_4 Forward -300 -287 2.2809 0.0939
NP_440590.1_4 Reverse -293 -306 1.29759 0.127
NP_440567.1_1 Reverse -293 -307 18.1908 0.0153
NP_440567.1_1 Forward -300 -286 14.0609 0.0191
NP_442497.1_10 Reverse -293 -302 17.601 0.00813
NP_442497.1_10 Forward -300 -291 10.4228 0.0087
NP_440821.1_4 Forward -303 -293 10.7964 0.0146
NP_440821.1_4 Reverse -290 -300 9.41981 0.0286
NP_441239.1_9 Forward -303 -291 14.887 0.0247
NP_441239.1_9 Reverse -356 -368 6.52882 0.185
NP_441239.1_9 Reverse -290 -302 3.38223 0.285
NP_441239.1_9 Reverse -295 -307 3.18557 0.292
NP_441727.1_3 Reverse -381 -400 2.94938 0.296
NP_440624.1_5 Forward -263 -245 6.51052 0.298
NP_442669.1_1 Forward -47 -28 0.294447 0.287
NP_442044.1_1 Reverse -292 -311 -7.37537 0.224
NP_442270.1_9 Reverse -281 -300 -8.94866 0.226
NP_440219.1_1 Forward -129 -110 13.0324 0.259
NP_440219.1_1 Forward -64 -45 13.0324 0.259
NP_441508.1_1 Forward -76 -57 20.1685 0.0922
NP_440264.1_7 Reverse -35 -51 21.1605 0.143
NP_442809.1_6 Forward -397 -378 2.16274 0.267
NP_440546.1_4 Reverse -292 -302 13.5365 0.0459
NP_440546.1_4 Forward -301 -291 10.046 0.109
NP_440675.1_3 Forward -301 -282 12.3892 0.17
NP_440462.1_6 Forward -303 -293 19.4496 0.00371
NP_440462.1_6 Reverse -290 -300 1.35667 0.294
NP_442340.1_3 Forward -332 -313 -2.75381 0.205
NP_440868.1_4 Forward -305 -293 7.4138 0.0691
NP_440868.1_4 Reverse -288 -300 6.23383 0.0878
NP_442499.1_3 Reverse -291 -309 11.3272 0.219
NP_442479.1_5 Forward -262 -243 6.23167 0.26
NP_441848.1_4 Forward -63 -47 10.4154 0.253
NP_441084.1_6 Forward -303 -289 13.9011 0.115
NP_441084.1_6 Reverse -235 -249 9.34412 0.287
NP_442039.1_4 Forward -300 -293 15.1821 0.0124
NP_442039.1_4 Reverse -293 -300 15.1821 0.0124
NP_442039.1_5 Forward -315 -296 19.5673 0.265
NP_441811.1_8 Forward -307 -293 8.45605 0.238
NP_442380.1_10 Forward -376 -358 10.4422 0.246
NP_442380.1_10 Reverse -378 -396 8.18062 0.263
NP_442409.1_5 Forward -325 -306 13.3725 0.238
NP_441926.1_3 Reverse -292 -308 13.8249 0.0521
NP_440825.1_7 Forward -300 -290 12.9096 0.152
NP_442837.1_3 Forward -300 -293 15.7721 0.0124
NP_442837.1_3 Reverse -293 -300 15.7721 0.0124
NP_442053.1_1 Forward -301 -292 18.3876 0.0007
NP_442053.1_1 Reverse -292 -301 18.3876 0.0007
NP_440505.1_3 Forward -303 -293 15.418 0.0114
NP_440505.1_3 Reverse -290 -300 9.22315 0.122
NP_442532.1_7 Reverse -292 -306 6.58777 0.171
NP_440914.1_1 Forward -301 -291 17.5935 0.000537
NP_440914.1_1 Reverse -292 -302 16.3248 0.00196
NP_441011.1_8 Reverse -293 -302 16.6177 0.00602
NP_441011.1_8 Forward -300 -291 8.25953 0.144
NP_442533.1_1 Forward -327 -308 -5.70374 0.155
NP_442533.1_1 Forward -318 -299 -16.6185 0.273
NP_442533.1_6 Forward -301 -292 17.2076 0.00137
NP_442533.1_6 Reverse -292 -301 17.2076 0.00137
NP_442533.1_6 Forward -340 -331 6.98123 0.0992
NP_442533.1_6 Reverse -331 -340 3.93297 0.197
NP_442533.1_6 Forward -366 -357 2.06468 0.275
NP_442322.1_4 Reverse -303 -320 7.3146 0.153
NP_440854.1_5 Reverse -110 -124 14.3354 0.293
NP_442229.1_1 Forward -303 -289 9.24208 0.184
NP_443016.1_1 Reverse -342 -361 -7.86702 0.288
NP_443016.1_1 Reverse -286 -305 -8.65367 0.3
NP_441482.1_7 Forward -307 -293 -2.95034 0.103
NP_441482.1_7 Reverse -352 -366 -11.3085 0.254
NP_439944.1_9 Reverse -293 -303 17.7779 0.00341
NP_439944.1_9 Forward -300 -290 10.5014 0.0887
NP_441697.1_5 Reverse -55 -74 -5.96867 0.232
NP_441028.1_6 Forward -250 -240 5.38779 0.255
NP_442664.1_10 Forward -99 -80 10.0292 0.261
NP_440116.1_5 Reverse -289 -306 6.62702 0.167
NP_440116.1_8 Forward -300 -281 9.14423 0.0354
NP_441527.1_4 Reverse -102 -121 -11.8892 0.284
NP_440115.1_6 Forward -304 -294 7.74818 0.146
NP_440115.1_6 Forward -394 -384 5.5849 0.236
NP_441106.1_1 Forward -302 -293 18.486 0.0028
NP_441106.1_1 Reverse -291 -300 9.63616 0.0311
NP_439903.1_6 Reverse -124 -143 1.86696 0.239
NP_439903.1_6 Forward -304 -285 1.37531 0.248
NP_442306.1_10 Reverse -287 -306 -20.1584 0.202
NP_441286.1_1 Reverse -291 -303 14.6903 0.00418
NP_441286.1_1 Forward -302 -290 3.48056 0.0467
NP_442674.1_3 Reverse -307 -326 3.24359 0.294
NP_440670.1_8 Forward -301 -292 18.3876 0.000699
NP_440670.1_8 Reverse -292 -301 18.3876 0.000699
NP_440886.1_7 Forward -302 -292 8.04271 0.0805
NP_440886.1_7 Reverse -291 -301 7.94438 0.0805
NP_440886.1_7 Forward -341 -331 4.99446 0.205
NP_442072.1_9 Reverse -291 -309 -2.63579 0.0317
NP_442072.1_9 Forward -302 -284 -11.2889 0.0789
NP_442072.1_9 Forward -205 -187 -14.6322 0.153
NP_440513.1_7 Reverse -350 -369 14.0608 0.206
NP_442401.1_2 Reverse -291 -310 6.78348 0.282
NP_439899.1_1 Reverse -58 -76 6.81542 0.205
NP_440907.2_8 Reverse -293 -303 19.1541 0.00362
NP_440907.2_8 Forward -300 -290 7.64939 0.117
NP_441021.1_1 Forward -300 -281 -1.08219 0.11
NP_441021.1_1 Reverse -293 -312 -7.96535 0.192
NP_441463.1_3 Reverse -282 -301 6.68596 0.0596
NP_441463.1_6 Reverse -329 -343 8.54187 0.25
NP_441626.1_2 Forward -300 -293 15.7721 0.0124
NP_441626.1_2 Reverse -293 -300 15.7721 0.0124
NP_441626.1_2 Reverse -383 -390 4.85733 0.244
NP_442365.1_7 Forward -370 -351 0.786102 0.177
NP_442365.1_7 Reverse -288 -307 -2.0655 0.199
NP_442794.1_1 Reverse -288 -300 2.69391 0.286
NP_442615.1_1 Forward -310 -292 7.19731 0.0324
NP_442615.1_1 Reverse -283 -301 0.510803 0.101
NP_441962.1_4 Forward -306 -287 -3.73712 0.151
NP_441962.1_4 Forward -396 -377 -8.94866 0.21
NP_441962.1_4 Reverse -326 -345 -10.817 0.232
NP_440387.1_1 Reverse -292 -308 26.1162 0.000932
NP_440387.1_1 Forward -301 -285 14.5132 0.00649
NP_440387.1_1 Reverse -331 -347 -4.56302 0.19
NP_440387.1_1 Forward -204 -188 -5.64466 0.243
NP_441431.1_2 Forward -304 -290 7.76712 0.234
NP_441836.1_2 Forward -307 -288 -6.1954 0.292
NP_440814.1_4 Reverse -283 -302 -12.1936 0.23
NP_440114.1_10 Reverse -292 -306 15.5359 0.0249
NP_440114.1_10 Forward -301 -287 8.25939 0.21
NP_440492.1_9 Reverse -243 -257 9.69621 0.294
NP_440287.1_6 Forward -303 -284 7.57094 0.151
NP_441720.1_2 Forward -169 -150 4.71854 0.231
NP_440766.1_5 Forward -106 -94 10.5205 0.27
NP_441421.1_6 Forward -75 -58 13.994 0.212
NP_439988.1_7 Reverse -294 -308 12.0937 0.292
NP_441237.1_9 Forward -300 -290 14.828 0.0242
NP_442743.1_1 Reverse -308 -327 4.62021 0.291
NP_439910.1_2 Reverse -284 -301 -21.594 0.183
NP_440457.1_1 Forward -305 -293 8.00379 0.101
NP_440457.1_1 Reverse -288 -300 0.825626 0.25
NP_440798.1_6 Reverse -293 -306 1.00259 0.24
NP_442680.1_5 Forward -225 -206 0.756062 0.258
NP_442509.1_9 Forward -301 -291 8.14104 0.192
NP_442509.1_9 Reverse -292 -302 8.04271 0.192
NP_441496.1_1 Forward -258 -244 13.7625 0.271
NP_441253.1_8 Reverse -287 -301 16.1759 0.121
NP_440554.1_4 Reverse -293 -303 15.418 0.0199
NP_441845.1_5 Reverse -172 -191 16.9442 0.198
NP_441885.1_5 Forward -301 -291 20.9245 0.000538
NP_441885.1_5 Reverse -292 -302 11.3864 0.00668
NP_441885.1_5 Forward -340 -330 -0.41329 0.197
NP_442341.1_7 Reverse -330 -344 9.2427 0.0751
NP_442341.1_7 Reverse -291 -305 2.35953 0.259
NP_442341.1_9 Forward -303 -289 10.8154 0.133
NP_442395.2_4 Reverse -339 -358 5.89851 0.152
NP_443000.1_7 Forward -303 -293 10.7964 0.0345
NP_443000.1_7 Reverse -290 -300 10.3048 0.0345
NP_440507.2_3 Reverse -322 -341 13.175 0.145
NP_440727.1_1 Reverse -330 -349 10.1275 0.249
NP_440275.1_3 Forward -303 -293 18.6629 0.0082
NP_440275.1_3 Reverse -290 -300 8.04317 0.0602
NP_440275.1_3 Reverse -332 -342 5.87989 0.13
NP_440091.1_1 Reverse -288 -300 10.7571 0.0429
NP_440091.1_1 Forward -305 -293 3.38223 0.163
NP_442275.1_1 Forward -360 -341 5.40766 0.267
NP_440679.1_4 Forward -362 -343 8.75091 0.274
NP_440679.1_10 Reverse -369 -388 -16.5201 0.266
NP_440679.1_10 Forward -313 -294 -20.4534 0.284
NP_443010.1_10 Forward -304 -287 7.98902 0.164
NP_441359.1_5 Reverse -303 -322 0.392778 0.291
NP_439962.1_4 Forward -241 -222 -8.94866 0.298
NP_440175.1_8 Reverse -307 -326 19.469 0.0737
NP_440149.1_8 Reverse -376 -395 -7.96535 0.296
NP_441105.1_3 Reverse -226 -245 -9.24366 0.286
NP_440216.1_1 Reverse -292 -306 6.29277 0.0156
NP_440216.1_1 Forward -301 -287 -0.492064 0.0284
NP_440172.1_1 Reverse -292 -302 17.5813 0.00421
NP_440172.1_1 Forward -301 -291 15.0247 0.00945
NP_440172.1_1 Forward -294 -284 2.04498 0.286
NP_442015.1_10 Reverse -327 -340 11.229 0.0372
NP_442015.1_10 Reverse -288 -301 1.59258 0.204
NP_441226.1_7 Forward -300 -293 14.4934 0.0123
NP_441226.1_7 Reverse -293 -300 14.4934 0.0123
NP_441111.1_7 Forward -300 -292 18.7023 0.00294
NP_441111.1_7 Reverse -293 -301 18.7023 0.00294
NP_442379.1_10 Reverse -285 -302 13.7068 0.0528
NP_442379.1_10 Forward -308 -291 10.4619 0.0932
NP_441766.1_2 Forward -301 -292 17.5026 0.00297
NP_441766.1_2 Reverse -292 -301 17.5026 0.00297
NP_441766.1_2 Reverse -382 -391 3.63797 0.209
NP_440416.1_9 Reverse -314 -333 -19.7651 0.278
NP_443052.1_8 Forward -353 -334 -6.1954 0.141
NP_443052.1_9 Reverse -129 -148 -3.54046 0.25
NP_443052.1_9 Forward -377 -358 -4.13045 0.254
NP_443052.1_9 Forward -247 -228 -6.98204 0.291
NP_442154.1_1 Forward -315 -297 -17.1888 0.249
NP_442154.1_1 Forward -329 -311 -17.9754 0.273
NP_440261.1_5 Reverse -293 -306 -10.6005 0.201
NP_440261.1_5 Forward -342 -329 -12.4687 0.297
NP_440988.1_10 Forward -368 -354 7.22233 0.219
NP_440988.1_10 Forward -399 -385 5.86695 0.24
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

GATCGCCGTAGCTACCGCAATCAATGTCTTCGGTGCCAGTGGCCTGCCTGGTCAAACTGCGGTCATCCCCATGGATCGTGAGGGAGCCGGTGAGGGTGAGGCGATCGCCAATCTGTTGGGTGTCAGTTGAATGGCACCCCCTTTTAAGAATTTTCTCCCGGGCCTCCGTCAGATGGAGGAAGTACAAATTTAGAAGTGCGATAATCTCACTTTTCGTATTCTTGGACTTTATGGAGGACCTCTCTATCCTTTTCTAGTGGTGAACTAGATGGTGTTATTGAGATTTTTTTACCGTTTCAGACAAATTAGGAAAACTCAGTGAACGTAAAGAAATATTACATTTTAGAAATATCTTAGATTGTGTTTCTAGAGTGCGTATATCTTTAAGGGTATATCCATC

CDS

GTGCAAATAAACTACTACACTGCAAAACCTATGAACAATCCTCTTCTCATGCTCAAAGACAAGACTGGCTCAATGAAAATCAAATTACTTATTAGCTTATTAATATTAACCCCAATTACAGCTTTAAGCAGCGTTGTTTTTGCTCAAAGTATGCATTCAGAACAGTCTAAAAAAGCAGAACAAAACTCGGAAGCAGCATTTGATTATGCTGGTTATTATTATGTCGAAACTTATTGTCAAGCAAGGTCGTATAATAAGCCCCATTTTGATTCTGTTAAAAATGCTACCTCTAGTTACAATGATAGGTTTAAAGTTTATATGAATAGGAATGGTGTTACAAATACCAATGCAATTGCTACTGCTTCTCAGCAAATGTTCTTTAGAAATGGTCAAGTAATTACCAACGCTATTAAAGAAACTTGTGCTTCTGTAATGGTAGGAACTGGTAGATAA

Protein

No sequence available