Your browser is old and dusty. Try Google Chrome!

Details for slr5102

ORF slr5102
Accession NP_942258.1
Symbol
Category
Definition
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_440795.1_7 Forward -290 -283 14.6904 0.0123
NP_440795.1_7 Reverse -283 -290 14.6904 0.0123
NP_441418.1_6 Forward -291 -272 -20.7484 0.125
NP_441453.1_4 Reverse -282 -290 16.6374 0.00633
NP_441453.1_4 Forward -291 -283 16.539 0.00633
NP_441623.1_1 Forward -228 -210 -0.865831 0.238
NP_440561.1_4 Reverse -280 -299 15.0585 0.208
NP_441818.1_1 Reverse -283 -294 14.2178 0.0541
NP_440226.1_1 Forward -291 -272 13.5691 0.0352
NP_440226.1_1 Reverse -282 -301 3.83436 0.212
NP_440813.1_6 Forward -54 -36 21.4553 0.102
NP_442173.1_1 Forward -290 -282 17.3257 0.00633
NP_442173.1_1 Reverse -283 -291 15.4574 0.00633
NP_442752.1_4 Forward -291 -284 13.8055 0.0199
NP_443027.1_4 Reverse -280 -290 14.6313 0.0452
NP_443027.1_4 Forward -293 -283 7.35486 0.24
NP_439997.1_6 Reverse -155 -174 13.0775 0.177
NP_440784.1_7 Forward -290 -283 15.9687 0.0123
NP_440784.1_7 Reverse -283 -290 15.9687 0.0123
NP_442909.1_7 Reverse -283 -297 12.0937 0.131
NP_441250.1_3 Forward -178 -159 2.85105 0.267
NP_440061.1_9 Forward -293 -279 6.68548 0.235
NP_442062.1_8 Forward -291 -281 17.0896 0.0025
NP_442062.1_8 Reverse -282 -292 15.2213 0.00881
NP_440304.1_4 Forward -293 -283 18.9579 0.00406
NP_442242.1_4 Forward -290 -283 14.3954 0.0124
NP_442242.1_4 Reverse -283 -290 14.3954 0.0124
NP_440273.1_3 Reverse -189 -208 5.80098 0.245
NP_440856.1_4 Reverse -275 -294 5.99764 0.0783
NP_441083.1_5 Forward -291 -281 10.5014 0.0197
NP_441083.1_5 Reverse -282 -292 10.1081 0.0208
NP_441434.1_7 Reverse -284 -298 16.0275 0.0961
NP_441738.1_2 Reverse -284 -291 15.28 0.0102
NP_441738.1_2 Forward -289 -282 11.5435 0.084
NP_441558.1_5 Forward -293 -274 15.8307 0.037
NP_440209.1_1 Forward -291 -283 18.1123 0.00295
NP_440209.1_1 Reverse -282 -290 8.57422 0.0425
NP_442889.1_8 Forward -294 -280 7.47213 0.149
NP_441713.1_1 Reverse -276 -295 -5.60541 0.113
NP_442570.1_3 Reverse -192 -211 -9.53865 0.299
NP_441716.1_1 Forward -291 -277 10.9143 0.0936
NP_442111.1_4 Reverse -281 -295 16.2242 0.0166
NP_440906.1_5 Forward -290 -283 15.8704 0.0124
NP_440906.1_5 Reverse -283 -290 15.8704 0.0124
NP_440747.1_10 Reverse -279 -291 7.51213 0.00286
NP_440747.1_10 Forward -294 -282 -11.8591 0.161
NP_441486.1_1 Reverse -279 -293 2.94952 0.0718
NP_441486.1_1 Forward -294 -280 -2.55701 0.175
NP_442634.1_4 Forward -293 -279 5.70279 0.0525
NP_441265.1_3 Reverse -276 -290 9.14437 0.149
NP_440057.1_8 Forward -160 -141 13.2741 0.266
NP_442848.1_1 Forward -297 -283 5.60446 0.0815
NP_443018.1_3 Forward -290 -283 14.8871 0.0123
NP_443018.1_3 Reverse -283 -290 14.8871 0.0123
NP_441316.1_7 Forward -293 -278 -0.610089 0.208
NP_440376.1_1 Reverse -282 -291 9.73449 0.0365
NP_440376.1_1 Forward -291 -282 9.63616 0.0385
NP_441857.1_6 Forward -318 -308 18.9579 0.139
NP_440266.1_6 Reverse -230 -249 7.76679 0.27
NP_442687.1_7 Forward -292 -282 17.5813 0.0089
NP_442485.1_3 Forward -302 -283 1.47442 0.227
NP_442485.1_3 Reverse -210 -229 -5.9004 0.296
NP_442946.1_7 Reverse -239 -254 14.0576 0.284
NP_442530.1_2 Reverse -297 -307 12.4681 0.276
NP_441682.1_7 Forward -158 -139 20.944 0.0299
NP_440360.1_2 Reverse -168 -182 14.8476 0.297
NP_442658.1_1 Forward -293 -283 14.8275 0.0188
NP_442658.1_1 Reverse -280 -290 8.73102 0.181
NP_440141.1_8 Forward -37 -18 11.0125 0.208
NP_441855.2_4 Forward -299 -280 21.1883 0.0104
NP_442782.1_2 Reverse -188 -202 2.06454 0.278
NP_442782.1_2 Reverse -210 -224 1.37622 0.281
NP_442205.1_9 Forward -297 -281 3.40179 0.188
NP_441414.1_9 Forward -291 -272 -3.93378 0.143
NP_440800.1_7 Forward -179 -165 10.3243 0.294
NP_441487.1_6 Reverse -274 -293 3.83436 0.254
NP_441958.1_5 Forward -292 -282 19.2529 0.00183
NP_441958.1_5 Reverse -281 -291 2.53664 0.0409
NP_442836.1_10 Forward -318 -308 9.51814 0.274
NP_440995.1_8 Reverse -272 -291 -1.08219 0.297
NP_439990.1_5 Reverse -277 -290 11.1307 0.128
NP_442911.1_2 Reverse -272 -291 12.2908 0.0128
NP_442911.1_2 Forward -301 -282 3.73603 0.042
NP_441099.1_5 Reverse -272 -291 -8.45701 0.194
NP_441099.1_10 Reverse -315 -325 17.1874 0.254
NP_442002.1_9 Forward -292 -285 14.1004 0.074
NP_442438.1_10 Reverse -277 -291 12.0943 0.0412
NP_441000.1_6 Forward -292 -278 -4.32697 0.237
NP_442771.1_1 Forward -293 -275 -4.99573 0.166
NP_442771.1_1 Reverse -280 -298 -5.68405 0.166
NP_440147.1_4 Forward -293 -280 11.3273 0.0326
NP_440147.1_4 Reverse -280 -293 0.314277 0.257
NP_441550.1_8 Forward -293 -283 15.4175 0.0132
NP_441550.1_8 Reverse -280 -290 11.9759 0.0397
NP_441916.1_7 Reverse -282 -292 17.5813 0.00295
NP_441916.1_7 Forward -291 -281 8.23984 0.0476
NP_441041.1_4 Forward -291 -272 -10.227 0.228
NP_441041.1_7 Reverse -279 -291 8.2922 0.139
NP_442396.1_5 Forward -295 -282 9.36073 0.13
NP_440569.1_10 Forward -375 -356 3.29405 0.278
NP_442004.1_6 Reverse -282 -296 13.6676 0.0826
NP_442004.1_6 Forward -291 -277 3.63784 0.235
NP_441725.1_5 Reverse -283 -293 21.0229 0.00533
NP_441725.1_5 Forward -290 -280 -0.0199663 0.223
NP_439966.1_7 Forward -293 -283 9.12434 0.119
NP_439966.1_7 Reverse -280 -290 6.56775 0.177
NP_439966.1_9 Reverse -280 -289 0.884706 0.253
NP_442941.1_3 Reverse -283 -293 11.3864 0.0116
NP_442941.1_3 Forward -290 -280 8.4365 0.0356
NP_440674.1_10 Reverse -205 -218 19.5871 0.229
NP_440289.1_2 Forward -294 -281 3.75586 0.0741
NP_440289.1_2 Reverse -279 -292 -4.01229 0.276
NP_441678.1_9 Reverse -209 -228 0.786102 0.223
NP_441334.1_6 Reverse -379 -398 20.354 0.0617
NP_441334.1_7 Reverse -280 -299 -13.5702 0.217
NP_441644.1_6 Reverse -282 -292 13.3526 0.0203
NP_441644.1_6 Forward -291 -281 7.94438 0.113
NP_442215.1_2 Reverse -280 -296 -7.51295 0.297
NP_440253.1_2 Forward -291 -273 1.10079 0.17
NP_440929.1_8 Reverse -282 -291 9.93116 0.0249
NP_440929.1_8 Forward -291 -282 9.83282 0.0254
NP_440566.1_3 Forward -268 -249 19.2723 0.194
NP_440780.1_1 Reverse -308 -327 7.30471 0.276
NP_442933.1_10 Forward -291 -282 17.601 0.00325
NP_442933.1_10 Reverse -282 -291 17.601 0.00325
NP_440430.1_6 Reverse -219 -237 16.9205 0.228
NP_441751.2_8 Reverse -283 -297 5.70279 0.0416
NP_441751.2_8 Forward -290 -276 4.62115 0.0481
NP_442554.1_8 Reverse -283 -293 14.828 0.0108
NP_442554.1_8 Forward -290 -280 8.4365 0.0744
NP_442554.1_8 Forward -229 -219 2.63497 0.265
NP_441762.1_7 Forward -292 -280 3.77555 0.0676
NP_441762.1_7 Reverse -281 -293 -5.17256 0.191
NP_442142.1_4 Forward -294 -281 4.34528 0.223
NP_442292.1_1 Forward -290 -281 9.53783 0.0183
NP_442292.1_1 Reverse -283 -292 9.53783 0.0183
NP_440045.1_3 Forward -179 -162 12.5261 0.138
NP_442476.1_6 Reverse -283 -297 6.19444 0.13
NP_442476.1_6 Forward -290 -276 1.08123 0.231
NP_443009.1_5 Reverse -281 -292 11.7595 0.0602
NP_443009.1_5 Forward -292 -281 10.0879 0.0818
NP_443009.1_5 Forward -378 -367 3.69644 0.282
NP_441715.1_4 Reverse -283 -293 7.25653 0.108
NP_441715.1_4 Forward -290 -280 6.56821 0.138
NP_440881.1_10 Forward -290 -277 14.8673 0.249
NP_440015.1_9 Reverse -282 -300 9.65558 0.099
NP_441198.1_8 Forward -293 -283 13.076 0.108
NP_441468.1_1 Forward -290 -283 15.8704 0.0124
NP_441468.1_1 Reverse -283 -290 15.8704 0.0124
NP_441020.2_6 Reverse -280 -297 15.8701 0.0349
NP_441673.1_1 Reverse -282 -291 11.1111 0.0121
NP_441673.1_1 Forward -291 -282 11.0128 0.018
NP_441826.1_2 Forward -297 -283 2.5562 0.125
NP_441826.1_2 Reverse -276 -290 -4.7203 0.299
NP_442868.1_6 Forward -293 -283 9.22315 0.0527
NP_442868.1_6 Reverse -280 -290 8.63316 0.0555
NP_441056.1_1 Reverse -282 -301 -8.55534 0.282
NP_442559.1_5 Reverse -210 -229 5.80098 0.296
NP_443058.1_7 Forward -292 -273 3.83436 0.26
NP_442427.1_8 Forward -300 -281 5.99764 0.25
NP_442630.1_5 Reverse -179 -198 14.9458 0.263
NP_440145.1_3 Reverse -272 -291 -2.26216 0.166
NP_442050.1_5 Forward -293 -283 15.8108 0.0091
NP_442050.1_5 Reverse -280 -290 14.7292 0.0195
NP_441114.1_3 Forward -228 -219 7.66954 0.231
NP_442977.1_5 Forward -248 -229 12.8808 0.0855
NP_440558.1_2 Forward -300 -281 -1.86883 0.218
NP_440558.1_2 Reverse -279 -298 -5.99873 0.269
NP_441878.1_6 Forward -292 -282 10.4031 0.0176
NP_441878.1_6 Reverse -220 -230 1.55333 0.0937
NP_441878.1_6 Reverse -281 -291 0.668351 0.139
NP_441036.1_8 Reverse -281 -291 8.04317 0.177
NP_441557.1_5 Forward -291 -282 18.6826 0.0015
NP_441557.1_5 Reverse -282 -291 10.5211 0.00695
NP_441445.1_1 Reverse -273 -292 8.45592 0.121
NP_441445.1_1 Forward -300 -281 4.32602 0.195
NP_441590.1_4 Forward -381 -362 1.6703 0.299
NP_442183.1_1 Reverse -282 -296 9.2427 0.0999
NP_442397.1_9 Reverse -282 -301 3.24438 0.264
NP_441549.1_9 Reverse -278 -296 -6.1757 0.198
NP_442347.1_2 Reverse -174 -183 5.70292 0.226
NP_442347.1_2 Reverse -283 -292 3.34298 0.284
NP_442347.1_2 Forward -290 -281 2.94966 0.292
NP_442645.1_2 Forward -299 -280 -5.70374 0.0728
NP_441037.1_4 Forward -293 -283 9.65667 0.21
NP_441633.1_3 Reverse -280 -293 -4.01229 0.179
NP_440136.1_2 Forward -290 -283 15.9687 0.0123
NP_440136.1_2 Reverse -283 -290 15.9687 0.0123
NP_442998.1_10 Reverse -284 -291 15.5754 0.0102
NP_442998.1_10 Forward -289 -282 5.74231 0.255
NP_440299.1_1 Forward -295 -282 15.85 0.0136
NP_440299.1_1 Reverse -278 -291 14.67 0.0232
NP_441799.1_1 Forward -295 -281 11.5037 0.0575
NP_441799.1_1 Reverse -380 -394 6.58715 0.167
NP_441799.1_1 Reverse -278 -292 5.99717 0.187
NP_441799.1_1 Reverse -217 -231 4.52221 0.247
NP_441007.1_10 Forward -296 -283 1.49425 0.203
NP_440256.1_1 Reverse -279 -298 7.47261 0.0257
NP_441957.1_1 Forward -299 -280 7.7676 0.204
NP_440915.1_6 Reverse -278 -292 16.5192 0.0183
NP_441704.1_8 Forward -302 -283 6.1935 0.262
NP_440748.1_5 Forward -374 -355 -2.16383 0.271
NP_440026.1_8 Forward -64 -46 12.8022 0.223
NP_442386.1_9 Reverse -281 -290 14.8472 0.0287
NP_442386.1_9 Forward -292 -283 6.39082 0.219
NP_441750.1_4 Reverse -278 -297 1.27776 0.286
NP_441340.1_5 Forward -290 -283 15.6737 0.0124
NP_441340.1_5 Reverse -283 -290 15.6737 0.0124
NP_440168.1_9 Forward -39 -20 -0.885524 0.273
NP_442714.1_7 Reverse -283 -302 -1.37718 0.287
NP_440586.1_8 Forward -290 -283 13.2151 0.026
NP_440586.1_8 Reverse -283 -290 13.2151 0.026
NP_442251.1_6 Forward -290 -283 15.2804 0.0124
NP_442251.1_6 Reverse -283 -290 15.2804 0.0124
NP_441262.1_3 Forward -291 -284 14.7888 0.0223
NP_441262.1_3 Reverse -282 -289 13.9038 0.0336
NP_443051.1_1 Forward -292 -283 18.0926 0.00402
NP_443051.1_1 Reverse -281 -290 1.08137 0.123
NP_439937.1_9 Forward -393 -376 -11.2699 0.248
NP_439937.1_9 Forward -378 -361 -13.1381 0.28
NP_439937.1_9 Forward -292 -275 -14.9081 0.287
NP_440439.1_1 Reverse -279 -292 0.805932 0.175
NP_440372.1_2 Forward -290 -283 16.3621 0.0124
NP_440372.1_2 Reverse -283 -290 16.3621 0.0124
NP_440316.1_10 Reverse -220 -230 9.51814 0.235
NP_439977.1_5 Reverse -276 -295 10.1275 0.0879
NP_440139.1_1 Forward -297 -278 12.585 0.0744
NP_442384.1_10 Reverse -282 -295 16.8339 0.00722
NP_442384.1_10 Forward -291 -278 0.510939 0.289
NP_442262.1_10 Forward -290 -283 14.1988 0.0123
NP_442262.1_10 Reverse -283 -290 14.1988 0.0123
NP_441689.1_5 Forward -293 -283 8.63269 0.132
NP_441689.1_5 Reverse -280 -290 8.14104 0.151
NP_440344.1_10 Forward -298 -281 -10.5809 0.185
NP_441965.1_10 Forward -294 -278 2.61514 0.285
NP_440297.1_9 Reverse -283 -293 19.0562 0.0359
NP_440297.1_9 Forward -229 -219 6.46988 0.185
NP_441592.1_4 Forward -244 -225 0.491109 0.23
NP_440894.1_10 Reverse -17 -36 4.12936 0.258
NP_440894.1_10 Reverse -224 -243 2.65439 0.286
YP_680420.1_1 Reverse -280 -299 9.3409 0.244
NP_440999.1_9 Reverse -278 -292 1.37622 0.166
NP_440888.1_2 Forward -291 -277 12.6836 0.0405
NP_440888.1_2 Reverse -282 -296 7.96378 0.175
NP_441543.1_2 Forward -290 -281 13.8644 0.021
NP_441543.1_2 Reverse -283 -292 9.34117 0.0818
NP_442845.1_2 Reverse -276 -290 5.80112 0.224
NP_441551.1_5 Reverse -278 -294 11.2676 0.174
NP_441469.1_8 Forward -292 -283 13.3727 0.073
NP_443064.1_6 Reverse -282 -292 11.0156 0.13
NP_443064.1_6 Forward -291 -281 8.97947 0.254
NP_442578.1_7 Forward -290 -283 14.5921 0.026
NP_442578.1_7 Reverse -283 -290 14.5921 0.026
NP_440710.1_1 Forward -299 -281 -4.11075 0.208
NP_441462.1_2 Forward -291 -281 10.5998 0.0068
NP_441462.1_2 Reverse -282 -292 10.4031 0.011
NP_441621.1_7 Forward -293 -279 -2.85201 0.188
NP_443062.1_6 Reverse -274 -293 0.491109 0.294
NP_440519.1_2 Forward -328 -309 12.8808 0.194
NP_441560.1_10 Forward -299 -280 11.9958 0.159
NP_440516.1_8 Forward -291 -282 9.4395 0.0183
NP_440516.1_8 Reverse -282 -291 7.17789 0.0754
NP_442428.1_5 Forward -290 -283 15.8704 0.0124
NP_442428.1_5 Reverse -283 -290 15.8704 0.0124
NP_440673.1_2 Forward -301 -282 8.43855 0.27
NP_440673.1_3 Forward -289 -282 14.0021 0.0426
NP_440673.1_3 Reverse -284 -291 12.4288 0.0426
NP_441052.1_2 Forward -291 -281 10.1081 0.0295
NP_441052.1_2 Reverse -282 -292 1.94665 0.221
NP_442219.1_8 Reverse -154 -173 8.74691 0.241
NP_442219.1_9 Forward -290 -281 18.486 0.00718
NP_442219.1_9 Reverse -283 -292 8.25953 0.0681
NP_440436.1_4 Forward -290 -281 15.9289 0.00508
NP_440436.1_4 Reverse -283 -292 15.9289 0.00508
NP_441884.1_9 Reverse -209 -228 -23.01 0.284
NP_442577.1_9 Reverse -304 -318 16.6169 0.164
NP_441719.1_4 Forward -290 -283 16.3621 0.0124
NP_441719.1_4 Reverse -283 -290 16.3621 0.0124
NP_441733.1_10 Reverse -279 -292 13.589 0.0916
NP_442694.1_9 Reverse -348 -367 18.879 0.115
NP_442206.1_10 Forward -291 -276 5.68309 0.178
NP_441851.1_10 Forward -292 -282 18.6629 0.0027
NP_441851.1_10 Reverse -281 -291 6.56821 0.161
NP_441668.1_4 Reverse -211 -230 4.32602 0.181
NP_442515.1_1 Reverse -281 -295 4.12949 0.108
NP_441683.1_7 Forward -308 -289 -12.1936 0.284
NP_440940.1_7 Reverse -272 -290 8.86816 0.167
NP_440940.1_7 Forward -301 -283 6.1149 0.225
NP_440432.1_9 Reverse -283 -298 -1.98672 0.167
NP_442843.1_1 Forward -229 -210 -5.9004 0.244
NP_440431.1_3 Forward -378 -359 -3.3438 0.178
NP_442450.1_5 Forward -293 -283 19.1546 0.0103
NP_442168.1_5 Reverse -283 -302 0.982764 0.241
NP_442006.1_2 Reverse -69 -86 -9.00761 0.197
NP_441570.1_1 Reverse -282 -300 -15.1238 0.228
NP_441078.1_4 Reverse -282 -291 9.93116 0.0203
NP_441078.1_4 Forward -291 -282 9.83282 0.0226
NP_442348.1_2 Reverse -220 -229 9.4395 0.28
NP_440526.1_3 Forward -290 -279 8.4163 0.125
NP_440526.1_3 Reverse -283 -294 1.6315 0.267
NP_441432.1_8 Forward -292 -283 8.35786 0.0755
NP_441432.1_8 Reverse -281 -290 7.07956 0.105
NP_442320.1_8 Forward -297 -283 -2.36035 0.0871
NP_441732.1_2 Forward -295 -279 -16.5594 0.174
NP_440760.1_1 Reverse -282 -301 -11.0136 0.0851
NP_440913.1_1 Reverse -280 -298 5.42735 0.241
NP_441072.1_2 Reverse -271 -290 5.80098 0.296
NP_440713.1_4 Reverse -272 -291 2.75272 0.257
NP_442489.1_7 Reverse -282 -291 10.4228 0.0151
NP_442489.1_7 Forward -291 -282 10.3245 0.0193
NP_440559.1_1 Forward -290 -281 17.5026 0.00658
NP_440559.1_1 Reverse -283 -292 17.306 0.00658
NP_441659.2_8 Reverse -282 -292 17.0896 0.00284
NP_441659.2_8 Forward -291 -281 8.53483 0.0412
NP_439956.1_7 Reverse -182 -201 0.884433 0.294
NP_440779.1_5 Reverse -28 -45 -14.0225 0.238
NP_442346.1_5 Forward -292 -282 17.4829 0.00248
NP_442346.1_5 Reverse -281 -291 14.533 0.0127
NP_440545.1_3 Reverse -278 -295 4.6604 0.0679
NP_441856.1_3 Forward -294 -275 4.03102 0.165
NP_440459.1_2 Forward -176 -159 10.6586 0.193
NP_442603.1_7 Forward -291 -277 7.3738 0.208
NP_441948.1_4 Forward -298 -280 -1.65248 0.148
NP_441833.1_4 Forward -290 -283 15.9687 0.0124
NP_441833.1_4 Reverse -283 -290 15.9687 0.0124
NP_440912.1_3 Reverse -257 -276 10.7167 0.254
NP_442162.1_9 Forward -290 -283 16.2637 0.0124
NP_442162.1_9 Reverse -283 -290 16.2637 0.0124
NP_440671.1_4 Forward -297 -283 7.66941 0.21
NP_442199.1_7 Reverse -314 -333 8.75009 0.14
NP_442140.1_3 Forward -290 -280 13.2547 0.0609
NP_442140.1_3 Reverse -283 -293 5.68323 0.198
NP_441813.1_5 Forward -293 -283 16.1063 0.01
NP_441813.1_5 Reverse -280 -290 7.94484 0.0517
NP_440590.1_4 Forward -290 -277 -4.89726 0.269
NP_440567.1_1 Forward -290 -276 11.6026 0.0277
NP_440567.1_1 Reverse -283 -297 8.65272 0.0554
NP_442497.1_10 Reverse -283 -292 19.8626 0.00532
NP_442497.1_10 Forward -290 -281 8.55452 0.0294
NP_440821.1_4 Forward -293 -283 19.8429 0.00399
NP_440821.1_4 Reverse -280 -290 9.22315 0.0334
NP_440927.1_4 Reverse -122 -141 13.1758 0.247
NP_440927.1_4 Reverse -353 -372 12.6841 0.247
NP_441239.1_9 Reverse -280 -292 9.08543 0.115
NP_441239.1_9 Forward -293 -281 7.61046 0.154
NP_441239.1_9 Forward -232 -220 5.05386 0.231
NP_442691.1_2 Reverse -233 -252 3.73603 0.292
NP_441892.1_1 Forward -300 -283 -1.73112 0.212
NP_442643.1_1 Forward -297 -278 -10.9153 0.231
NP_442643.1_5 Forward -248 -229 -5.80207 0.293
NP_440546.1_4 Reverse -282 -292 13.6334 0.0459
NP_440546.1_4 Forward -291 -281 11.6943 0.0748
NP_440462.1_6 Reverse -280 -290 9.61647 0.0429
NP_440462.1_6 Forward -293 -283 7.84651 0.0699
NP_440868.1_4 Reverse -278 -290 6.52882 0.0878
NP_440868.1_4 Forward -295 -283 -0.551008 0.274
NP_441497.1_3 Forward -209 -190 -12.0953 0.296
NP_442787.1_9 Reverse -158 -177 16.9124 0.208
NP_442479.1_9 Forward -175 -156 -8.16202 0.266
NP_441848.1_7 Forward -222 -203 -0.197979 0.235
NP_442039.1_4 Forward -290 -283 15.1821 0.0124
NP_442039.1_4 Reverse -283 -290 15.1821 0.0124
NP_442039.1_7 Forward -206 -196 7.25653 0.277
NP_441811.1_1 Forward -38 -19 5.01433 0.28
NP_441811.1_8 Forward -297 -283 14.1593 0.175
NP_440825.1_6 Reverse -155 -174 7.7676 0.285
NP_440825.1_7 Forward -290 -280 12.5193 0.155
NP_442837.1_3 Forward -290 -283 15.7721 0.0124
NP_442837.1_3 Reverse -283 -290 15.7721 0.0124
NP_440160.1_2 Forward -204 -185 -2.55715 0.245
NP_439994.1_3 Forward -292 -273 12.3406 0.153
NP_442053.1_1 Forward -291 -282 9.24284 0.068
NP_442053.1_1 Reverse -282 -291 8.94785 0.07
NP_440505.1_3 Forward -293 -283 7.55152 0.151
NP_440505.1_3 Reverse -280 -290 6.8632 0.169
NP_440505.1_7 Forward -243 -224 2.16274 0.237
NP_441203.1_1 Reverse -283 -302 -13.5702 0.168
NP_442255.1_3 Forward -247 -228 7.66927 0.299
NP_440914.1_1 Forward -291 -281 8.51751 0.186
NP_440914.1_1 Reverse -282 -292 7.24882 0.242
NP_440914.1_1 Reverse -242 -252 6.66328 0.269
NP_441011.1_8 Reverse -283 -292 14.356 0.0249
NP_441011.1_8 Forward -290 -281 9.53783 0.123
NP_442533.1_6 Forward -291 -282 15.1427 0.00675
NP_442533.1_6 Reverse -282 -291 7.47288 0.0898
NP_442533.1_6 Forward -244 -235 1.96635 0.28
NP_442533.1_6 Forward -229 -220 1.37636 0.3
NP_441219.1_6 Forward -168 -150 10.4422 0.252
NP_441482.1_7 Forward -297 -283 17.4042 0.0059
NP_439944.1_9 Forward -290 -280 17.4829 0.00423
NP_439944.1_9 Reverse -283 -293 17.3846 0.00516
NP_440115.1_6 Reverse -279 -289 17.6796 0.022
NP_440007.1_9 Forward -295 -281 0.982901 0.29
NP_441961.1_4 Forward -299 -280 3.24438 0.281
NP_441106.1_1 Forward -292 -283 9.73449 0.0311
NP_441106.1_1 Reverse -281 -290 8.75118 0.0469
NP_441106.1_7 Forward -34 -15 12.7816 0.208
NP_441420.1_2 Reverse -20 -39 11.6025 0.268
NP_439903.1_6 Reverse -279 -298 7.17681 0.163
NP_441286.1_1 Reverse -281 -293 14.7886 0.00418
NP_441286.1_1 Forward -292 -280 2.98891 0.051
NP_440670.1_8 Forward -291 -282 8.94785 0.0606
NP_440670.1_8 Reverse -282 -291 8.84951 0.0606
NP_441930.1_3 Forward -269 -250 13.6331 0.191
NP_442614.1_2 Forward -291 -277 15.5359 0.0773
NP_439995.1_5 Reverse -272 -291 4.42435 0.285
NP_442072.1_9 Forward -292 -274 -10.9939 0.0789
NP_440907.2_8 Reverse -283 -293 9.81266 0.103
NP_440907.2_8 Forward -290 -280 8.04271 0.117
NP_440326.1_5 Reverse -280 -293 13.6873 0.229
NP_441463.1_3 Reverse -272 -291 -9.83364 0.286
NP_441626.1_2 Forward -290 -283 15.7721 0.0124
NP_441626.1_2 Reverse -283 -290 15.7721 0.0124
NP_442615.1_1 Reverse -273 -291 4.83737 0.0426
NP_440387.1_1 Forward -291 -275 3.69678 0.0533
NP_440387.1_1 Reverse -282 -298 -3.77637 0.167
NP_441431.1_2 Forward -233 -219 6.48882 0.269
NP_442020.1_1 Forward -95 -76 -1.77127 0.299
NP_440114.1_10 Reverse -282 -296 14.5526 0.0382
NP_440324.1_2 Reverse -305 -324 16.3215 0.152
NP_439910.1_2 Reverse -274 -291 -12.1542 0.0788
NP_440457.1_1 Forward -295 -283 19.4102 0.0344
NP_440457.1_1 Reverse -278 -290 -0.354346 0.262
NP_442509.1_9 Reverse -282 -292 7.84605 0.2
NP_440554.1_4 Forward -290 -280 8.4365 0.0749
NP_440554.1_4 Reverse -283 -293 6.96153 0.107
NP_442862.1_3 Forward -327 -310 8.7903 0.236
NP_441885.1_5 Forward -291 -281 19.6462 0.00179
NP_441885.1_5 Reverse -282 -292 1.65166 0.106
NP_442341.1_9 Forward -232 -218 5.70218 0.258
NP_443000.1_7 Reverse -280 -290 9.7148 0.0437
NP_443000.1_7 Forward -293 -283 8.82982 0.0437
NP_440275.1_3 Forward -293 -283 10.0098 0.0454
NP_440275.1_3 Reverse -280 -290 9.12481 0.055
NP_440091.1_1 Reverse -278 -290 13.117 0.0313
NP_440091.1_1 Forward -295 -283 1.51394 0.197
NP_441902.1_3 Reverse -362 -372 12.2043 0.259
NP_442451.1_2 Forward -299 -280 -7.76869 0.239
NP_441122.1_1 Forward -248 -233 4.20813 0.28
NP_440149.1_8 Reverse -282 -301 9.93088 0.0507
NP_440216.1_1 Reverse -282 -296 -3.147 0.0729
NP_440216.1_1 Forward -291 -277 -11.0135 0.159
NP_440678.1_7 Forward -379 -360 17.0107 0.264
NP_440172.1_1 Forward -291 -281 17.2863 0.00544
NP_440172.1_1 Reverse -282 -292 6.56821 0.102
NP_441226.1_7 Forward -290 -283 14.4934 0.0123
NP_441226.1_7 Reverse -283 -290 14.4934 0.0123
NP_441111.1_7 Reverse -283 -291 18.7023 0.00294
NP_441111.1_7 Forward -290 -282 8.86921 0.0589
NP_442379.1_10 Reverse -275 -292 20.3934 0.0176
NP_441766.1_2 Forward -291 -282 17.896 0.00297
NP_441766.1_2 Reverse -282 -291 9.4395 0.0285
NP_440261.1_5 Forward -290 -277 -3.4223 0.132
NP_440261.1_5 Reverse -283 -296 -10.2071 0.201
NP_440261.1_5 Forward -229 -216 -12.0754 0.27
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

GTTTCTTCGCGAATTGTCACACAAAGCATTGCTGACCAAATTGCTAATAGTCAGCAACAGGTATTTATGCGTCAAGATTTTGAGGATTTGGGTAATTATGAGCAGGTAGGGCGATCGCTACGCAGTTTAATACAACAAAATCAGCTAATTCGGATTGGCCAGGGTTTATACGCCAAGGCCCAGATTTCTCCTCTCAGTGGCAAACCAGTTCCCAGACTTGGTATCAAAGAATTGGCCAAAGAGGCCCTACAACGTCTTGAGGTGGAAACATTTCCTTCGAGCTATGAAAAGCAGTACAACGACGGAAAAACGACTCAAGTTCCCACTGGTCGTGTAATTGGTGTTAAGGGAAGAGTACAAAGGCGCATTGGTTACAACGGCAAATACGTTAAGTTTGAGC

CDS

ATGTCTAGCACCCTGGCAATCACAGAAATTATCCAGGCGATCGCCGCTGAGTTCGTTGTTGATGAATGCTTTATCGAGAAAGACTGGTACGCCATGCGGATTATTGGAGTATTGAGCCAAATTCAAGATCCCACATTTCAATTAGTCTTTTCTGGGGGAACCAGTCTTTCTAAGGGCTTTGGTTTAATTCAACGTTTTTCTGAAGATCTGGATTTTAAGGTTAAAATCATCAACAATCACCCGCCTTCTAAAAATCGGCAACAAAAACAAAGAAAAGCTTTTCGGGACAAGATTTTAGAAAATCTAGAACAATATCAAACAGATTGGCAAGTAGATCTAAATGCTTTACAGAAGGGGAATGAATCAAAATTTTTTAAAGTCCCAATTCGCTATCAGCCCCTTTTTCAGGTGTCTAATTCCCTACGTCCCCATGTACAGTTGGAAGTCACATTTGAATCTCCCGCACTGGAGCCAGAGCTAAAAGATCTTCAGTCCTTTGTCGGAAAAGCTCTCAAACAACAACCAGAGGCAATTAACTTCCCCTGTGTTAATCCAATTGAAACAGCAGCAGATAAGCTCAGTGCTTTGGTCTGGCGGATTTAA

Protein

No sequence available