Your browser is old and dusty. Try Google Chrome!

Details for slr5078

ORF slr5078
Accession NP_942234.1
Symbol
Category
Definition
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_442272.1_2 Forward -296 -277 12.6523 0.217
NP_441453.1_4 Forward -76 -68 7.09925 0.0962
NP_441453.1_4 Reverse -350 -358 4.73931 0.252
NP_442151.1_6 Reverse -67 -81 10.6193 0.119
NP_442328.1_9 Reverse -235 -254 6.58763 0.229
NP_441818.1_1 Reverse -68 -79 12.2512 0.135
NP_440226.1_1 Forward -76 -57 4.916 0.174
NP_442169.1_1 Forward -253 -234 -0.197208 0.261
NP_442173.1_1 Forward -75 -67 11.6225 0.04
NP_442173.1_1 Reverse -68 -76 5.72262 0.203
NP_442752.1_4 Reverse -350 -357 5.54565 0.194
NP_442975.1_10 Forward -363 -349 7.76712 0.119
NP_440784.1_7 Reverse -68 -75 6.3323 0.228
NP_440784.1_7 Forward -75 -68 6.13563 0.241
NP_440110.1_4 Forward -87 -68 5.11266 0.173
NP_442062.1_8 Forward -76 -66 7.94484 0.0848
NP_442062.1_8 Reverse -350 -360 6.17489 0.136
NP_441859.1_3 Forward -25 -6 1.96529 0.269
NP_440304.1_4 Forward -78 -68 9.02648 0.0637
NP_442242.1_4 Forward -75 -68 11.8388 0.0776
NP_442097.1_2 Forward -239 -220 1.57275 0.259
NP_441352.1_2 Forward -28 -9 8.06259 0.162
NP_441925.1_2 Forward -172 -153 0.687771 0.288
NP_441083.1_5 Reverse -67 -77 1.25834 0.213
NP_441434.1_3 Forward -242 -223 12.1925 0.0969
NP_441738.1_2 Reverse -69 -76 13.8051 0.0221
NP_440209.1_1 Forward -76 -68 8.27922 0.0687
NP_441783.1_1 Forward -193 -175 13.5888 0.288
NP_440659.1_9 Reverse -35 -54 16.0274 0.133
NP_441792.1_5 Reverse -85 -101 11.7599 0.19
NP_442111.1_4 Forward -77 -63 7.07942 0.105
NP_440906.1_5 Reverse -351 -358 8.79057 0.149
NP_440906.1_5 Forward -75 -68 6.13563 0.241
NP_440906.1_5 Reverse -68 -75 6.13563 0.241
NP_440747.1_10 Reverse -64 -76 -4.28759 0.0903
NP_440747.1_10 Forward -79 -67 -12.1541 0.227
NP_442608.1_2 Forward -235 -217 16.2356 0.247
NP_442848.1_1 Forward -122 -108 -0.983719 0.263
NP_442848.1_1 Forward -82 -68 -1.27871 0.263
NP_443018.1_3 Forward -75 -68 12.0355 0.0639
NP_443018.1_3 Reverse -68 -75 5.64398 0.181
NP_441316.1_7 Forward -78 -63 -3.36336 0.273
NP_440376.1_1 Forward -76 -67 6.29291 0.104
NP_440376.1_1 Reverse -350 -359 5.3096 0.137
NP_440376.1_1 Reverse -67 -76 -0.0986038 0.285
NP_442687.1_7 Forward -154 -144 4.60159 0.243
NP_440642.1_10 Reverse -228 -242 2.45727 0.277
NP_441950.1_7 Forward -102 -83 2.85105 0.175
NP_442658.1_1 Reverse -65 -75 9.616 0.147
NP_442658.1_9 Forward -376 -357 11.0125 0.294
NP_440141.1_8 Forward -125 -106 5.60432 0.273
NP_440141.1_8 Forward -247 -228 5.50599 0.273
NP_442782.1_2 Reverse -386 -400 0.491246 0.289
NP_442937.1_5 Reverse -176 -195 6.88262 0.268
NP_441958.1_5 Reverse -66 -76 1.65166 0.0872
NP_441958.1_5 Forward -77 -67 -6.70647 0.287
NP_441127.1_1 Reverse -181 -195 11.6026 0.217
NP_442025.1_4 Forward -296 -277 10.3242 0.291
NP_439905.1_1 Forward -393 -380 7.88576 0.241
NP_439990.1_5 Forward -81 -68 19.5871 0.00712
NP_439990.1_5 Reverse -345 -358 7.98409 0.183
NP_442690.1_1 Reverse -53 -72 -15.2418 0.28
NP_442911.1_2 Forward -126 -107 1.37609 0.0593
NP_442911.1_2 Reverse -57 -76 -9.53865 0.258
NP_440993.1_3 Reverse -233 -252 -0.197979 0.261
NP_440993.1_4 Forward -400 -383 3.77542 0.281
NP_441099.1_10 Reverse -324 -334 18.1707 0.2
NP_442002.1_9 Forward -253 -246 12.2322 0.185
NP_440809.1_9 Reverse -58 -76 1.59244 0.121
NP_440475.1_10 Reverse -118 -137 19.2723 0.207
NP_441294.1_7 Reverse -63 -77 8.57871 0.294
NP_441646.1_1 Forward -123 -104 5.211 0.182
NP_441646.1_1 Forward -366 -347 -1.18052 0.28
NP_442438.1_10 Forward -121 -107 -0.787057 0.279
NP_441000.1_5 Forward -197 -178 8.94676 0.229
NP_440484.1_3 Reverse -348 -362 18.6825 0.134
NP_440147.1_4 Reverse -10 -23 1.88757 0.216
NP_440147.1_4 Reverse -65 -78 0.904263 0.244
NP_440147.1_4 Forward -361 -348 -0.767364 0.299
NP_441041.1_4 Forward -82 -63 -11.2103 0.242
NP_441041.1_7 Reverse -64 -76 8.68091 0.133
NP_440569.1_10 Reverse -274 -293 4.43995 0.257
NP_441547.1_2 Reverse -209 -227 3.16574 0.289
NP_441725.1_5 Reverse -68 -78 1.74999 0.125
NP_441725.1_5 Forward -75 -65 -0.904945 0.274
NP_439966.1_7 Forward -78 -68 5.97777 0.199
NP_442941.1_3 Reverse -68 -78 10.2065 0.0213
NP_442941.1_3 Forward -358 -348 -0.118297 0.249
NP_442012.1_2 Forward -78 -59 5.99764 0.211
NP_440723.1_4 Forward -119 -100 -1.96717 0.234
NP_441644.1_6 Forward -76 -66 12.6642 0.0302
NP_442215.1_5 Reverse -91 -110 13.6675 0.276
NP_442247.1_8 Reverse -300 -314 8.06273 0.286
NP_440253.1_2 Reverse -67 -85 5.42735 0.0933
NP_440929.1_8 Reverse -67 -76 7.66954 0.0624
NP_440929.1_8 Forward -76 -67 7.57121 0.0706
NP_442933.1_6 Reverse -322 -341 14.5621 0.284
NP_442554.1_8 Reverse -68 -78 6.76487 0.107
NP_442554.1_8 Forward -115 -105 5.19158 0.157
NP_442554.1_8 Forward -75 -65 3.81494 0.209
NP_442142.1_4 Reverse -12 -25 2.28034 0.295
NP_442292.1_1 Reverse -68 -77 8.94785 0.0261
NP_442292.1_1 Forward -75 -66 7.07956 0.0825
NP_440919.1_7 Reverse -233 -251 5.83656 0.285
NP_441523.1_6 Forward -280 -261 7.57094 0.194
NP_443009.1_5 Forward -77 -66 9.3996 0.0965
NP_443009.1_5 Reverse -349 -360 7.03967 0.141
NP_441715.1_4 Reverse -68 -78 5.09324 0.233
NP_441198.1_8 Reverse -65 -75 11.7088 0.189
NP_441198.1_8 Forward -313 -303 11.0251 0.228
NP_441468.1_1 Forward -75 -68 6.3323 0.202
NP_441468.1_1 Reverse -68 -75 6.13563 0.209
NP_441673.1_1 Forward -76 -67 1.27803 0.155
NP_441673.1_1 Reverse -67 -76 1.27803 0.155
NP_441826.1_2 Reverse -101 -115 10.6193 0.0463
NP_441826.1_2 Forward -82 -68 1.96621 0.137
NP_442868.1_6 Forward -78 -68 0.0783647 0.248
NP_442427.1_8 Forward -248 -229 10.1275 0.168
NP_442542.1_10 Forward -393 -379 18.5841 0.219
NP_442050.1_5 Forward -78 -68 6.66608 0.286
NP_440558.1_2 Reverse -246 -265 -7.27704 0.291
NP_441518.1_3 Forward -194 -175 -15.2418 0.288
NP_441878.1_6 Forward -77 -67 -7.59145 0.245
NP_441557.1_5 Reverse -67 -76 7.66954 0.0443
NP_441557.1_5 Forward -76 -67 0.983037 0.0911
NP_441445.1_1 Forward -119 -100 1.0811 0.262
NP_441590.1_4 Reverse -85 -104 5.80018 0.268
NP_441116.1_10 Reverse -276 -295 7.7676 0.257
NP_440276.1_8 Reverse -241 -260 10.4225 0.232
NP_441549.1_9 Reverse -382 -400 -10.1089 0.269
NP_442645.1_2 Forward -207 -188 -14.5535 0.175
NP_442645.1_2 Forward -84 -65 -16.9135 0.245
NP_442965.1_2 Forward -281 -262 -8.752 0.294
NP_441037.1_4 Forward -361 -351 7.12278 0.237
NP_442594.1_8 Forward -94 -75 6.4893 0.231
NP_442594.1_10 Reverse -258 -277 8.75009 0.28
NP_441633.1_3 Reverse -65 -78 -5.19226 0.229
NP_440136.1_2 Forward -75 -68 13.4121 0.0388
NP_440136.1_2 Reverse -68 -75 6.23397 0.171
NP_440136.1_2 Reverse -351 -358 4.26735 0.218
NP_442998.1_5 Reverse -52 -62 7.25653 0.298
NP_442998.1_10 Reverse -69 -76 6.23397 0.157
NP_440299.1_1 Forward -80 -67 4.54195 0.207
NP_441799.1_1 Reverse -63 -77 7.57046 0.138
NP_440256.1_1 Forward -113 -94 -1.18052 0.101
NP_440709.1_1 Forward -71 -52 5.30853 0.173
NP_441559.1_8 Reverse -62 -76 -0.787057 0.18
NP_441559.1_8 Reverse -262 -276 -5.9986 0.271
NP_441559.1_8 Reverse -345 -359 -7.47356 0.294
NP_441704.1_8 Reverse -170 -189 8.35677 0.208
NP_441704.1_8 Forward -87 -68 7.07848 0.249
NP_441464.1_10 Forward -104 -90 9.04604 0.265
NP_440306.1_8 Forward -153 -134 -3.63955 0.293
NP_441340.1_5 Reverse -68 -75 6.23397 0.132
NP_441340.1_5 Forward -75 -68 6.13563 0.175
NP_441248.1_10 Forward -213 -203 17.4139 0.189
NP_440161.1_3 Forward -78 -59 8.16093 0.276
NP_442714.1_7 Forward -238 -219 -0.000545616 0.248
NP_440586.1_8 Reverse -13 -20 7.51192 0.239
NP_442251.1_6 Forward -75 -68 11.9372 0.0749
NP_441262.1_3 Forward -76 -69 11.5438 0.0584
NP_441262.1_3 Reverse -67 -74 5.15232 0.265
NP_443051.1_1 Reverse -66 -75 7.76787 0.0541
NP_443051.1_1 Forward -77 -68 0.589713 0.143
NP_443051.1_1 Reverse -349 -358 0.0980582 0.226
NP_440451.1_10 Forward -115 -96 10.4217 0.264
NP_439937.1_9 Forward -77 -60 -16.973 0.291
NP_439943.1_7 Forward -81 -62 4.32602 0.278
NP_440372.1_2 Reverse -68 -75 6.62729 0.151
NP_440372.1_2 Forward -75 -68 6.52896 0.188
NP_442488.1_7 Forward -192 -173 24.4839 0.00636
NP_439977.1_5 Reverse -61 -80 3.44104 0.159
NP_439977.1_8 Forward -161 -142 16.2791 0.205
NP_440267.1_2 Reverse -139 -153 7.27547 0.202
NP_441018.1_7 Reverse -186 -205 9.14423 0.233
NP_441018.1_7 Forward -104 -85 7.27595 0.273
NP_441018.1_7 Reverse -381 -400 6.78429 0.282
NP_442262.1_2 Forward -24 -5 15.3417 0.247
NP_442262.1_10 Forward -75 -68 12.4288 0.0538
NP_441689.1_5 Forward -78 -68 5.48612 0.251
NP_440163.1_10 Forward -113 -103 10.9931 0.18
NP_440163.1_10 Forward -79 -69 10.6981 0.198
NP_442123.1_3 Forward -94 -75 11.7992 0.22
NP_441335.1_8 Reverse -179 -198 7.07928 0.281
NP_440297.1_9 Reverse -68 -78 0.865012 0.282
NP_442280.1_10 Reverse -240 -258 7.49983 0.268
NP_441896.1_3 Forward -85 -66 0.0977854 0.23
NP_441896.1_5 Forward -93 -86 15.3787 0.268
NP_441103.1_9 Reverse -269 -279 12.2942 0.299
NP_440894.1_7 Forward -377 -358 8.35677 0.277
NP_440834.1_2 Reverse -263 -282 12.29 0.275
NP_440999.1_2 Forward -251 -232 14.2574 0.165
NP_440999.1_2 Forward -263 -244 8.16093 0.296
NP_441771.1_4 Forward -204 -185 -0.590531 0.292
NP_441543.1_2 Reverse -68 -77 7.86621 0.107
NP_441543.1_2 Forward -358 -349 4.71961 0.222
NP_441304.1_10 Forward -242 -233 14.7494 0.164
NP_441469.1_8 Forward -360 -351 7.17789 0.227
NP_440148.1_1 Forward -213 -194 -5.9004 0.24
NP_441462.1_2 Forward -76 -66 1.55333 0.0864
NP_443062.1_1 Forward -76 -58 5.81572 0.218
NP_441423.1_5 Forward -144 -131 18.5049 0.18
NP_440255.1_9 Forward -290 -271 16.5674 0.219
NP_440516.1_8 Forward -76 -67 -0.295266 0.232
NP_442428.1_5 Forward -75 -68 6.43063 0.148
NP_442428.1_5 Reverse -68 -75 6.13563 0.209
NP_441443.1_1 Forward -282 -263 -4.91709 0.297
NP_440673.1_3 Reverse -17 -24 8.29892 0.221
NP_441052.1_2 Reverse -67 -77 1.94665 0.221
NP_442219.1_9 Reverse -68 -77 8.06287 0.0696
NP_440436.1_4 Reverse -68 -77 7.66912 0.124
NP_442864.1_7 Forward -258 -240 13.2938 0.213
NP_440314.1_9 Reverse -68 -87 -7.4737 0.24
NP_440041.1_2 Forward -101 -82 -6.58872 0.296
NP_441719.1_4 Reverse -68 -75 6.62729 0.151
NP_441719.1_4 Forward -75 -68 6.52896 0.188
NP_441115.1_4 Forward -25 -7 8.3765 0.25
NP_442694.1_9 Reverse -173 -192 9.93088 0.24
NP_441851.1_10 Forward -77 -67 13.943 0.0256
NP_441195.1_1 Forward -223 -204 -2.45882 0.237
NP_441668.1_4 Forward -119 -100 -1.86883 0.283
NP_442515.1_1 Reverse -135 -149 -1.8687 0.266
NP_441046.1_2 Forward -26 -7 0.884433 0.262
NP_442843.1_1 Forward -198 -179 -10.522 0.278
NP_440396.1_10 Reverse -182 -198 12.8408 0.153
NP_440431.1_3 Forward -77 -58 -10.4236 0.275
NP_440431.1_3 Forward -305 -286 -12.1936 0.296
NP_440195.1_5 Forward -245 -226 5.99764 0.225
NP_441078.1_4 Forward -359 -350 5.70292 0.111
NP_441078.1_4 Reverse -67 -76 0.589713 0.174
NP_441078.1_4 Forward -76 -67 0.589713 0.174
NP_442729.1_8 Forward -80 -67 5.23083 0.257
NP_441539.1_1 Reverse -52 -66 21.8284 0.0585
NP_441432.1_8 Reverse -66 -75 7.96454 0.0953
NP_441432.1_8 Forward -77 -68 7.17789 0.102
NP_442320.1_8 Forward -27 -13 -3.63866 0.126
NP_442320.1_8 Forward -82 -68 -4.81863 0.188
NP_442344.1_7 Reverse -351 -370 -6.68705 0.172
NP_442344.1_7 Forward -198 -179 -9.83364 0.27
NP_442003.1_9 Forward -266 -247 6.09597 0.235
NP_440760.1_7 Forward -368 -349 5.40686 0.211
NP_440760.1_7 Reverse -223 -242 4.71854 0.224
NP_442400.1_10 Forward -290 -277 7.12818 0.298
NP_442489.1_7 Forward -76 -67 7.86621 0.0448
NP_442489.1_7 Reverse -67 -76 0.589713 0.17
NP_440386.1_3 Forward -291 -272 -4.6221 0.221
NP_442079.1_7 Reverse -68 -87 0.687771 0.275
NP_440559.1_1 Reverse -68 -77 14.1594 0.0317
NP_441659.2_8 Forward -76 -66 7.74818 0.0566
NP_442749.1_5 Reverse -182 -199 9.09135 0.22
NP_441800.1_7 Reverse -92 -110 -1.94747 0.256
NP_442346.1_5 Forward -77 -67 6.27322 0.208
NP_440545.1_3 Reverse -63 -80 -6.05768 0.268
NP_440831.1_1 Forward -310 -291 13.2741 0.261
NP_442027.1_5 Forward -108 -89 14.6508 0.12
NP_440847.1_3 Reverse -109 -123 11.012 0.275
NP_442732.1_1 Forward -139 -122 18.5251 0.162
NP_441833.1_4 Reverse -68 -75 6.23397 0.163
NP_441833.1_4 Forward -75 -68 6.13563 0.198
NP_442162.1_9 Forward -75 -68 12.6255 0.0393
NP_442162.1_9 Reverse -68 -75 6.52896 0.178
NP_440671.1_4 Forward -82 -68 9.2427 0.184
NP_441973.1_1 Reverse -247 -262 0.766545 0.235
NP_442943.1_1 Forward -188 -173 11.9104 0.166
NP_442199.1_5 Forward -29 -10 5.40766 0.096
NP_442140.1_3 Reverse -351 -361 3.91327 0.271
NP_441813.1_5 Forward -78 -68 6.07655 0.104
NP_440590.1_4 Reverse -68 -81 3.06754 0.0772
NP_442497.1_10 Forward -75 -66 5.89959 0.109
NP_442497.1_10 Reverse -68 -77 0.688044 0.141
NP_440821.1_4 Forward -78 -68 8.4365 0.0503
NP_441239.1_9 Reverse -65 -77 9.28209 0.11
NP_442772.1_4 Reverse -170 -189 1.86774 0.217
NP_442482.1_1 Forward -400 -381 16.0265 0.133
NP_440900.1_6 Forward -97 -78 21.1913 0.102
NP_440551.1_9 Forward -315 -296 19.6656 0.0609
NP_440675.1_1 Reverse -376 -395 4.42435 0.235
NP_440462.1_6 Reverse -348 -358 7.25653 0.0838
NP_441474.1_1 Reverse -91 -110 4.52188 0.221
NP_442402.1_1 Reverse -200 -219 9.73422 0.268
NP_442402.1_4 Reverse -200 -219 -5.99948 0.249
NP_442402.1_4 Reverse -124 -143 -10.326 0.299
NP_440696.1_3 Forward -86 -68 0.707465 0.228
NP_442039.1_4 Forward -75 -68 14.3954 0.0271
NP_442039.1_10 Reverse -236 -254 14.473 0.227
NP_441811.1_8 Forward -82 -68 10.4227 0.219
NP_442679.1_1 Forward -254 -235 -0.983855 0.226
NP_442409.1_10 Reverse -269 -283 14.2569 0.293
NP_442837.1_3 Reverse -68 -75 6.0373 0.25
NP_442837.1_3 Forward -75 -68 5.93897 0.265
NP_440505.1_3 Reverse -348 -358 14.9263 0.0157
NP_440505.1_3 Forward -78 -68 13.2547 0.0351
NP_440351.1_3 Forward -183 -164 15.9291 0.201
NP_442456.1_5 Forward -286 -268 6.01734 0.283
NP_441252.1_6 Reverse -187 -194 11.6422 0.288
NP_441203.1_1 Reverse -68 -87 -12.4886 0.143
NP_440914.1_1 Reverse -67 -77 6.56569 0.273
NP_441011.1_8 Forward -358 -349 10.3245 0.108
NP_442541.1_10 Reverse -107 -121 8.06211 0.225
NP_441482.1_7 Forward -82 -68 -1.5737 0.0755
NP_441482.1_7 Reverse -344 -358 -4.91696 0.162
NP_439944.1_9 Reverse -68 -78 9.51814 0.1
NP_441697.1_5 Forward -180 -161 -6.92359 0.239
NP_441028.1_6 Reverse -268 -278 5.38779 0.255
NP_441028.1_6 Reverse -236 -246 3.71617 0.281
NP_442202.1_6 Forward -238 -219 -0.4922 0.265
NP_442664.1_4 Forward -287 -273 23.4024 0.0231
NP_440116.1_8 Reverse -68 -87 -3.63879 0.157
NP_440007.1_9 Forward -80 -66 3.24451 0.272
NP_440608.1_6 Reverse -68 -87 7.17681 0.238
NP_441602.1_3 Reverse -380 -399 -0.295539 0.224
NP_441972.1_5 Forward -115 -96 -7.37537 0.248
NP_441286.1_1 Reverse -66 -78 0.923956 0.102
NP_440670.1_8 Forward -76 -67 13.0777 0.0183
NP_440670.1_8 Reverse -67 -76 5.40793 0.158
NP_441479.1_1 Forward -29 -10 8.55425 0.247
NP_440886.1_7 Forward -360 -350 5.68278 0.168
NP_442382.1_7 Reverse -83 -102 5.11266 0.252
NP_440907.2_8 Forward -358 -348 5.38779 0.203
NP_440907.2_8 Forward -75 -65 4.20782 0.273
NP_442264.1_2 Forward -86 -69 4.56207 0.298
NP_440326.1_9 Forward -378 -359 12.585 0.274
NP_441626.1_2 Forward -75 -68 6.43063 0.147
NP_441626.1_2 Reverse -68 -75 6.0373 0.212
NP_442794.1_1 Forward -80 -68 7.21714 0.144
NP_442615.1_1 Reverse -58 -76 8.37728 0.0284
NP_441962.1_4 Reverse -102 -121 -10.817 0.232
NP_441962.1_4 Reverse -176 -195 -11.0136 0.236
NP_441962.1_4 Forward -204 -185 -14.3569 0.286
NP_440387.1_1 Reverse -350 -366 -3.48138 0.16
NP_440387.1_1 Reverse -67 -83 -5.84132 0.254
NP_441836.1_1 Reverse -170 -189 15.4927 0.147
NP_441193.1_1 Reverse -83 -102 9.83173 0.277
NP_441993.1_1 Forward -116 -97 18.9043 0.0369
NP_442352.1_1 Reverse -379 -392 15.8513 0.215
NP_440082.1_5 Reverse -306 -325 15.4197 0.256
NP_440814.1_8 Forward -276 -257 6.58763 0.269
NP_440814.1_8 Forward -244 -225 -0.197208 0.277
NP_440467.1_3 Forward -75 -56 13.0141 0.214
NP_442698.1_10 Forward -283 -264 0.786102 0.297
NP_442323.1_7 Reverse -238 -257 2.06362 0.273
NP_441720.1_2 Reverse -103 -122 2.06362 0.282
NP_441720.1_4 Reverse -86 -105 19.7631 0.268
NP_441272.1_7 Forward -375 -365 15.6147 0.2
NP_440798.1_6 Forward -75 -62 0.117615 0.285
NP_441332.1_4 Reverse -43 -62 3.44104 0.298
NP_441885.1_5 Reverse -67 -77 1.94665 0.0935
NP_442703.1_4 Reverse -77 -96 1.27698 0.284
NP_443000.1_7 Forward -78 -68 7.25653 0.0927
NP_443000.1_7 Reverse -348 -358 1.06167 0.274
NP_440091.1_1 Forward -25 -13 1.02229 0.218
NP_440175.1_7 Reverse -381 -399 12.0957 0.228
NP_440804.1_4 Forward -213 -204 16.716 0.145
NP_440149.1_8 Reverse -67 -86 -1.86883 0.162
NP_441105.1_3 Reverse -244 -263 -9.047 0.283
NP_441105.1_3 Reverse -56 -75 -9.93197 0.298
NP_440172.1_1 Forward -76 -66 7.94484 0.0705
NP_440172.1_1 Reverse -67 -77 1.94665 0.29
NP_440249.1_2 Reverse -280 -290 15.3192 0.268
NP_442015.1_10 Forward -353 -340 -0.865694 0.285
NP_441226.1_7 Reverse -68 -75 5.64364 0.286
NP_441111.1_7 Reverse -68 -76 8.96754 0.0463
NP_441766.1_2 Reverse -67 -76 6.48957 0.096
NP_442154.1_1 Forward -101 -83 -10.8956 0.211
NP_442564.1_9 Reverse -107 -121 16.0549 0.227
NP_440988.1_10 Reverse -105 -119 10.8044 0.187
NP_440988.1_10 Forward -78 -64 3.83388 0.277
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

GGCAAATCTCATGGCAGCAACTTCAGTTTTTGGAGGAATTCTGCTATCCCCTGAGATTATCAAAACGATTTTAAGGAGTGAAATCATGAAGGAATCCGCTGTCTATCAAGAAATTTTAGAGGAAGGGGAACAACGAGGCATACTCAAGGGCAAACTGGAGGGGAAATTGGAAACCATACCCCTGTTGAAAAAATTAGGTCTTACAATTGCCGAAATTGCCAAAGAATTAGATATTGATGTTGAACTGGTTAATCGGTTTGTTGCTAACCAGAACAATTAAGGGTTGAAATGGCCACTGGTTGGTGTGTGGTTTGGTGGATCTATGGCGATTGCATAGCAAATCTTTACAAGATCTCCTATTCTAAACATTAATTGAAGCAATGATGGCTGAAAAGTCTTG

CDS

ATGAAATTTTCCTTTCCTTGGCACTGGGGTAAATCCCATAAATTAAAGCCAGTAACTCATCCAATTCGGCATCTGCGTCCGATTCAGTCAGGGGATTCCAGGCAAAAAAAAATCCAACCAATGGTGACAGATTTATATCATTGGTTATTGGTGCTTTCCTGGCCAAAATTTTTAGCGACTATCGGGATTTTTTATTTCAGTTTAAATGTTTTTTTTGCCTTAATTTTTTCCTTAACTGGTGATAGTATTGCTAATGCCAAACCAGGATCATTTTTAGATTTATTTTTTTTTAGTATTCAAACCCTTTCGACAGTAGGCTATGGTGCTATGTATCCAAAAACTGTGGCCGCCCAAATCGTTGTCAGTGTAGAAATTTTTGTCGGACTGATAAGTCTAGCCATTTTAACAGGGTTAATGTTTTCACGTTTTGCTAAACCTACCTCTAGGGTCTTATTTAGCGAAGTCGCTGTGGTCTGTCCCTTTGAAGAAATCCCAACATTAATGTTTCGTGCTGCCAACCAACGAAATAATCGTATTTTAGAAGCCCAAATTAGAGTGAGTTTAGTTCAGGATGAACAAACCAAAGAAGGACATAAAATGCGCCGTTTTTATGATTTAAACTTATTACGCTCCCACACCCCGGTTTTTGGTTTGAGTTGGTTAATAATGCATCCGATAGACAGTAATAGCCCACTTTATGGATTTTCAGAAGTAAGCAATCAACAACAAAGGTTAGAACTTTGGATTAGTTTCACTGGTTTAGATGAAAGTTTTTCCCAAACTATTCACAGTCGTTATGCCTATGAGGGAGCAGATATTCGTTGGCAGTACCGTTTTGTGGATATTTTTCACCAAACCCCAGAAGGTAAATGGTTTATTAATATGGACAATTTTCATCAAATAGAACCTTATCACCCTAAATCCCCTGAAAATTCCTAG

Protein

No sequence available