Your browser is old and dusty. Try Google Chrome!

Details for slr5073

ORF slr5073
Accession NP_942229.1
Symbol
Category
Definition
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_441061.1_2 Reverse -358 -372 3.24451 0.166
NP_441061.1_2 Reverse -239 -253 2.2612 0.178
NP_441061.1_2 Forward -246 -232 0.786239 0.199
NP_440795.1_7 Forward -246 -239 14.6904 0.0123
NP_440795.1_7 Reverse -239 -246 14.6904 0.0123
NP_441418.1_6 Forward -247 -228 -18.5851 0.0832
NP_441418.1_6 Forward -366 -347 -29.4015 0.224
NP_440815.1_5 Forward -247 -228 18.0924 0.0856
NP_442291.1_5 Forward -248 -232 -2.39974 0.215
NP_441453.1_1 Forward -254 -236 2.37835 0.294
NP_441453.1_4 Reverse -238 -246 16.539 0.00633
NP_441453.1_4 Forward -247 -239 16.539 0.00633
NP_441453.1_4 Forward -372 -364 4.24765 0.259
NP_441453.1_4 Reverse -363 -371 4.24765 0.259
NP_442151.1_6 Forward -372 -358 10.0294 0.133
NP_442151.1_6 Reverse -363 -377 9.04604 0.159
NP_442151.1_6 Forward -247 -233 8.45605 0.172
NP_442151.1_6 Reverse -238 -252 7.17775 0.206
NP_441818.1_1 Forward -246 -235 10.1862 0.232
NP_441818.1_9 Forward -315 -296 -1.27885 0.2
NP_441818.1_9 Forward -270 -251 -5.99873 0.258
NP_441818.1_9 Forward -276 -257 -10.0303 0.292
NP_440226.1_1 Forward -247 -228 13.9625 0.0337
NP_441630.1_3 Reverse -230 -249 4.42435 0.164
NP_440150.1_6 Forward -315 -296 5.89931 0.229
NP_440996.1_3 Reverse -327 -345 11.7205 0.221
NP_441721.1_1 Reverse -298 -317 5.50599 0.231
NP_442173.1_1 Forward -246 -238 15.4574 0.00633
NP_442173.1_1 Reverse -239 -247 15.4574 0.00633
NP_442752.1_4 Forward -247 -240 13.8055 0.0199
NP_442752.1_4 Reverse -238 -245 13.8055 0.0199
NP_442752.1_4 Reverse -340 -347 10.8555 0.0846
NP_442752.1_4 Forward -258 -251 7.90559 0.144
NP_442752.1_4 Forward -252 -245 4.95566 0.26
NP_443027.1_4 Forward -249 -239 15.3197 0.0437
NP_443027.1_4 Reverse -361 -371 7.84651 0.228
NP_441812.1_3 Reverse -237 -251 6.78443 0.291
NP_442975.1_10 Forward -251 -237 10.9137 0.0516
NP_442975.1_10 Reverse -234 -248 10.9137 0.0516
NP_441225.1_1 Reverse -240 -259 -4.52377 0.197
NP_441225.1_4 Reverse -251 -270 -5.9004 0.284
NP_440784.1_7 Forward -246 -239 15.9687 0.0123
NP_440784.1_7 Reverse -239 -246 15.9687 0.0123
NP_440061.1_9 Reverse -236 -250 10.0287 0.131
NP_440110.1_4 Forward -258 -239 5.11266 0.173
NP_441054.1_2 Reverse -380 -399 14.1591 0.172
NP_441054.1_4 Reverse -353 -371 -1.45582 0.2
NP_441476.1_5 Forward -354 -335 1.96607 0.188
NP_441476.1_5 Reverse -272 -291 -6.98204 0.279
NP_439979.1_9 Reverse -358 -376 7.09898 0.288
NP_442062.1_8 Forward -247 -237 17.3846 0.00193
NP_442062.1_8 Reverse -238 -248 10.3048 0.0493
NP_442062.1_8 Reverse -340 -350 6.46988 0.125
NP_442062.1_8 Reverse -363 -373 5.09324 0.184
NP_442062.1_8 Forward -337 -327 2.83163 0.293
NP_441859.1_3 Reverse -327 -346 5.50519 0.198
NP_440304.1_4 Forward -249 -239 18.9579 0.00406
NP_440304.1_4 Forward -374 -364 7.74818 0.101
NP_440304.1_4 Reverse -361 -371 7.74818 0.101
NP_440304.1_4 Reverse -236 -246 1.84832 0.299
NP_442242.1_4 Forward -246 -239 14.3954 0.0124
NP_442242.1_4 Reverse -239 -246 14.3954 0.0124
NP_440044.1_8 Forward -246 -227 4.42435 0.114
NP_440044.1_8 Reverse -239 -258 -3.3438 0.282
NP_441781.1_7 Forward -215 -196 3.6377 0.188
NP_441781.1_7 Forward -372 -353 2.85105 0.199
NP_441781.1_7 Forward -247 -228 1.96607 0.215
NP_441200.1_4 Reverse -370 -389 5.89931 0.291
NP_441619.1_8 Forward -253 -239 13.1753 0.115
NP_441208.1_9 Reverse -235 -249 15.4376 0.0854
NP_441208.1_9 Forward -315 -301 10.4227 0.188
NP_441594.1_6 Forward -346 -327 4.62101 0.216
NP_442110.1_7 Reverse -238 -252 1.27789 0.233
NP_442110.1_7 Forward -366 -352 0.982901 0.241
NP_442110.1_7 Forward -372 -358 -0.492064 0.291
NP_441925.1_2 Forward -164 -145 5.211 0.262
NP_441925.1_2 Forward -165 -146 0.884433 0.282
NP_441925.1_4 Reverse -290 -309 -9.53937 0.222
NP_441925.1_4 Reverse -239 -258 -13.4726 0.257
NP_441083.1_3 Forward -89 -79 12.8609 0.242
NP_441083.1_5 Forward -247 -237 20.3345 0.00053
NP_441083.1_5 Reverse -238 -248 11.2881 0.0159
NP_441083.1_5 Reverse -363 -373 -0.216628 0.261
NP_441434.1_6 Forward -169 -159 14.1397 0.288
NP_441738.1_2 Forward -245 -238 15.28 0.0102
NP_441738.1_2 Reverse -240 -247 15.28 0.0102
NP_441558.1_5 Forward -374 -355 19.0757 0.00989
NP_441558.1_5 Forward -249 -230 14.4541 0.0485
NP_441558.1_5 Reverse -236 -255 4.52268 0.28
NP_440209.1_1 Reverse -238 -246 18.1123 0.00295
NP_440209.1_1 Forward -247 -239 18.1123 0.00295
NP_442889.1_8 Forward -250 -236 17.6002 0.0162
NP_441713.1_1 Forward -318 -299 -0.197208 0.092
NP_440178.1_7 Forward -373 -354 -11.1119 0.088
NP_440178.1_7 Reverse -237 -256 -11.2103 0.088
NP_440178.1_7 Forward -248 -229 -12.4886 0.121
NP_442570.1_3 Forward -51 -32 -6.49039 0.258
NP_442111.1_4 Reverse -237 -251 19.4691 0.00416
NP_441163.1_4 Forward -383 -364 17.9547 0.158
NP_441163.1_4 Reverse -255 -274 13.5982 0.278
NP_440343.1_3 Reverse -246 -264 2.67334 0.291
NP_440851.1_1 Forward -211 -192 18.1898 0.147
NP_440906.1_5 Forward -246 -239 15.8704 0.0124
NP_440906.1_5 Reverse -239 -246 15.8704 0.0124
NP_440747.1_10 Reverse -235 -247 14.9853 0.00221
NP_440747.1_10 Forward -250 -238 -2.02597 0.0196
NP_440747.1_10 Forward -375 -363 -11.7607 0.142
NP_440747.1_10 Forward -315 -303 -11.7607 0.142
NP_440747.1_10 Reverse -300 -312 -11.9574 0.178
NP_441486.1_1 Reverse -235 -249 6.19444 0.0344
NP_441486.1_1 Forward -250 -236 -2.45868 0.175
NP_442330.1_4 Forward -267 -248 17.1907 0.233
NP_442634.1_4 Reverse -361 -375 3.8345 0.0946
NP_442634.1_4 Reverse -236 -250 -3.24533 0.161
NP_442634.1_4 Forward -249 -235 -3.54032 0.161
NP_440842.1_10 Forward -250 -236 0.982901 0.296
NP_441695.1_4 Reverse -245 -263 16.4404 0.145
NP_441695.1_4 Reverse -64 -82 9.55725 0.294
NP_441014.1_5 Forward -377 -359 13.1955 0.218
NP_441014.1_10 Forward -248 -229 -2.65624 0.283
NP_442848.1_1 Reverse -232 -246 -2.36035 0.263
NP_442848.1_1 Forward -253 -239 -4.52363 0.294
NP_442848.1_5 Reverse -296 -314 -2.83245 0.286
NP_441012.1_4 Forward -51 -38 12.2123 0.249
NP_441012.1_4 Forward -370 -357 9.16406 0.272
NP_441012.1_4 Forward -376 -363 6.21414 0.284
NP_443018.1_3 Forward -246 -239 14.8871 0.0123
NP_443018.1_3 Reverse -239 -246 14.8871 0.0123
NP_443018.1_3 Forward -371 -364 12.5271 0.0523
NP_443018.1_3 Reverse -364 -371 12.5271 0.0523
NP_441634.1_8 Reverse -338 -352 7.07942 0.114
NP_441634.1_8 Forward -374 -360 2.2612 0.169
NP_441634.1_8 Reverse -236 -250 -3.147 0.295
NP_440376.1_1 Forward -247 -238 19.4693 0.000692
NP_440376.1_1 Reverse -238 -247 19.4693 0.000692
NP_440376.1_1 Forward -372 -363 6.39124 0.1
NP_440376.1_1 Reverse -363 -372 6.39124 0.1
NP_440376.1_1 Reverse -303 -312 3.63797 0.2
NP_441588.1_4 Forward -245 -235 18.1713 0.0143
NP_442687.1_7 Forward -248 -238 9.02648 0.0994
NP_442687.1_7 Reverse -237 -247 8.92815 0.0994
NP_442687.1_7 Forward -373 -363 7.45319 0.132
NP_442191.1_4 Forward -285 -271 12.8353 0.187
NP_440066.1_5 Reverse -291 -310 9.7334 0.251
NP_442485.1_3 Reverse -358 -377 -2.85214 0.268
NP_441846.1_10 Forward -265 -246 -11.8986 0.19
NP_442958.1_3 Forward -258 -239 0.884433 0.267
NP_441013.1_2 Reverse -358 -376 -1.55415 0.282
NP_441422.1_7 Reverse -236 -253 -5.07437 0.247
NP_442296.1_9 Forward -246 -227 1.17943 0.197
NP_442658.1_1 Forward -249 -239 15.9091 0.00966
NP_442658.1_1 Reverse -236 -246 6.76441 0.214
NP_442658.1_1 Reverse -361 -371 5.68278 0.258
NP_440141.1_8 Reverse -271 -290 5.99764 0.271
NP_442205.1_9 Forward -253 -237 15.6932 0.0259
NP_441414.1_9 Forward -247 -228 -1.7705 0.105
NP_441414.1_9 Reverse -238 -257 -3.63879 0.14
NP_440800.1_7 Reverse -226 -240 10.6193 0.294
NP_440607.1_5 Reverse -354 -373 3.73603 0.226
NP_441487.1_9 Reverse -279 -298 -0.590531 0.259
NP_442937.1_5 Reverse -233 -252 15.1424 0.0621
NP_442937.1_5 Forward -237 -218 6.58763 0.275
NP_442321.1_1 Reverse -361 -380 -5.9004 0.228
NP_441958.1_5 Forward -248 -238 21.2195 0.000805
NP_441958.1_5 Reverse -237 -247 12.2714 0.00183
NP_441958.1_5 Reverse -362 -372 1.65166 0.0872
NP_441958.1_5 Forward -373 -363 0.963343 0.12
NP_441958.1_5 Reverse -302 -312 -0.41329 0.205
NP_440318.1_1 Forward -286 -267 5.40766 0.218
NP_439905.1_1 Forward -371 -358 8.27909 0.234
NP_439905.1_1 Reverse -239 -252 6.80412 0.275
NP_440984.1_7 Forward -377 -363 7.37441 0.175
NP_440984.1_7 Reverse -233 -247 5.30946 0.259
NP_442911.1_2 Forward -257 -238 8.06259 0.0223
NP_442911.1_2 Forward -359 -340 0.294447 0.0682
NP_442911.1_2 Reverse -228 -247 -8.26035 0.231
NP_441580.1_6 Reverse -329 -348 -2.45882 0.224
NP_440153.1_5 Reverse -239 -253 4.22782 0.199
NP_440153.1_8 Forward -372 -359 4.34585 0.202
NP_440153.1_8 Reverse -303 -316 -3.02898 0.276
NP_440153.1_8 Reverse -334 -347 -3.52063 0.295
NP_443055.1_6 Reverse -230 -248 4.73828 0.181
NP_443055.1_6 Reverse -185 -203 -2.43985 0.295
NP_440993.1_2 Forward -252 -236 3.30346 0.259
NP_440993.1_3 Forward -322 -303 3.73524 0.179
NP_440496.1_9 Reverse -94 -113 -3.54046 0.249
NP_440138.1_6 Forward -213 -194 2.26028 0.269
NP_441099.1_5 Reverse -228 -247 5.40766 0.0469
NP_441099.1_5 Forward -257 -238 -1.67217 0.112
NP_441099.1_5 Reverse -353 -372 -8.35868 0.193
NP_441099.1_5 Forward -322 -303 -11.3086 0.276
NP_442002.1_9 Reverse -339 -346 10.7572 0.185
NP_441294.1_7 Reverse -234 -248 14.434 0.0428
NP_441294.1_7 Forward -251 -237 9.53859 0.241
NP_441646.1_1 Forward -254 -235 3.6377 0.206
NP_442438.1_10 Forward -252 -238 5.99778 0.123
NP_442438.1_10 Forward -354 -340 3.14618 0.166
NP_442431.1_10 Forward -273 -255 3.46073 0.217
NP_442431.1_10 Forward -261 -243 -0.0791831 0.284
NP_441000.1_6 Forward -248 -234 -4.52363 0.245
NP_442771.1_1 Reverse -236 -254 -6.76569 0.169
NP_440147.1_4 Reverse -236 -249 20.1771 0.00228
NP_440147.1_4 Reverse -301 -314 6.1158 0.103
NP_440147.1_4 Forward -249 -236 3.75586 0.181
NP_440147.1_4 Forward -374 -361 0.805932 0.244
NP_440147.1_4 Forward -329 -316 -0.472371 0.287
NP_441550.1_8 Forward -249 -239 17.4824 0.00754
NP_441550.1_8 Reverse -236 -246 14.6309 0.0132
NP_441550.1_8 Reverse -361 -371 4.60114 0.299
NP_441916.1_7 Reverse -238 -248 18.9579 0.00144
NP_441916.1_7 Forward -247 -237 10.3048 0.0261
NP_441916.1_7 Forward -372 -362 6.37155 0.0988
NP_441916.1_7 Reverse -363 -373 4.3066 0.182
NP_441916.1_10 Forward -255 -236 12.4875 0.122
NP_440206.1_4 Reverse -353 -372 4.71854 0.255
NP_440465.1_10 Reverse -360 -379 5.89931 0.209
NP_441041.1_4 Forward -247 -228 4.916 0.0542
NP_441041.1_4 Forward -372 -353 1.37609 0.0808
NP_441041.1_4 Reverse -357 -376 -8.752 0.207
NP_441041.1_7 Reverse -235 -247 11.8878 0.0689
NP_441041.1_7 Forward -250 -238 8.87526 0.128
NP_442642.1_9 Forward -254 -237 3.48043 0.192
NP_442004.1_6 Reverse -238 -252 6.88276 0.17
NP_442004.1_6 Forward -372 -358 4.03116 0.227
NP_441725.1_5 Reverse -364 -374 9.22315 0.0553
NP_441725.1_5 Reverse -239 -249 8.92815 0.0553
NP_441725.1_5 Forward -246 -236 2.04498 0.115
NP_441725.1_5 Forward -336 -326 -1.19994 0.294
NP_439966.1_7 Forward -249 -239 13.8442 0.0234
NP_439966.1_7 Reverse -236 -246 7.25606 0.15
NP_439966.1_7 Reverse -338 -348 6.17443 0.191
NP_439966.1_9 Forward -351 -342 6.5879 0.253
NP_439966.1_9 Forward -249 -240 0.983037 0.253
NP_440736.1_3 Forward -249 -230 -1.18052 0.282
NP_442941.1_3 Forward -246 -236 11.0914 0.0116
NP_442941.1_3 Reverse -239 -249 10.9931 0.0116
NP_442941.1_3 Forward -348 -338 -0.609952 0.264
NP_440289.1_2 Forward -250 -237 2.18257 0.102
NP_440289.1_2 Reverse -235 -248 -2.24233 0.253
NP_440983.1_5 Reverse -303 -322 -5.9004 0.273
NP_440260.1_8 Forward -256 -238 -7.35568 0.295
NP_441678.1_9 Forward -372 -353 -5.70374 0.299
NP_442281.1_1 Reverse -233 -247 18.5835 0.00414
NP_442281.1_1 Forward -377 -363 14.2569 0.0198
NP_441334.1_7 Forward -329 -310 -16.4218 0.275
NP_441334.1_7 Reverse -236 -255 -21.1417 0.29
NP_442575.1_3 Reverse -241 -260 13.3725 0.103
NP_440177.1_9 Forward -255 -236 13.5691 0.226
NP_442256.1_2 Forward -249 -231 0.609134 0.115
NP_442012.1_1 Forward -304 -285 -0.590531 0.264
NP_442012.1_1 Forward -378 -359 -1.27885 0.282
NP_441457.1_7 Forward -374 -355 1.37609 0.276
NP_441457.1_7 Reverse -236 -255 -0.688862 0.293
NP_440498.1_1 Reverse -229 -247 -3.6191 0.267
NP_440375.1_8 Forward -246 -227 -1.86883 0.293
NP_443030.1_4 Reverse -321 -340 -7.57203 0.298
NP_441644.1_6 Reverse -238 -248 19.0557 0.000803
NP_441644.1_6 Forward -247 -237 17.3841 0.00127
NP_441644.1_6 Forward -372 -362 15.6142 0.00525
NP_441644.1_6 Forward -312 -302 14.4342 0.0126
NP_441644.1_6 Reverse -363 -373 12.2709 0.0356
NP_442215.1_2 Reverse -361 -377 1.92682 0.125
NP_442215.1_2 Forward -249 -233 -4.26803 0.23
NP_442177.1_5 Forward -309 -295 9.5377 0.239
NP_442247.1_8 Reverse -236 -250 9.93102 0.247
NP_440253.1_2 Forward -247 -229 7.39397 0.0717
NP_440929.1_8 Forward -247 -238 19.2726 0.000701
NP_440929.1_8 Reverse -238 -247 19.2726 0.000701
NP_442933.1_10 Forward -247 -238 17.601 0.00325
NP_442933.1_10 Reverse -238 -247 17.601 0.00325
NP_442933.1_10 Reverse -363 -372 4.42462 0.246
NP_442933.1_10 Forward -372 -363 4.42462 0.246
NP_441751.2_8 Reverse -239 -253 14.9459 0.0119
NP_441751.2_8 Forward -246 -232 -3.147 0.134
NP_442926.1_3 Reverse -352 -371 14.6508 0.0896
NP_442926.1_3 Forward -383 -364 4.22769 0.269
NP_442554.1_8 Reverse -239 -249 19.1546 0.00369
NP_442554.1_8 Forward -371 -361 16.9913 0.0065
NP_442554.1_8 Forward -246 -236 15.3197 0.00882
NP_442554.1_8 Reverse -364 -374 12.6647 0.0234
NP_442554.1_8 Reverse -304 -314 5.09324 0.161
NP_441762.1_7 Reverse -237 -249 2.59558 0.0676
NP_441762.1_7 Forward -248 -236 0.530633 0.0747
NP_441762.1_7 Reverse -339 -351 -5.36923 0.203
NP_442142.1_4 Forward -375 -362 14.2767 0.0311
NP_442142.1_4 Reverse -235 -248 11.5234 0.0552
NP_442142.1_4 Reverse -246 -259 5.23026 0.197
NP_442142.1_4 Forward -250 -237 3.65697 0.248
NP_442292.1_1 Forward -246 -237 18.486 0.00229
NP_442292.1_1 Reverse -239 -248 17.5026 0.00435
NP_442292.1_1 Forward -371 -362 4.81794 0.17
NP_442476.1_6 Reverse -239 -253 2.16287 0.191
NP_442476.1_6 Reverse -341 -355 0.88457 0.238
NP_442381.1_8 Forward -250 -231 -15.0452 0.292
NP_441711.1_4 Reverse -229 -248 6.29264 0.154
NP_443009.1_5 Reverse -237 -248 14.5128 0.02
NP_443009.1_5 Forward -248 -237 10.1862 0.0792
NP_443009.1_5 Reverse -362 -373 5.46638 0.202
NP_443009.1_5 Forward -373 -362 5.17139 0.214
NP_443009.1_5 Reverse -205 -216 3.40144 0.296
NP_441715.1_4 Forward -246 -236 7.94484 0.107
NP_441715.1_4 Reverse -239 -249 7.25653 0.108
NP_440015.1_9 Reverse -238 -256 -2.0458 0.299
NP_441198.1_5 Forward -245 -232 12.7034 0.216
NP_441198.1_5 Forward -325 -312 12.5067 0.224
NP_441198.1_8 Forward -249 -239 15.4199 0.0427
NP_441198.1_8 Reverse -361 -371 12.49 0.129
NP_441198.1_8 Forward -374 -364 10.1462 0.296
NP_440379.1_5 Forward -262 -243 -3.73712 0.205
NP_440379.1_5 Forward -256 -237 -5.01543 0.219
NP_440379.1_5 Forward -316 -297 -5.31042 0.222
NP_440464.1_10 Forward -246 -236 13.0082 0.169
NP_441468.1_1 Forward -246 -239 15.8704 0.0124
NP_441468.1_1 Reverse -239 -246 15.8704 0.0124
NP_441468.1_1 Reverse -364 -371 3.97235 0.277
NP_441468.1_1 Forward -371 -364 3.97235 0.277
NP_441020.2_6 Forward -249 -232 11.2486 0.124
NP_441015.1_10 Reverse -358 -377 9.0459 0.078
NP_441015.1_10 Forward -263 -244 -1.18052 0.171
NP_441015.1_10 Forward -317 -298 -3.44213 0.189
NP_441673.1_1 Forward -247 -238 20.8459 0.000698
NP_441673.1_1 Reverse -238 -247 20.8459 0.000698
NP_441673.1_1 Forward -372 -363 1.27803 0.155
NP_441673.1_1 Reverse -363 -372 1.27803 0.155
NP_441826.1_2 Forward -253 -239 -3.04867 0.282
NP_441826.1_2 Forward -372 -358 -3.63866 0.286
NP_441826.1_2 Forward -378 -364 -4.4253 0.296
NP_442490.1_9 Reverse -328 -347 -2.0655 0.204
NP_442868.1_6 Reverse -236 -246 9.81313 0.038
NP_442868.1_6 Forward -249 -239 8.63316 0.0555
NP_442719.1_2 Forward -126 -108 5.03327 0.142
NP_441612.1_2 Forward -247 -237 8.54929 0.21
NP_442227.1_2 Reverse -251 -270 -0.197208 0.253
NP_442808.1_1 Forward -248 -238 8.73102 0.0481
NP_442808.1_1 Reverse -237 -247 8.63269 0.0481
NP_442808.1_1 Forward -350 -340 5.97777 0.134
NP_442808.1_1 Forward -203 -193 4.50281 0.197
NP_441101.1_1 Forward -249 -231 14.0805 0.231
NP_440145.1_3 Forward -257 -238 1.86774 0.122
NP_442820.1_4 Forward -317 -300 13.5102 0.265
NP_442050.1_1 Reverse -350 -369 7.27595 0.274
NP_442050.1_5 Forward -249 -239 17.1874 0.00812
NP_442050.1_5 Reverse -236 -246 7.64939 0.243
NP_442342.1_9 Reverse -296 -312 7.2367 0.209
NP_440558.1_2 Forward -375 -356 2.16274 0.17
NP_440558.1_2 Reverse -359 -378 -1.27885 0.213
NP_440558.1_2 Forward -256 -237 -2.26216 0.225
NP_440558.1_2 Forward -310 -291 -6.88371 0.283
NP_440558.1_2 Reverse -360 -379 -6.98204 0.284
NP_441518.1_3 Reverse -228 -247 -4.42544 0.12
NP_441878.1_6 Forward -373 -363 20.2362 0.0046
NP_441878.1_6 Reverse -362 -372 10.5014 0.0176
NP_441878.1_6 Forward -248 -238 10.5014 0.0176
NP_441878.1_6 Reverse -237 -247 10.4031 0.0176
NP_441878.1_6 Forward -313 -303 -7.29646 0.217
NP_441036.1_8 Forward -248 -238 15.713 0.00724
NP_441036.1_8 Reverse -237 -247 8.33817 0.174
NP_441036.1_8 Forward -350 -340 6.66654 0.22
NP_441557.1_5 Forward -247 -238 19.9609 0.000699
NP_441557.1_5 Reverse -238 -247 19.9609 0.000699
NP_441557.1_5 Forward -372 -363 0.393051 0.166
NP_441557.1_5 Reverse -363 -372 0.393051 0.166
NP_441590.1_4 Reverse -245 -264 7.17681 0.25
NP_442267.1_6 Forward -348 -329 16.1257 0.265
NP_442066.2_4 Reverse -238 -257 -7.4737 0.28
NP_442066.2_9 Forward -251 -238 12.114 0.154
NP_441433.1_8 Forward -312 -293 -3.73712 0.283
NP_441308.1_8 Forward -249 -239 12.4681 0.218
NP_442183.1_1 Reverse -238 -252 10.4227 0.0845
NP_442183.1_1 Forward -247 -233 7.76774 0.131
NP_442183.1_1 Reverse -340 -354 5.60446 0.21
NP_442444.1_6 Forward -255 -237 20.1752 0.0935
NP_441549.1_9 Forward -376 -358 -4.30741 0.198
NP_441549.1_9 Reverse -234 -252 -5.29072 0.198
NP_441549.1_9 Reverse -359 -377 -8.24065 0.223
NP_441549.1_9 Forward -316 -298 -9.81395 0.261
NP_442347.1_2 Forward -246 -237 12.4878 0.056
NP_442347.1_2 Forward -348 -339 3.93297 0.284
NP_442347.1_2 Reverse -239 -248 3.34298 0.284
NP_442645.1_2 Forward -255 -236 5.99764 0.0183
NP_442645.1_2 Reverse -230 -249 -22.2233 0.29
NP_441037.1_4 Forward -249 -239 16.5761 0.0168
NP_441037.1_4 Reverse -236 -246 7.9999 0.237
NP_441633.1_3 Reverse -236 -249 10.8357 0.0286
NP_440136.1_2 Forward -246 -239 15.9687 0.0123
NP_440136.1_2 Reverse -239 -246 15.9687 0.0123
NP_442590.1_10 Forward -304 -285 5.50599 0.258
NP_442590.1_10 Reverse -296 -315 3.34271 0.294
NP_442998.1_10 Forward -245 -238 15.5754 0.0102
NP_442998.1_10 Reverse -240 -247 15.5754 0.0102
NP_442998.1_10 Forward -347 -340 6.0373 0.205
NP_440899.1_2 Forward -383 -364 7.57013 0.225
NP_440299.1_1 Forward -251 -238 9.36014 0.0728
NP_440299.1_1 Reverse -234 -247 4.44361 0.207
NP_441799.1_1 Reverse -234 -248 14.5519 0.0228
NP_441799.1_1 Forward -251 -237 12.782 0.04
NP_441799.1_1 Forward -376 -362 6.58715 0.167
NP_441007.1_10 Forward -252 -239 12.9006 0.0499
NP_441007.1_10 Reverse -358 -371 2.2809 0.193
NP_441007.1_10 Reverse -233 -246 0.412608 0.23
NP_442201.1_10 Forward -258 -239 -13.3736 0.274
NP_441449.1_8 Reverse -224 -243 14.5663 0.24
NP_440256.1_1 Reverse -235 -254 -3.44213 0.133
NP_440256.1_1 Forward -145 -126 -9.53865 0.281
NP_441559.1_8 Forward -302 -288 -0.000409212 0.171
NP_441559.1_8 Forward -291 -277 -3.44199 0.203
NP_441559.1_8 Reverse -272 -286 -6.78525 0.279
NP_440915.1_6 Forward -251 -237 10.3243 0.0322
NP_440915.1_6 Reverse -234 -248 3.93283 0.1
NP_440915.1_6 Reverse -359 -373 2.85119 0.111
NP_440915.1_6 Forward -316 -302 2.45787 0.118
NP_442785.1_8 Forward -288 -270 16.9321 0.269
NP_441704.1_8 Forward -342 -323 6.39016 0.262
NP_442452.1_8 Reverse -261 -275 17.8952 0.257
NP_442866.1_1 Reverse -358 -377 -4.6221 0.228
NP_442866.1_1 Forward -303 -284 -8.55534 0.282
NP_440748.1_5 Forward -244 -225 0.392778 0.252
NP_440748.1_5 Reverse -354 -373 -3.14714 0.291
NP_441464.1_8 Reverse -238 -252 7.47274 0.206
NP_441464.1_8 Forward -247 -233 4.91614 0.26
NP_440306.1_8 Reverse -13 -32 -3.14789 0.28
NP_441939.1_3 Reverse -239 -258 6.78429 0.222
NP_441199.1_6 Reverse -234 -253 7.27595 0.12
NP_441494.1_6 Reverse -358 -371 9.85238 0.227
NP_442993.1_1 Reverse -238 -254 -10.7579 0.226
NP_442386.1_9 Reverse -237 -246 13.8639 0.0289
NP_442386.1_9 Forward -248 -239 6.39082 0.219
NP_441750.1_1 Reverse -193 -212 -5.40875 0.21
NP_441340.1_5 Forward -246 -239 15.6737 0.0124
NP_441340.1_5 Reverse -239 -246 15.6737 0.0124
NP_441340.1_5 Reverse -364 -371 4.07068 0.239
NP_441340.1_5 Forward -371 -364 4.07068 0.239
NP_439909.1_6 Forward -166 -147 16.7157 0.248
NP_442484.1_2 Reverse -227 -246 -0.39387 0.262
NP_440146.1_2 Forward -253 -239 14.3559 0.23
NP_440586.1_8 Forward -246 -239 13.2151 0.026
NP_440586.1_8 Reverse -239 -246 13.2151 0.026
NP_440586.1_8 Forward -371 -364 7.61025 0.227
NP_440586.1_8 Reverse -364 -371 7.61025 0.227
NP_442251.1_6 Forward -246 -239 15.2804 0.0124
NP_442251.1_6 Reverse -239 -246 15.2804 0.0124
NP_440192.1_5 Forward -319 -300 7.57094 0.209
NP_440684.1_9 Reverse -232 -246 12.0943 0.168
NP_441262.1_3 Reverse -238 -245 14.7888 0.0223
NP_441262.1_3 Forward -247 -240 14.7888 0.0223
NP_440027.1_3 Reverse -288 -306 5.22993 0.245
NP_440027.1_3 Reverse -267 -285 2.28001 0.292
NP_440027.1_8 Reverse -235 -254 4.62021 0.287
NP_443051.1_1 Forward -248 -239 19.5676 0.00335
NP_443051.1_1 Reverse -237 -246 10.4228 0.00754
NP_443051.1_1 Reverse -362 -371 -0.000272808 0.245
NP_441232.1_10 Forward -258 -239 1.17943 0.287
NP_439937.1_8 Reverse -338 -357 -2.0655 0.254
NP_439937.1_8 Reverse -358 -377 -4.72043 0.286
NP_439937.1_9 Forward -373 -356 -8.02495 0.173
NP_439937.1_9 Reverse -287 -304 -11.2699 0.248
NP_440439.1_1 Forward -250 -237 3.06754 0.121
NP_440439.1_1 Reverse -360 -373 2.18257 0.138
NP_439943.1_7 Reverse -233 -252 3.44104 0.29
NP_440372.1_2 Forward -246 -239 16.3621 0.0124
NP_440372.1_2 Reverse -239 -246 16.3621 0.0124
NP_440574.1_7 Forward -283 -264 9.63589 0.283
NP_441789.1_7 Reverse -248 -267 7.76679 0.193
NP_440819.1_5 Forward -79 -71 15.8507 0.185
NP_440316.1_10 Forward -373 -363 7.74818 0.246
NP_440316.1_10 Reverse -362 -372 6.27322 0.264
NP_439977.1_5 Reverse -292 -311 3.73603 0.158
NP_439977.1_5 Forward -355 -336 1.37609 0.194
NP_441572.1_7 Forward -378 -359 -4.42544 0.235
NP_442384.1_10 Reverse -238 -251 8.67241 0.0625
NP_442384.1_10 Reverse -363 -376 5.52582 0.127
NP_442384.1_10 Forward -312 -299 4.54251 0.153
NP_442384.1_10 Reverse -277 -290 3.06754 0.203
NP_442384.1_10 Forward -247 -234 1.10092 0.268
NP_442384.1_10 Forward -372 -359 0.314277 0.294
NP_441980.1_9 Forward -254 -235 13.9625 0.298
NP_442262.1_10 Forward -246 -239 14.1988 0.0123
NP_442262.1_10 Reverse -239 -246 14.1988 0.0123
NP_442262.1_10 Forward -371 -364 10.4622 0.145
NP_442262.1_10 Reverse -364 -371 10.4622 0.145
NP_442262.1_10 Reverse -319 -326 7.6106 0.274
NP_441689.1_5 Forward -249 -239 8.43603 0.132
NP_441689.1_5 Reverse -236 -246 5.78111 0.197
NP_441689.1_5 Forward -144 -134 4.99446 0.285
NP_442244.1_6 Reverse -357 -376 0.687771 0.291
NP_440163.1_10 Forward -375 -365 8.82982 0.26
NP_440344.1_10 Forward -356 -339 -1.82945 0.0577
NP_440344.1_10 Reverse -333 -350 -10.4826 0.182
NP_440344.1_10 Reverse -231 -248 -10.7776 0.19
NP_440282.1_10 Reverse -29 -48 9.3409 0.11
NP_440282.1_10 Reverse -353 -372 -3.83545 0.249
NP_440282.1_10 Reverse -273 -292 -5.01543 0.25
NP_440282.1_10 Forward -382 -363 -9.63698 0.286
NP_440531.1_6 Forward -380 -361 -3.93378 0.273
NP_440531.1_8 Forward -354 -335 5.60432 0.249
NP_441965.1_3 Forward -257 -238 4.916 0.161
NP_441965.1_10 Reverse -360 -376 8.02334 0.135
NP_441965.1_10 Forward -250 -234 5.76173 0.197
NP_442529.1_4 Reverse -229 -248 12.3892 0.175
NP_442693.1_6 Reverse -297 -316 1.96607 0.278
NP_440297.1_9 Reverse -364 -374 19.0562 0.0359
NP_440297.1_9 Forward -336 -326 4.79825 0.22
NP_440297.1_9 Forward -246 -236 -0.118297 0.282
NP_440297.1_9 Forward -371 -361 -0.314959 0.282
NP_440297.1_9 Reverse -239 -249 -0.314959 0.282
NP_442280.1_10 Forward -388 -370 10.9088 0.215
NP_442067.1_4 Forward -383 -364 12.1925 0.115
NP_440999.1_9 Reverse -359 -373 -2.26202 0.264
NP_440888.1_2 Reverse -238 -252 17.7968 0.00308
NP_440888.1_2 Forward -286 -272 10.2254 0.1
NP_440888.1_2 Forward -372 -358 7.96378 0.175
NP_440888.1_2 Forward -247 -233 7.66879 0.186
NP_440600.1_4 Reverse -125 -143 -3.12744 0.218
NP_442277.1_2 Forward -89 -75 11.701 0.263
NP_442033.1_10 Reverse -296 -315 -11.6036 0.255
NP_441949.1_2 Reverse -228 -247 8.45592 0.261
NP_440575.1_2 Forward -385 -366 19.5326 0.137
NP_441543.1_2 Forward -246 -237 16.9127 0.00359
NP_441543.1_2 Reverse -239 -248 15.9293 0.00518
NP_441543.1_2 Forward -371 -362 4.12963 0.279
NP_442845.1_2 Forward -253 -239 17.2075 0.0608
NP_442845.1_2 Reverse -357 -371 12.8809 0.102
NP_442845.1_2 Forward -378 -364 5.70279 0.225
NP_442845.1_2 Reverse -363 -377 4.32615 0.261
NP_441551.1_5 Forward -376 -360 8.41597 0.238
NP_441469.1_8 Forward -373 -364 10.9145 0.191
NP_441469.1_8 Forward -248 -239 6.5879 0.227
NP_441469.1_8 Reverse -237 -246 6.48957 0.227
NP_441469.1_8 Reverse -339 -348 6.19458 0.231
NP_442315.1_1 Forward -263 -245 3.16574 0.294
NP_443064.1_6 Forward -247 -237 12.5669 0.0796
NP_443064.1_6 Reverse -238 -248 10.8217 0.13
NP_442337.1_6 Reverse -192 -211 21.94 0.04
NP_442337.1_8 Forward -186 -167 0.982764 0.241
NP_442578.1_7 Forward -246 -239 14.5921 0.026
NP_442578.1_7 Reverse -239 -246 14.5921 0.026
NP_442578.1_7 Reverse -341 -348 5.25066 0.251
NP_440710.1_1 Reverse -295 -313 0.904127 0.151
NP_440710.1_1 Forward -255 -237 -1.06249 0.179
NP_441462.1_2 Reverse -238 -248 20.2362 0.000805
NP_441462.1_2 Forward -247 -237 11.5831 0.00406
NP_441462.1_2 Forward -372 -362 0.668351 0.135
NP_441462.1_2 Reverse -363 -373 0.57002 0.144
NP_441621.1_7 Reverse -236 -250 -5.21195 0.248
NP_443062.1_1 Forward -247 -229 14.0063 0.0538
NP_443062.1_1 Reverse -238 -256 4.93815 0.244
NP_443062.1_6 Reverse -230 -249 1.76941 0.268
NP_441601.1_4 Reverse -245 -264 5.99764 0.166
NP_442204.1_1 Reverse -359 -370 1.33697 0.274
NP_440454.1_2 Reverse -121 -135 10.9932 0.291
NP_440516.1_8 Forward -247 -238 16.9127 0.00442
NP_440516.1_8 Reverse -238 -247 16.9127 0.00442
NP_442428.1_5 Forward -246 -239 15.8704 0.0124
NP_442428.1_5 Reverse -239 -246 15.8704 0.0124
NP_442428.1_5 Forward -371 -364 4.36568 0.271
NP_442428.1_5 Reverse -364 -371 4.36568 0.271
NP_442859.1_2 Reverse -239 -258 3.44104 0.253
NP_442120.1_10 Forward -372 -353 -8.06369 0.23
NP_442120.1_10 Forward -214 -195 -15.8318 0.296
NP_442120.1_10 Forward -247 -228 -16.0285 0.296
NP_440673.1_2 Forward -257 -238 14.5843 0.0986
NP_440673.1_3 Forward -245 -238 12.4288 0.0426
NP_440673.1_3 Reverse -240 -247 12.4288 0.0426
NP_441714.1_3 Forward -254 -236 14.6697 0.171
NP_441052.1_2 Forward -247 -237 19.9412 0.00106
NP_441052.1_2 Reverse -238 -248 10.4031 0.0285
NP_441052.1_2 Reverse -363 -373 4.20827 0.163
NP_441052.1_2 Forward -372 -362 4.20827 0.163
NP_442219.1_9 Forward -246 -237 17.7976 0.00718
NP_442219.1_9 Reverse -239 -248 8.25953 0.0681
NP_440436.1_4 Forward -246 -237 17.2072 0.00233
NP_440436.1_4 Reverse -239 -248 9.24241 0.0871
NP_441884.1_8 Forward -143 -124 -9.34199 0.268
NP_441884.1_9 Forward -292 -273 -21.83 0.266
NP_441884.1_9 Forward -250 -231 -23.4033 0.284
NP_442086.1_3 Reverse -239 -258 8.35759 0.231
NP_440314.1_9 Reverse -239 -258 2.3594 0.0855
NP_440314.1_9 Reverse -281 -300 -9.83364 0.278
NP_442907.1_2 Forward -371 -353 12.7038 0.181
NP_441719.1_4 Forward -246 -239 16.3621 0.0124
NP_441719.1_4 Reverse -239 -246 16.3621 0.0124
NP_441733.1_10 Forward -352 -339 9.2624 0.122
NP_441733.1_10 Forward -250 -237 6.01747 0.203
NP_441004.1_2 Forward -399 -380 -1.47551 0.259
NP_442813.1_4 Forward -282 -263 4.22769 0.197
NP_442366.1_3 Forward -248 -230 1.98577 0.137
NP_442366.1_5 Reverse -235 -245 14.8275 0.0375
NP_440296.1_10 Forward -315 -296 -11.4069 0.269
NP_441115.1_4 Reverse -362 -380 12.6047 0.0997
NP_442854.1_6 Reverse -238 -257 1.76941 0.279
NP_443054.1_2 Forward -249 -235 1.86788 0.245
NP_443054.1_2 Reverse -338 -352 0.294584 0.269
NP_441966.1_1 Reverse -81 -100 19.8623 0.0651
NP_442308.1_7 Forward -345 -326 14.6176 0.29
NP_441851.1_9 Forward -316 -297 13.0775 0.183
NP_441851.1_10 Reverse -237 -247 15.8113 0.00552
NP_441851.1_10 Reverse -339 -349 10.0098 0.106
NP_441851.1_10 Reverse -204 -214 8.73149 0.114
NP_441851.1_10 Forward -248 -238 8.53483 0.114
NP_441851.1_10 Forward -373 -363 6.17489 0.182
NP_442208.1_5 Forward -314 -295 -4.52377 0.258
NP_441501.1_6 Forward -307 -288 12.6841 0.288
NP_442515.1_1 Reverse -237 -251 6.78443 0.0974
NP_440593.1_3 Forward -213 -194 -2.26216 0.224
NP_441982.1_6 Reverse -114 -123 10.7665 0.292
NP_441046.1_2 Forward -169 -150 5.80098 0.221
NP_441349.1_10 Forward -257 -238 -7.37537 0.248
NP_441349.1_10 Reverse -228 -247 -8.85033 0.279
NP_440432.1_9 Forward -246 -231 8.43636 0.0427
NP_440432.1_9 Reverse -239 -254 -1.98672 0.167
NP_442843.1_1 Reverse -370 -389 -10.522 0.278
NP_440474.1_8 Reverse -239 -253 19.2718 0.0423
NP_442450.1_5 Reverse -236 -246 7.55152 0.13
NP_442450.1_5 Forward -374 -364 6.46988 0.174
NP_442168.1_5 Reverse -239 -258 0.982764 0.241
NP_440588.1_2 Forward -231 -212 -5.21209 0.243
NP_442006.1_2 Reverse -309 -326 -18.644 0.294
NP_442006.1_2 Reverse -78 -95 -19.0374 0.297
NP_443047.1_7 Reverse -239 -258 17.8957 0.0485
NP_442243.1_1 Reverse -357 -375 -0.0799167 0.239
NP_441570.1_1 Forward -247 -229 -1.06249 0.0538
NP_441078.1_4 Forward -247 -238 19.6659 0.0007
NP_441078.1_4 Reverse -238 -247 19.6659 0.0007
NP_441078.1_4 Reverse -363 -372 8.06287 0.0392
NP_441078.1_4 Forward -372 -363 8.06287 0.0392
NP_441078.1_4 Forward -312 -303 -1.86856 0.272
NP_442729.1_8 Reverse -336 -349 6.80412 0.178
NP_441663.1_8 Reverse -270 -289 -3.44213 0.289
NP_440526.1_3 Forward -246 -235 10.2846 0.0646
NP_440526.1_3 Reverse -239 -250 2.41814 0.267
NP_440526.1_3 Reverse -341 -352 0.54986 0.275
NP_441432.1_8 Reverse -237 -246 16.8143 0.00595
NP_441432.1_8 Forward -248 -239 16.8143 0.00595
NP_441432.1_8 Reverse -362 -371 6.19458 0.118
NP_441432.1_8 Forward -215 -206 5.40793 0.158
NP_442320.1_8 Reverse -232 -246 3.63784 0.0578
NP_442320.1_8 Forward -253 -239 -1.08205 0.0817
NP_442320.1_8 Reverse -334 -348 -4.03198 0.142
NP_442320.1_8 Reverse -328 -342 -5.70361 0.245
NP_442344.1_7 Forward -246 -227 -7.37537 0.182
NP_441732.1_2 Forward -251 -235 -15.5761 0.151
NP_441732.1_2 Reverse -234 -250 -16.2644 0.165
NP_441732.1_2 Forward -376 -360 -16.3627 0.165
NP_441030.1_6 Forward -374 -355 14.0067 0.197
NP_440497.1_6 Forward -377 -358 4.42435 0.227
NP_440497.1_6 Reverse -298 -317 -6.88371 0.269
NP_442815.1_2 Reverse -358 -376 2.18243 0.296
NP_440760.1_1 Reverse -238 -257 -2.0655 0.0329
NP_440760.1_1 Forward -247 -228 -21.535 0.238
NP_442797.1_1 Reverse -245 -264 0.687771 0.212
NP_442797.1_6 Reverse -251 -270 10.455 0.238
NP_442797.1_7 Reverse -296 -314 2.67408 0.238
NP_440199.1_10 Reverse -235 -245 7.25653 0.231
NP_440913.1_1 Forward -314 -296 6.90232 0.22
NP_440713.1_4 Forward -322 -303 12.6841 0.105
NP_442489.1_2 Reverse -227 -246 1.57275 0.285
NP_442489.1_7 Forward -247 -238 20.1576 0.000695
NP_442489.1_7 Reverse -238 -247 20.1576 0.000695
NP_442489.1_7 Forward -372 -363 8.06287 0.0371
NP_442489.1_7 Reverse -363 -372 8.06287 0.0371
NP_442489.1_7 Forward -312 -303 -1.18024 0.18
NP_440757.1_7 Reverse -358 -376 2.96908 0.263
NP_440565.1_3 Reverse -244 -263 15.8702 0.218
NP_442079.1_7 Reverse -364 -383 -0.295539 0.29
NP_440559.1_1 Forward -246 -237 17.4043 0.00658
NP_440559.1_1 Reverse -239 -248 8.65285 0.0586
NP_440559.1_1 Reverse -329 -338 4.52295 0.26
NP_441659.2_8 Reverse -238 -248 20.9245 0.000805
NP_441659.2_8 Forward -247 -237 18.1713 0.00133
NP_441659.2_8 Forward -372 -362 9.12481 0.0355
NP_441659.2_8 Reverse -363 -373 7.55152 0.0593
NP_441659.2_8 Reverse -303 -313 3.61828 0.154
NP_441659.2_8 Forward -366 -356 3.02829 0.177
NP_440426.1_7 Reverse -293 -312 3.14605 0.207
NP_440363.1_8 Reverse -310 -329 10.2259 0.288
NP_442913.1_10 Reverse -229 -248 6.68596 0.058
NP_439956.1_7 Forward -318 -299 5.40766 0.257
NP_440708.1_6 Reverse -245 -264 -5.70374 0.234
NP_442776.1_1 Forward -225 -206 7.7676 0.203
NP_440779.1_5 Forward -247 -230 -14.7108 0.269
NP_442346.1_1 Forward -348 -329 9.73422 0.286
NP_442346.1_5 Reverse -237 -247 16.6963 0.00248
NP_442346.1_5 Forward -248 -238 16.303 0.00248
NP_442346.1_5 Forward -373 -363 16.008 0.00329
NP_442346.1_5 Reverse -362 -372 14.3364 0.0136
NP_440352.1_5 Forward -155 -136 9.93029 0.289
NP_440545.1_3 Reverse -359 -376 19.6067 0.00859
NP_440545.1_3 Forward -376 -359 5.84037 0.059
NP_440545.1_3 Reverse -234 -251 2.79211 0.0941
NP_440545.1_3 Forward -316 -299 0.235503 0.143
NP_440545.1_3 Forward -370 -353 -1.14113 0.163
NP_440545.1_3 Reverse -299 -316 -3.8944 0.214
NP_441629.1_3 Reverse -296 -315 3.44025 0.218
NP_441923.1_6 Reverse -194 -208 8.25939 0.278
NP_442551.1_4 Reverse -361 -376 6.17475 0.203
NP_442603.1_7 Reverse -303 -317 11.7987 0.112
NP_440449.1_6 Reverse -355 -373 13.4108 0.105
NP_441047.1_3 Forward -220 -201 14.6508 0.268
NP_441502.1_5 Reverse -308 -327 11.3075 0.273
NP_441833.1_4 Forward -246 -239 15.9687 0.0124
NP_441833.1_4 Reverse -239 -246 15.9687 0.0124
NP_441329.1_4 Reverse -3 -21 18.4319 0.0905
NP_441329.1_6 Forward -155 -136 1.4797 0.237
NP_442162.1_9 Forward -246 -239 16.2637 0.0124
NP_442162.1_9 Reverse -239 -246 16.2637 0.0124
NP_440671.1_4 Reverse -193 -207 6.88276 0.233
NP_440671.1_4 Reverse -172 -186 5.70279 0.275
NP_440671.1_7 Forward -305 -286 17.6007 0.235
NP_442140.1_3 Forward -246 -236 12.2714 0.0632
NP_442140.1_3 Reverse -239 -249 7.94484 0.124
NP_442723.1_1 Reverse -234 -253 2.26028 0.291
NP_441696.1_6 Reverse -239 -258 0.294447 0.294
NP_440875.1_9 Forward -370 -360 10.6108 0.205
NP_440875.1_9 Reverse -240 -250 8.66404 0.233
NP_440875.1_9 Reverse -342 -352 8.17736 0.24
NP_440875.1_9 Forward -310 -300 7.00932 0.287
NP_441813.1_5 Forward -249 -239 8.73149 0.0367
NP_441813.1_5 Reverse -236 -246 8.63316 0.0367
NP_440594.1_8 Reverse -239 -252 10.3434 0.168
NP_440590.1_4 Forward -246 -233 2.2809 0.0939
NP_440590.1_4 Reverse -239 -252 1.29759 0.127
NP_440590.1_4 Forward -348 -335 0.60927 0.148
NP_440590.1_4 Reverse -304 -317 -4.9956 0.272
NP_440567.1_1 Reverse -239 -253 18.1908 0.0153
NP_440567.1_1 Forward -246 -232 4.52282 0.118
NP_440567.1_1 Forward -371 -357 0.687908 0.236
NP_442497.1_10 Reverse -239 -248 17.601 0.00813
NP_442497.1_10 Forward -246 -237 10.4228 0.0087
NP_442497.1_10 Reverse -364 -373 0.29472 0.199
NP_440821.1_4 Forward -249 -239 10.7964 0.0146
NP_440821.1_4 Reverse -236 -246 9.41981 0.0286
NP_440821.1_4 Forward -351 -341 5.19158 0.117
NP_440821.1_4 Forward -374 -364 0.275027 0.19
NP_440821.1_4 Reverse -338 -348 -0.511621 0.269
NP_441239.1_9 Reverse -361 -373 18.5252 0.0114
NP_441239.1_9 Forward -249 -237 14.887 0.0247
NP_441239.1_9 Forward -374 -362 11.8387 0.0547
NP_441239.1_9 Forward -351 -339 5.44718 0.221
NP_441239.1_9 Reverse -236 -248 3.38223 0.285
NP_441239.1_9 Reverse -241 -253 3.18557 0.292
NP_441727.1_3 Reverse -231 -250 9.0459 0.197
NP_441727.1_3 Forward -344 -325 8.65258 0.202
NP_441727.1_3 Reverse -356 -375 3.83436 0.275
NP_440665.1_1 Reverse -303 -322 -12.0953 0.244
NP_442044.1_1 Reverse -238 -257 -7.37537 0.224
NP_442044.1_1 Reverse -358 -377 -7.4737 0.224
NP_442193.1_1 Forward -109 -91 9.36059 0.245
NP_442270.1_9 Reverse -195 -214 -7.08038 0.213
NP_442270.1_9 Reverse -227 -246 -8.94866 0.226
NP_441017.1_8 Reverse -360 -375 9.71466 0.215
NP_441874.1_1 Reverse -196 -210 9.14437 0.277
NP_440354.1_5 Reverse -360 -379 12.7825 0.174
NP_441617.1_6 Forward -126 -107 -7.96535 0.297
NP_442138.1_10 Forward -247 -228 -6.1954 0.282
NP_442809.1_6 Reverse -117 -136 5.80098 0.256
NP_440546.1_4 Reverse -238 -248 13.5365 0.0459
NP_440546.1_4 Forward -372 -362 11.3065 0.0872
NP_440546.1_4 Reverse -363 -373 10.6277 0.109
NP_440546.1_4 Forward -247 -237 10.046 0.109
NP_441230.1_5 Reverse -358 -377 7.96426 0.158
NP_440675.1_3 Forward -247 -228 10.3242 0.186
NP_440462.1_6 Forward -249 -239 19.4496 0.00371
NP_440462.1_6 Reverse -338 -348 2.33998 0.29
NP_440462.1_6 Reverse -236 -246 1.35667 0.294
NP_442340.1_3 Forward -278 -259 4.71934 0.113
NP_440868.1_4 Forward -251 -239 7.4138 0.0691
NP_440868.1_4 Reverse -234 -246 5.93884 0.0879
NP_442499.1_3 Reverse -237 -255 11.3272 0.219
NP_442402.1_2 Forward -128 -114 10.422 0.292
NP_442402.1_4 Forward -133 -114 -0.39464 0.189
NP_442402.1_10 Forward -124 -114 13.0576 0.204
NP_441084.1_6 Forward -249 -235 13.9011 0.115
NP_440653.1_10 Reverse -329 -348 6.68596 0.203
NP_440696.1_3 Forward -353 -335 1.29745 0.217
NP_440843.1_3 Reverse -380 -399 9.73422 0.265
NP_442039.1_4 Forward -246 -239 15.1821 0.0124
NP_442039.1_4 Reverse -239 -246 15.1821 0.0124
NP_442039.1_5 Forward -261 -242 19.5673 0.265
NP_441811.1_8 Forward -253 -239 8.45605 0.238
NP_442380.1_10 Forward -322 -304 9.55725 0.262
NP_442409.1_5 Forward -271 -252 12.2908 0.298
NP_441926.1_3 Reverse -238 -254 13.8249 0.0521
NP_440825.1_7 Forward -246 -236 12.9096 0.152
NP_442837.1_3 Forward -246 -239 15.7721 0.0124
NP_442837.1_3 Reverse -239 -246 15.7721 0.0124
NP_442837.1_3 Forward -348 -341 9.18389 0.144
NP_440160.1_2 Reverse -297 -316 -5.80207 0.277
NP_439994.1_3 Reverse -171 -190 10.1945 0.222
NP_442053.1_1 Forward -247 -238 18.3876 0.0007
NP_442053.1_1 Reverse -238 -247 18.3876 0.0007
NP_440505.1_3 Forward -249 -239 15.418 0.0114
NP_440505.1_3 Reverse -236 -246 9.22315 0.122
NP_441203.1_2 Forward -270 -251 -2.85214 0.188
NP_442532.1_1 Forward -28 -14 10.891 0.232
NP_442532.1_7 Reverse -238 -252 6.58777 0.171
NP_442532.1_7 Forward -372 -358 4.42448 0.171
NP_440914.1_1 Forward -247 -237 17.5935 0.000537
NP_440914.1_1 Reverse -238 -248 16.3248 0.00196
NP_441011.1_8 Reverse -239 -248 16.6177 0.00602
NP_441011.1_8 Forward -246 -237 8.25953 0.144
NP_442533.1_1 Forward -273 -254 1.57275 0.118
NP_442533.1_1 Forward -264 -245 -16.6185 0.273
NP_442533.1_6 Forward -247 -238 17.2076 0.00137
NP_442533.1_6 Reverse -238 -247 17.2076 0.00137
NP_442533.1_6 Forward -372 -363 16.5193 0.00338
NP_442533.1_6 Reverse -363 -372 16.5193 0.00338
NP_442533.1_6 Forward -312 -303 10.6195 0.0529
NP_442541.1_10 Forward -372 -358 3.44058 0.254
NP_442322.1_4 Reverse -249 -266 7.3146 0.153
NP_442322.1_4 Reverse -31 -48 -9.7949 0.297
NP_442229.1_1 Forward -249 -235 9.24208 0.184
NP_441482.1_7 Reverse -334 -348 -1.8687 0.0876
NP_441482.1_7 Forward -253 -239 -2.95034 0.103
NP_439944.1_9 Reverse -239 -249 17.7779 0.00341
NP_439944.1_9 Forward -246 -236 10.5014 0.0887
NP_439944.1_9 Forward -371 -361 5.68323 0.231
NP_439944.1_9 Reverse -364 -374 5.28991 0.262
NP_441697.1_5 Forward -27 -8 -11.5072 0.295
NP_442202.1_10 Forward -373 -359 5.89945 0.255
NP_440116.1_5 Reverse -235 -252 6.62702 0.167
NP_440116.1_8 Forward -246 -227 0.294447 0.0998
NP_441527.1_4 Forward -27 -8 -12.0802 0.285
NP_440115.1_6 Forward -250 -240 7.74818 0.146
NP_440007.1_9 Reverse -354 -368 2.06454 0.281
NP_440007.1_9 Forward -376 -362 1.37622 0.285
NP_442492.1_2 Forward -247 -228 6.78429 0.173
NP_441602.1_3 Reverse -335 -354 -1.96717 0.231
NP_441602.1_3 Forward -303 -284 -4.22878 0.261
NP_442673.1_7 Forward -236 -217 12.1748 0.264
NP_441972.1_5 Reverse -346 -365 -5.80207 0.225
NP_441972.1_5 Reverse -329 -348 -8.26035 0.26
NP_441106.1_1 Forward -248 -239 18.486 0.0028
NP_441106.1_1 Reverse -237 -246 9.63616 0.0311
NP_441106.1_1 Reverse -362 -371 5.50626 0.145
NP_440429.1_2 Forward -348 -329 6.98095 0.295
NP_439903.1_6 Forward -250 -231 1.37531 0.248
NP_441286.1_1 Reverse -237 -249 14.6903 0.00418
NP_441286.1_1 Forward -248 -236 3.48056 0.0467
NP_441286.1_1 Reverse -362 -374 -5.07423 0.188
NP_442674.1_3 Forward -380 -361 4.91521 0.282
NP_442674.1_3 Reverse -253 -272 4.03023 0.294
NP_442674.1_9 Forward -169 -150 15.2111 0.287
NP_440670.1_8 Forward -247 -238 18.3876 0.000699
NP_440670.1_8 Reverse -238 -247 18.3876 0.000699
NP_440886.1_7 Forward -248 -238 8.04271 0.0805
NP_440886.1_7 Reverse -237 -247 7.94438 0.0805
NP_442614.1_2 Reverse -363 -377 13.0776 0.133
NP_442072.1_9 Reverse -237 -255 -2.63579 0.0317
NP_442072.1_9 Forward -373 -355 -12.4689 0.0852
NP_442072.1_9 Forward -248 -230 -20.532 0.204
NP_442401.1_2 Reverse -237 -256 6.78348 0.282
NP_441753.1_10 Reverse -354 -373 5.30933 0.186
NP_440028.1_6 Reverse -352 -370 19.587 0.121
NP_440907.2_8 Reverse -239 -249 19.1541 0.00362
NP_440907.2_8 Reverse -341 -351 11.3859 0.0902
NP_440907.2_8 Forward -246 -236 7.64939 0.117
NP_442264.1_2 Reverse -318 -335 9.18362 0.199
NP_441021.1_1 Forward -246 -227 -1.08219 0.11
NP_441021.1_1 Reverse -239 -258 -7.96535 0.192
NP_441021.1_1 Forward -371 -352 -9.73531 0.219
NP_441021.1_2 Forward -221 -202 5.70265 0.276
NP_441463.1_3 Reverse -228 -247 8.94757 0.0481
NP_441463.1_3 Forward -359 -340 -2.55715 0.156
NP_441463.1_3 Reverse -353 -372 -5.80207 0.232
NP_441463.1_6 Reverse -361 -375 8.44524 0.25
NP_441626.1_2 Forward -246 -239 15.7721 0.0124
NP_441626.1_2 Reverse -239 -246 15.7721 0.0124
NP_442211.1_3 Reverse -220 -239 8.93095 0.266
NP_442365.1_7 Reverse -234 -253 -2.0655 0.199
NP_442794.1_1 Reverse -234 -246 2.69391 0.286
NP_442615.1_1 Forward -256 -238 7.19731 0.0324
NP_442615.1_1 Reverse -229 -247 -1.75081 0.132
NP_441962.1_4 Forward -252 -233 -3.73712 0.151
NP_441962.1_4 Reverse -358 -377 -7.86702 0.195
NP_441962.1_4 Forward -342 -323 -11.8003 0.245
NP_440387.1_1 Reverse -238 -254 26.1162 0.000932
NP_440387.1_1 Forward -247 -231 5.86006 0.0304
NP_440387.1_1 Forward -372 -356 -2.5964 0.148
NP_441431.1_2 Forward -250 -236 7.76712 0.234
NP_441431.1_2 Reverse -300 -314 7.17714 0.247
NP_441431.1_3 Reverse -193 -212 5.01433 0.263
NP_441836.1_2 Reverse -297 -316 -0.787193 0.214
NP_441836.1_2 Reverse -357 -376 -1.7705 0.223
NP_441836.1_2 Forward -253 -234 -6.1954 0.292
NP_441993.1_1 Reverse -357 -376 1.75177 0.27
NP_441993.1_1 Forward -318 -299 1.4594 0.276
NP_441993.1_1 Forward -372 -353 0.777198 0.292
NP_442084.1_6 Forward -39 -21 6.90232 0.221
NP_440114.1_10 Reverse -238 -252 15.5359 0.0249
NP_440114.1_10 Forward -247 -233 9.5377 0.169
NP_440114.1_10 Forward -372 -358 5.60446 0.3
NP_440287.1_6 Forward -249 -230 5.30933 0.183
NP_439988.1_7 Reverse -240 -254 12.0937 0.292
NP_441237.1_9 Forward -246 -236 14.828 0.0242
NP_442930.1_1 Forward -12 -2 12.1726 0.239
NP_439910.1_2 Reverse -230 -247 -12.1542 0.0788
NP_440457.1_1 Forward -251 -239 8.00379 0.101
NP_440798.1_6 Reverse -239 -252 1.00259 0.24
NP_442509.1_9 Forward -247 -237 8.14104 0.192
NP_442509.1_9 Reverse -238 -248 8.04271 0.192
NP_441253.1_8 Reverse -233 -247 15.113 0.122
NP_440554.1_4 Reverse -239 -249 15.418 0.0199
NP_440554.1_4 Forward -371 -361 2.7333 0.254
NP_441885.1_5 Forward -247 -237 20.9245 0.000538
NP_441885.1_5 Reverse -238 -248 11.3864 0.00668
NP_441885.1_5 Reverse -303 -313 -0.118297 0.186
NP_441428.1_8 Forward -380 -361 2.55606 0.268
NP_442703.1_9 Reverse -4 -22 3.16574 0.299
NP_442341.1_7 Forward -350 -336 9.34103 0.0751
NP_442341.1_7 Reverse -237 -251 2.35953 0.259
NP_442341.1_9 Forward -249 -235 10.8154 0.133
NP_441756.1_5 Forward -316 -297 16.7157 0.0566
NP_442395.2_4 Reverse -339 -358 -0.00131823 0.28
NP_443000.1_7 Forward -249 -239 10.7964 0.0345
NP_443000.1_7 Reverse -236 -246 10.3048 0.0345
NP_440507.2_3 Forward -316 -297 11.3067 0.19
NP_441842.1_10 Reverse -311 -325 12.3893 0.105
NP_440275.1_3 Forward -249 -239 18.6629 0.0082
NP_440275.1_3 Reverse -236 -246 8.04317 0.0602
NP_440275.1_3 Reverse -278 -288 3.42162 0.229
NP_440275.1_3 Reverse -301 -311 2.7333 0.254
NP_440091.1_1 Reverse -234 -246 8.88877 0.0567
NP_440091.1_1 Forward -251 -239 3.38223 0.163
NP_440091.1_1 Forward -353 -341 2.59558 0.191
NP_440679.1_10 Forward -277 -258 -20.2567 0.283
NP_440679.1_10 Forward -259 -240 -20.4534 0.284
NP_441359.1_5 Forward -375 -356 2.0644 0.28
NP_441359.1_5 Reverse -249 -268 0.392778 0.291
NP_442495.1_5 Forward -318 -299 4.916 0.299
NP_440149.1_8 Reverse -322 -341 -5.31042 0.223
NP_441105.1_3 Forward -383 -364 -3.63879 0.184
NP_441105.1_3 Forward -348 -329 -3.73712 0.185
NP_441105.1_3 Forward -377 -358 -4.13045 0.192
NP_441105.1_3 Reverse -352 -371 -6.78538 0.241
NP_440216.1_1 Reverse -238 -252 6.29277 0.0156
NP_440216.1_1 Forward -312 -298 4.81781 0.0229
NP_440216.1_1 Forward -247 -233 -1.77037 0.0383
NP_440216.1_1 Reverse -363 -377 -11.9968 0.236
NP_440172.1_1 Reverse -238 -248 17.5813 0.00421
NP_440172.1_1 Forward -247 -237 15.0247 0.00945
NP_440172.1_1 Forward -372 -362 5.19158 0.149
NP_440172.1_1 Reverse -363 -373 3.91327 0.213
NP_440172.1_1 Forward -312 -302 2.43831 0.279
NP_442015.1_10 Reverse -273 -286 8.9674 0.0569
NP_442015.1_10 Reverse -234 -247 1.59258 0.204
NP_442015.1_10 Reverse -353 -366 -1.06236 0.293
NP_441226.1_7 Forward -246 -239 14.4934 0.0123
NP_441226.1_7 Reverse -239 -246 14.4934 0.0123
NP_441757.1_3 Forward -367 -348 -1.18052 0.245
NP_441111.1_7 Forward -246 -238 18.7023 0.00294
NP_441111.1_7 Reverse -239 -247 18.7023 0.00294
NP_442379.1_10 Forward -254 -237 10.4619 0.0932
NP_442379.1_10 Reverse -231 -248 3.97208 0.16
NP_441766.1_2 Forward -247 -238 17.5026 0.00297
NP_441766.1_2 Reverse -238 -247 17.5026 0.00297
NP_440416.1_9 Reverse -296 -315 -20.945 0.289
NP_443052.1_8 Reverse -228 -247 -8.06369 0.168
NP_443052.1_9 Reverse -251 -270 -5.60541 0.271
NP_442116.1_6 Forward -22 -5 8.55092 0.247
NP_442116.1_6 Reverse -6 -23 5.68616 0.291
NP_440591.1_9 Reverse -198 -216 3.95239 0.294
NP_442154.1_1 Forward -261 -243 -17.1888 0.249
NP_442154.1_1 Forward -275 -257 -17.9754 0.273
NP_442226.1_8 Forward -164 -154 14.828 0.256
NP_440261.1_5 Reverse -364 -377 6.70579 0.0318
NP_440261.1_5 Reverse -239 -252 -10.6005 0.201
NP_440988.1_10 Forward -314 -300 4.51157 0.259
NP_440988.1_10 Forward -374 -360 3.73707 0.281
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

GGCCAAACTTGGCGCAACATCTTCTCAGGGCCATGGCCTCCGCATTGGAGCTTGGATCGCCGTAGCTATTGCAATCAATCTCTTCCGTGCCGGTGGCCTGGCGGGTAATGCTCCGGTCTTCCCCGTGGATTGTGAGGGAGCCGGTGAGGGTGAGGCGATCGCCAATTTGTTGGGTGTCAATGATCAGGCATTCCCAACCTCCAAGGCCACATAATCAATCTGGTTTCCCTTGAGGAATTTTTGACTGATAAATTGGAAAGCAATAGGTTGCTGTAGGTTTTCCAGAATTCCGGTCAGGAGTAAGGTGCAGTTTACCCTTGCCCGGAAAAAGCATCGTACAATATTAATACAAGGGTCGGGCTTTAAGCGTGGTAAAGAATTTAATTACAAATAATTTTCT

CDS

ATGATTGTTGAACGGTGCTATTTTCCTCTACCAAAATACTTTTTCTGTGATGGTCCATCTTATGTCATCACTTCCTCTAGTTTTGGTGGCAGTTTATTAACCCCAGAAACCTTACCAGAGCTTCTACAAAATGGGGATGAAAAAGTTATTAATCAGCTTTTAGAAGAAGGAATTTGTTTACCATTATTCTTTCCTGGGGACTGTGCCTTAGATGGGGCAATTTTTATAGTAGGAGATTTAACCCCTATTGAAGAACAGGAATGGATTGGACGCATTCAAAGCAAGTTAAAAATTCCCTGTGGTAAATTATTAGTGGTTTGTGGAGGTGGTTCCCCAGAGGATTTTGAAGGAGTGATCGCTGGGAATGGTATCAATGATTATACTGACTATTTTTGTGTCTTGGATGTACCAAAAGGGGACTATTTAGTGGAAGTATTAGCCTATGTTTCGAGTATGAGTGTTGATTTTTATTTTGAAGAAAACGAACCCTTAACAGAATGGTTTTATCGCACTCGGCCAGGAGAGATTTTACCGCAATGGTTAGAAACTTTTCAATCCAAAGGTTATATTGGGGAACTAAGTGATCAACTTTTAACTTATATTGTACATCTAACTCCCTTGATTGATGAGCCATCTTTACTAACTCTTATATCTGAAATTGGTTGGTGTGGGGAATTTGAATTCCGTCGTCCAGAAATTTGTCCTAGGGGAATTCCTCGGAGCTATTATGCTTAA

Protein

No sequence available