Your browser is old and dusty. Try Google Chrome!

Details for slr5055

ORF slr5055
Accession NP_942211.1
Symbol
Category Other
Definition similar to UDP-N-acetyl-D-mannosaminuronic acid transferase
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_441061.1_2 Forward -166 -152 -0.590395 0.234
NP_442752.1_4 Reverse -135 -142 4.95566 0.26
NP_440061.1_9 Forward -156 -142 6.98048 0.223
NP_441054.1_2 Reverse -170 -189 11.1109 0.271
NP_439979.1_9 Reverse -141 -159 8.37728 0.263
NP_442062.1_8 Forward -358 -348 6.56821 0.123
NP_442207.1_1 Reverse -314 -333 6.09597 0.204
NP_439918.1_2 Forward -303 -284 -3.44213 0.254
NP_441200.1_4 Reverse -300 -319 15.8307 0.151
NP_441738.1_2 Reverse -324 -331 6.03696 0.295
NP_442889.1_8 Forward -32 -18 4.42388 0.267
NP_442760.1_5 Reverse -348 -360 15.8697 0.254
NP_440403.1_4 Reverse -217 -236 -10.227 0.297
NP_441012.1_4 Reverse -113 -126 6.1158 0.286
NP_442720.1_8 Reverse -368 -386 10.5406 0.297
NP_441971.1_4 Reverse -163 -182 18.7798 0.212
NP_440203.1_5 Reverse -351 -361 10.6976 0.215
NP_443001.1_7 Reverse -158 -177 0.491109 0.297
NP_442536.1_4 Forward -191 -173 6.60732 0.3
NP_442051.1_5 Reverse -195 -214 9.63589 0.29
NP_441000.1_5 Forward -194 -175 14.9449 0.114
NP_441041.1_4 Reverse -158 -177 -6.39206 0.167
NP_441725.1_5 Forward -159 -149 -1.19994 0.294
NP_442941.1_5 Forward -182 -168 14.2385 0.298
NP_440260.1_8 Forward -373 -355 -6.4707 0.291
NP_442281.1_1 Reverse -344 -358 1.96562 0.282
NP_442288.1_3 Forward -286 -269 6.43035 0.269
NP_441556.1_4 Forward -138 -119 10.5835 0.279
NP_442215.1_2 Reverse -162 -178 3.00846 0.104
NP_441762.1_7 Reverse -113 -125 -5.95921 0.258
NP_442142.1_4 Forward -18 -5 2.87033 0.273
NP_440919.1_7 Forward -314 -296 5.74015 0.285
NP_440919.1_7 Forward -184 -166 4.67968 0.289
NP_441523.1_6 Reverse -328 -347 4.22769 0.261
NP_440970.1_1 Forward -57 -43 17.2075 0.279
NP_441876.1_9 Reverse -4 -14 12.3692 0.267
NP_441826.1_2 Forward -129 -115 -4.13031 0.292
NP_441826.1_5 Reverse -146 -165 4.22769 0.259
NP_441764.1_8 Reverse -287 -297 11.5978 0.284
NP_442719.1_2 Forward -195 -177 -10.3063 0.272
NP_441906.1_2 Reverse -353 -372 1.96529 0.286
NP_442050.1_5 Reverse -320 -330 7.55106 0.251
NP_441114.1_3 Reverse -350 -359 8.25953 0.231
NP_441114.1_3 Forward -356 -347 6.39124 0.277
NP_440558.1_2 Reverse -142 -161 1.47442 0.181
NP_441878.1_4 Reverse -162 -181 4.62101 0.271
NP_441433.1_8 Reverse -165 -184 0.392778 0.24
NP_440979.1_6 Reverse -316 -335 15.2408 0.27
NP_440276.1_8 Forward -318 -299 6.58763 0.277
NP_442347.1_2 Reverse -323 -332 4.81794 0.257
NP_441411.1_3 Reverse -159 -178 11.7992 0.0705
NP_440151.1_5 Forward -376 -357 3.44104 0.288
NP_441633.1_3 Reverse -112 -125 -7.25721 0.3
NP_442158.1_4 Forward -294 -284 10.6981 0.283
NP_441464.1_10 Forward -366 -352 13.7659 0.199
NP_441464.1_10 Forward -294 -280 7.66941 0.295
NP_440327.1_6 Forward -303 -284 15.2408 0.13
NP_440161.1_3 Forward -125 -106 7.96426 0.282
NP_440408.1_3 Forward -166 -147 -4.81876 0.272
NP_441138.1_5 Forward -294 -281 3.97694 0.297
NP_441789.1_7 Forward -159 -140 -1.08295 0.251
NP_439977.1_6 Reverse -213 -231 16.0471 0.271
NP_441572.1_1 Forward -169 -150 -1.96717 0.212
NP_440163.1_10 Forward -129 -119 8.63316 0.266
NP_440282.1_3 Reverse -159 -178 -0.4922 0.291
NP_441335.1_8 Reverse -175 -194 11.0125 0.204
NP_441640.1_8 Reverse -159 -178 -0.4922 0.197
NP_440297.1_9 Reverse -165 -175 4.20827 0.238
NP_440350.1_5 Forward -305 -286 0.196116 0.166
NP_440894.1_4 Forward -178 -159 28.9088 0.00123
NP_442553.1_7 Forward -147 -133 14.4542 0.284
NP_440999.1_2 Reverse -217 -236 8.75091 0.288
NP_440052.1_4 Reverse -266 -285 10.8159 0.239
NP_443064.1_6 Forward -150 -140 8.6886 0.276
NP_442120.1_10 Forward -166 -147 -13.8652 0.288
NP_442612.1_1 Forward -134 -119 12.5663 0.294
NP_441867.1_2 Reverse -208 -227 -15.6352 0.291
NP_440673.1_3 Reverse -119 -126 8.20058 0.234
NP_442219.1_8 Reverse -338 -357 8.45701 0.245
NP_440436.1_4 Forward -122 -113 7.17747 0.136
NP_441321.1_5 Reverse -177 -196 4.81767 0.265
NP_441004.1_1 Reverse -146 -165 -13.2752 0.256
NP_442366.1_3 Forward -124 -106 -4.99573 0.28
NP_440593.1_3 Forward -159 -140 -1.18052 0.211
NP_441409.1_3 Reverse -267 -286 15.2408 0.0353
NP_441409.1_6 Reverse -20 -39 -13.7669 0.243
NP_442843.1_1 Reverse -171 -190 -9.93197 0.272
NP_442348.1_2 Forward -254 -245 9.53783 0.28
NP_440526.1_3 Reverse -115 -126 5.46638 0.247
NP_441233.1_6 Reverse -165 -184 7.96345 0.295
NP_441112.1_8 Forward -254 -235 3.53937 0.232
NP_441973.1_1 Forward -282 -267 -0.216765 0.271
NP_441769.1_3 Forward -185 -166 -5.90115 0.249
NP_440833.1_6 Forward -188 -174 9.43874 0.263
NP_440080.2_2 Forward -361 -347 18.2765 0.165
NP_442340.1_6 Reverse -28 -47 18.289 0.221
NP_442402.1_4 Reverse -268 -287 -8.55607 0.283
NP_442402.1_6 Reverse -173 -182 12.9794 0.289
NP_442402.1_10 Forward -184 -174 12.7626 0.204
NP_441848.1_7 Forward -188 -169 -1.37794 0.247
NP_442039.1_7 Reverse -172 -182 6.96153 0.286
NP_442039.1_7 Forward -171 -161 6.76487 0.299
NP_442679.1_1 Reverse -163 -182 -2.36049 0.24
NP_441252.1_6 Reverse -314 -321 11.9372 0.25
NP_441482.1_7 Reverse -145 -159 -9.73518 0.209
NP_440429.1_9 Reverse -210 -229 10.3242 0.195
NP_442588.1_5 Forward -138 -119 8.75091 0.272
NP_001035870.1_3 Forward -303 -284 2.45773 0.163
NP_441705.1_3 Reverse -172 -191 -4.81876 0.291
NP_439955.1_10 Forward -150 -131 12.4867 0.258
NP_441021.1_1 Forward -206 -187 -11.3086 0.259
NP_442087.1_2 Reverse -235 -254 17.9557 0.117
NP_441332.1_3 Forward -167 -148 10.3242 0.173
NP_441275.1_5 Forward -182 -163 13.8633 0.276
NP_441756.1_5 Forward -229 -210 3.6377 0.199
NP_441173.1_9 Reverse -381 -389 11.7204 0.226
NP_440191.1_4 Forward -182 -172 15.9599 0.254
NP_442122.1_9 Forward -175 -156 18.0924 0.207
NP_442354.1_8 Forward -293 -274 7.7676 0.266
NP_441389.1_5 Reverse -203 -222 17.8957 0.186
NP_440216.1_9 Reverse -147 -156 5.40793 0.294
NP_442371.1_1 Reverse -174 -184 13.9425 0.191
NP_442015.1_10 Forward -199 -186 -1.16069 0.297
NP_443052.1_9 Forward -165 -146 -3.93378 0.253
NP_442154.1_1 Reverse -126 -144 -11.1906 0.213
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

CAGAGAAGCATTGGGTTAAAGAAAGCCGCAGTATTTGGTTCTGGGCATTGATCATTCCAGTTGTCAGTCTGGGATCTAGTTGCCCCACTTTCGGTCTGAGCTTAGTTTTGCTGTTGGGTTACCCGTTGATTATCTATAAAACGGCACGGTATTTTCAGCAACAAGGATTATCCGCCCAGTTAGCCTGGCTCTATGCCACTTCCTGTCTGCTAGCCAAATTTCCCCAGTTCATTGGCCAACTGCGTTTTCACTGGCTCCGCCTCACCAAACAAACAGCGACGATTGTTGAATATAAAGCTCGATCATAAAGTTATACGGTGCGTAAACAAAACATAGACATGAGCTTAAACAGTCCTGCTCGAAGATGAAAGTGTCATCAAAAAAACACCGGGGCTAAGCA

CDS

ATGAATTCCATCACGCTTCTCAACACAACGATCCATAACTACTCCATGGTTGAGTTACTTGAAGATCTCAATAAGCGTGGTGGATTTGTGGTTACGCCAAATGTGGATCACATGGTTAAGTTGCAGGAAGATGCTGAGCTGCAAGAGGTTTACCAAGTGGCAGATTACCGAGTTTGTGATAGCAAAATCATTGAATACATTCTCAAACTGTTAGGTACACCGATTAAAGAGAAAATCTCTGGTTCTGACTTGTTTCCTGCTTTTTATGAATACAACAAAGACAATACTGATACCAAAATCTTTCTGCTCGGTGCTAAAGAAGGGGTAGCCGATCGCGCTCGCCAAAAAATCAATGAAAAAGTAGGCCGAGAGATGATTGTTGATTCCTATTCCCCTAGCTTCGGCTTTGAGCAAAATCCTGAAGAATGTGCCTACATTCTAGAGCGCATCAAACAATCCGGTGCCACCGTGTTAGCAGTGGGTCTTGGGGCTCCCAAGCAAGAAAAGTGGATTGCTAAATATCGTCATCAACTGCCCAATATCAAAATTTTTCTGGCGATCGGCGCTACCATCGACTTCGAAGCGGGTGAAAAAGCCCGTTCCCCCCAATGGATGAGCAAAGTCGGGTTGGAGTGGCTCCACCGCTTAGCCTCTGAACCTCAGCGGTTATGGAAGCGTTACTTGGTGGAAAGCCTACCGTTCTTTGCCTTGGTGTTACAGTACAAACTGCAAACCCTTCTGTCTGAGCCTGCTTATCCTCAGTTATCTACTGCTGATTCTCGGACCGTTTAG

Protein

No sequence available