Your browser is old and dusty. Try Google Chrome!

Details for slr5037

ORF slr5037
Accession NP_942193.1
Symbol
Category
Definition
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_440226.1_1 Forward -367 -348 6.4893 0.128
NP_442752.1_4 Forward -367 -360 15.0838 0.0199
NP_442752.1_4 Reverse -102 -109 9.47889 0.109
NP_441812.1_1 Reverse -340 -354 17.7968 0.17
NP_441812.1_3 Forward -368 -354 10.3243 0.222
NP_442975.1_10 Reverse -354 -368 8.45543 0.0964
NP_440928.1_5 Forward -41 -23 8.96727 0.192
NP_441145.1_1 Forward -172 -153 3.93269 0.269
NP_442062.1_8 Reverse -152 -162 4.89658 0.193
NP_442062.1_8 Forward -367 -357 4.20827 0.228
NP_440304.1_4 Reverse -150 -160 4.40493 0.266
NP_441581.1_9 Forward -20 -1 5.20389 0.296
NP_440300.1_1 Forward -152 -133 8.4551 0.244
NP_441925.1_4 Forward -160 -141 -6.3928 0.185
NP_441925.1_4 Forward -164 -145 -14.5542 0.263
NP_441925.1_4 Forward -277 -258 -16.4225 0.282
NP_441434.1_1 Forward -212 -198 7.07802 0.288
NP_440645.1_10 Reverse -326 -345 8.35759 0.245
NP_441738.1_2 Reverse -360 -367 11.7401 0.0647
NP_441738.1_2 Forward -267 -260 6.52862 0.261
NP_442889.1_1 Forward -205 -186 0.884433 0.145
NP_442889.1_8 Forward -222 -208 3.34225 0.281
NP_441713.1_3 Reverse -143 -162 3.04771 0.259
NP_442570.1_3 Forward -190 -171 -6.29373 0.257
NP_441716.1_2 Forward -95 -76 -1.62095 0.289
NP_441327.1_1 Reverse -220 -239 7.38498 0.235
NP_440343.1_3 Forward -152 -134 2.77167 0.291
NP_440343.1_9 Reverse -251 -270 23.1072 0.0463
NP_440747.1_10 Reverse -156 -168 -11.9574 0.178
NP_441014.1_8 Forward -155 -136 3.44104 0.214
NP_441182.1_7 Reverse -200 -213 18.6038 0.234
NP_440376.1_1 Reverse -152 -161 11.2095 0.0265
NP_440376.1_1 Forward -168 -159 4.32629 0.163
NP_440376.1_1 Forward -279 -270 0.0980582 0.285
NP_440376.1_1 Reverse -144 -153 -0.295266 0.286
NP_441846.1_10 Reverse -136 -155 -22.2233 0.257
NP_440642.1_10 Forward -348 -334 1.37564 0.293
NP_441950.1_7 Reverse -147 -166 1.57275 0.175
NP_442300.1_10 Reverse -151 -170 10.1275 0.293
NP_441958.1_5 Forward -368 -358 0.766681 0.124
NP_441958.1_5 Forward -169 -159 -0.0199663 0.178
NP_442836.1_10 Reverse -261 -271 16.4013 0.208
NP_439905.1_2 Forward -160 -146 8.84938 0.241
NP_440984.1_7 Forward -372 -358 8.45605 0.144
NP_440984.1_7 Forward -333 -319 5.40779 0.257
NP_443055.1_6 Forward -161 -143 -0.866561 0.268
NP_441099.1_9 Reverse -56 -75 14.0608 0.266
NP_440377.1_1 Reverse -114 -131 13.8828 0.22
NP_441000.1_6 Reverse -151 -165 -5.40861 0.275
NP_440147.1_4 Forward -170 -157 -0.177378 0.276
NP_441916.1_7 Reverse -358 -368 6.56821 0.0919
NP_441041.1_4 Reverse -159 -178 -3.83545 0.126
NP_440569.1_6 Reverse -136 -155 4.03102 0.24
NP_442004.1_6 Reverse -358 -372 4.03116 0.227
NP_441725.1_1 Reverse -197 -216 21.5339 0.029
NP_439966.1_7 Forward -271 -261 10.796 0.0811
NP_439966.1_9 Reverse -258 -267 3.83464 0.253
NP_442941.1_3 Forward -366 -356 5.38824 0.115
NP_442281.1_1 Reverse -353 -367 5.60385 0.152
NP_441644.1_6 Reverse -159 -169 6.56775 0.154
NP_442177.1_5 Reverse -258 -272 11.996 0.22
NP_442933.1_10 Reverse -358 -367 5.3096 0.203
NP_441751.2_8 Forward -167 -153 -6.58858 0.273
NP_442292.1_5 Reverse -266 -285 -0.983855 0.257
NP_442381.1_8 Reverse -141 -160 -13.6686 0.279
NP_443009.1_5 Reverse -151 -162 5.17139 0.214
NP_441865.1_3 Reverse -80 -98 13.3922 0.249
NP_439939.1_1 Forward -339 -320 14.9449 0.275
NP_441020.2_6 Reverse -149 -166 6.52869 0.262
NP_441673.1_1 Forward -168 -159 -7.86675 0.187
NP_441673.1_1 Reverse -159 -168 -7.96508 0.206
NP_441339.1_1 Forward -234 -215 17.762 0.165
NP_441826.1_5 Reverse -249 -268 2.3594 0.276
NP_441764.1_8 Forward -217 -207 12.2678 0.284
NP_442868.1_6 Reverse -157 -167 0.57002 0.217
NP_442808.1_1 Forward -154 -144 5.97777 0.134
NP_442808.1_1 Forward -155 -145 1.94622 0.281
NP_442542.1_2 Forward -163 -150 5.62415 0.257
NP_442050.1_5 Reverse -356 -366 10.206 0.162
NP_442342.1_9 Reverse -268 -284 19.8231 0.0512
NP_442342.1_9 Forward -271 -255 7.82668 0.2
NP_440601.1_10 Forward -39 -20 10.2259 0.29
NP_440346.1_6 Forward -103 -93 17.2569 0.14
NP_441878.1_6 Reverse -151 -161 -7.29646 0.217
NP_441036.1_8 Forward -368 -358 9.91146 0.174
NP_441557.1_5 Forward -367 -358 -0.786921 0.239
NP_441557.1_8 Forward -152 -142 10.8943 0.273
NP_441445.1_8 Reverse -248 -267 -11.9969 0.277
NP_441590.1_1 Forward -145 -126 8.35759 0.297
NP_441590.1_4 Forward -270 -251 7.57013 0.249
NP_441458.1_10 Reverse -24 -43 1.37609 0.29
NP_442183.1_1 Forward -367 -353 4.42448 0.261
NP_442347.1_2 Reverse -359 -368 6.39124 0.17
NP_442347.1_2 Reverse -211 -220 4.32629 0.284
NP_442645.1_2 Reverse -151 -170 -14.3569 0.173
NP_441633.1_3 Forward -163 -150 -4.79893 0.212
NP_440136.1_2 Forward -366 -359 3.97235 0.288
NP_442998.1_2 Forward -163 -144 16.6165 0.0561
NP_442998.1_5 Forward -245 -235 9.32148 0.243
NP_442998.1_5 Reverse -267 -277 8.23984 0.267
NP_442998.1_10 Reverse -360 -367 5.74231 0.255
NP_441559.1_8 Forward -192 -178 10.1277 0.0614
NP_441559.1_8 Forward -166 -152 5.01447 0.102
NP_440915.1_6 Forward -283 -269 -1.77037 0.246
NP_442855.1_3 Reverse -249 -268 14.0608 0.21
NP_441464.1_8 Forward -161 -147 6.6861 0.226
NP_441464.1_8 Reverse -268 -282 5.01447 0.26
NP_441464.1_10 Reverse -92 -106 9.34103 0.262
NP_442993.1_1 Forward -168 -152 -11.1512 0.235
NP_442386.1_9 Forward -270 -261 7.37413 0.219
NP_440570.1_7 Forward -267 -248 14.5524 0.287
NP_441340.1_9 Reverse -341 -351 7.00193 0.297
NP_441506.1_1 Reverse -344 -363 12.672 0.283
NP_440211.1_1 Forward -158 -139 15.8299 0.155
NP_442959.1_5 Forward -71 -52 4.916 0.298
NP_441912.1_3 Reverse -319 -338 6.88262 0.27
NP_443051.1_1 Forward -368 -359 0.29472 0.195
NP_439937.1_9 Forward -165 -148 -15.6947 0.287
NP_439937.1_9 Forward -114 -97 -17.3663 0.298
NP_440439.1_1 Forward -370 -357 3.46087 0.114
NP_442783.1_8 Forward -107 -88 14.9449 0.266
NP_442663.1_1 Reverse -218 -237 7.4718 0.193
NP_439977.1_5 Forward -275 -256 -1.18052 0.244
NP_441572.1_1 Forward -331 -312 -6.68705 0.294
NP_440267.1_2 Reverse -353 -367 16.9119 0.05
NP_442887.1_5 Forward -137 -118 -4.03212 0.264
NP_442384.1_10 Reverse -358 -371 3.16588 0.199
NP_441689.1_5 Reverse -356 -366 15.0242 0.0617
NP_441965.1_10 Reverse -355 -371 4.68009 0.234
NP_440350.1_5 Forward -361 -342 -3.63879 0.261
NP_441778.1_10 Forward -363 -345 14.5122 0.251
NP_440999.1_1 Forward -272 -253 8.06178 0.156
NP_440888.1_2 Reverse -152 -166 10.422 0.0946
NP_440888.1_2 Reverse -270 -284 9.53707 0.123
NP_442033.1_10 Forward -271 -252 -7.86702 0.186
NP_442845.1_2 Reverse -313 -327 10.9143 0.14
NP_442845.1_2 Forward -373 -359 4.81781 0.251
NP_442845.1_2 Forward -285 -271 4.32615 0.261
NP_440739.1_7 Forward -367 -348 11.2092 0.25
NP_440982.1_1 Forward -155 -136 4.03023 0.294
NP_442710.1_7 Forward -84 -65 0.0816015 0.194
NP_442710.1_7 Reverse -192 -211 -3.47446 0.263
NP_441469.1_8 Forward -162 -153 11.6028 0.158
NP_443064.1_6 Reverse -358 -368 8.6886 0.276
NP_442337.1_8 Reverse -240 -259 -0.590531 0.276
NP_441223.1_7 Forward -338 -320 20.8645 0.0952
NP_440710.1_1 Forward -190 -172 -1.94747 0.188
NP_441462.1_2 Forward -367 -357 0.176696 0.161
NP_441462.1_2 Reverse -159 -169 -0.511621 0.236
NP_441462.1_2 Forward -168 -158 -1.10161 0.281
NP_443062.1_1 Reverse -358 -376 3.57305 0.293
NP_443062.1_6 Forward -60 -41 9.14423 0.131
NP_442204.1_1 Forward -191 -180 0.648657 0.281
NP_441353.1_8 Reverse -260 -279 18.2673 0.245
NP_441443.1_1 Reverse -144 -163 -0.983855 0.238
NP_440673.1_7 Reverse -141 -160 2.45773 0.226
NP_441719.1_4 Forward -366 -359 3.77569 0.285
NP_441733.1_10 Reverse -257 -270 9.36073 0.119
NP_441004.1_1 Reverse -126 -145 -11.1119 0.234
NP_441004.1_1 Reverse -308 -327 -11.5053 0.24
NP_441004.1_1 Reverse -146 -165 -12.1936 0.245
NP_441004.1_1 Reverse -147 -166 -17.9951 0.296
NP_441004.1_2 Reverse -303 -322 1.47442 0.22
NP_442813.1_4 Reverse -85 -104 -4.6221 0.299
NP_442366.1_5 Forward -370 -360 14.6309 0.0426
NP_442873.1_5 Forward -262 -243 10.9134 0.246
NP_443054.1_2 Reverse -187 -201 1.57289 0.245
NP_442430.1_6 Forward -24 -5 13.5691 0.271
NP_441851.1_3 Reverse -250 -269 10.4225 0.258
NP_441851.1_10 Reverse -151 -161 5.19158 0.221
NP_441851.1_10 Forward -368 -358 4.50326 0.266
NP_441542.1_4 Reverse -308 -322 4.81781 0.264
NP_441396.1_5 Reverse -95 -104 8.1612 0.224
NP_440593.1_3 Forward -160 -141 -7.27704 0.291
NP_441540.1_1 Forward -84 -65 18.7798 0.12
NP_440432.1_9 Forward -366 -351 -5.82163 0.267
NP_440588.1_3 Reverse -103 -122 12.0942 0.248
NP_440483.1_1 Reverse -139 -158 -2.75381 0.208
NP_441078.1_4 Forward -161 -152 -1.57357 0.266
NP_442729.1_8 Reverse -148 -161 8.9674 0.125
NP_441539.1_2 Forward -85 -66 24.1889 0.00956
NP_441539.1_2 Reverse -64 -83 22.2223 0.0261
NP_440526.1_3 Forward -268 -257 7.23633 0.156
NP_441432.1_8 Forward -37 -28 2.55633 0.298
NP_441732.1_2 Forward -172 -156 -17.2477 0.247
NP_440760.1_1 Forward -161 -142 -19.6667 0.219
NP_442797.1_2 Reverse -28 -46 14.3104 0.22
NP_442797.1_7 Reverse -151 -169 2.87075 0.238
NP_441131.1_5 Reverse -260 -279 3.6377 0.251
NP_440578.1_8 Reverse -126 -145 11.3075 0.264
NP_442489.1_7 Reverse -152 -161 -1.6719 0.235
NP_441659.2_8 Reverse -159 -169 5.38824 0.108
NP_440025.1_3 Reverse -265 -279 11.6757 0.288
NP_440025.1_3 Reverse -223 -237 10.2235 0.29
NP_442900.1_1 Reverse -90 -109 -5.21209 0.233
NP_441050.1_5 Reverse -99 -117 -1.65248 0.265
NP_442140.1_3 Reverse -304 -314 4.89658 0.238
NP_442723.1_1 Forward -120 -101 6.39016 0.276
NP_442028.1_1 Forward -72 -59 9.89744 0.251
NP_440567.1_1 Reverse -359 -373 2.5562 0.17
NP_441951.1_9 Forward -163 -144 5.01433 0.254
NP_442568.1_5 Reverse -190 -209 13.5691 0.177
NP_442325.1_6 Forward -159 -140 -2.0655 0.282
NP_442325.1_8 Forward -247 -228 14.2097 0.29
NP_442138.1_10 Forward -367 -348 -7.67036 0.29
NP_440546.1_4 Reverse -319 -329 7.91294 0.214
NP_440462.1_6 Forward -369 -359 5.48657 0.15
NP_442611.1_1 Reverse -255 -274 14.9458 0.0513
NP_442402.1_10 Forward -197 -187 13.2542 0.204
NP_442402.1_10 Reverse -221 -231 12.9592 0.204
NP_441084.1_6 Forward -98 -84 11.6711 0.194
NP_439942.1_2 Reverse -340 -359 12.6962 0.269
NP_440696.1_3 Forward -52 -34 1.19912 0.22
NP_442039.1_7 Reverse -185 -195 7.45319 0.276
NP_442837.1_3 Reverse -359 -366 8.79057 0.165
NP_440505.1_3 Forward -163 -153 7.84651 0.147
NP_440505.1_3 Reverse -187 -197 4.99491 0.252
NP_442533.1_1 Reverse -134 -153 -10.1286 0.231
NP_442533.1_1 Reverse -135 -154 -16.3235 0.265
NP_442533.1_6 Forward -161 -152 5.3096 0.145
NP_442533.1_6 Reverse -270 -279 4.12963 0.191
NP_442533.1_6 Reverse -159 -168 2.26134 0.266
NP_442232.1_3 Reverse -148 -167 -8.94866 0.239
NP_442322.1_4 Forward -156 -139 8.29791 0.151
NP_442322.1_4 Forward -155 -138 -9.49991 0.295
NP_441028.1_6 Reverse -380 -390 7.45273 0.229
NP_441527.1_4 Forward -21 -2 -7.40105 0.232
NP_441527.1_4 Reverse -343 -362 -8.26048 0.242
NP_441527.1_4 Reverse -339 -358 -12.3666 0.285
NP_440007.1_9 Forward -191 -177 1.37622 0.285
NP_440670.1_8 Forward -132 -123 3.24465 0.29
NP_439955.1_7 Forward -277 -260 16.2635 0.27
NP_440886.1_7 Forward -154 -144 4.30615 0.243
NP_440886.1_7 Forward -162 -152 3.12618 0.296
NP_442614.1_2 Forward -168 -154 9.34103 0.242
NP_441399.1_10 Reverse -151 -170 14.4541 0.213
NP_442072.1_9 Reverse -151 -169 -22.007 0.216
NP_441069.1_1 Reverse -259 -276 24.2283 0.0322
NP_440907.2_8 Reverse -359 -369 5.48612 0.198
NP_440907.2_8 Forward -268 -258 5.28945 0.209
NP_442842.1_10 Reverse -1 -20 4.83391 0.213
NP_439958.1_2 Reverse -348 -362 15.8309 0.175
NP_442615.1_1 Forward -376 -358 -4.79907 0.194
NP_440387.1_1 Reverse -159 -175 -6.03799 0.262
NP_440387.1_1 Forward -161 -145 -6.52964 0.292
NP_442647.1_7 Forward -146 -133 15.3589 0.169
NP_441174.1_1 Reverse -144 -159 15.4179 0.231
NP_441510.2_7 Reverse -306 -320 9.83206 0.281
NP_441272.1_7 Reverse -94 -104 15.9097 0.2
NP_440766.1_4 Reverse -256 -270 5.01447 0.117
NP_439988.1_3 Reverse -257 -271 6.98109 0.278
NP_439910.1_2 Reverse -350 -367 -22.2823 0.22
NP_440457.1_1 Reverse -256 -268 2.39892 0.212
NP_442680.1_5 Reverse -337 -356 3.58908 0.229
NP_441332.1_6 Forward -270 -260 11.9372 0.239
NP_441332.1_6 Forward -155 -145 10.7754 0.287
NP_440756.1_1 Forward -72 -53 15.5003 0.294
NP_440185.1_9 Reverse -96 -113 11.7402 0.276
NP_441885.1_5 Forward -168 -158 -0.314959 0.195
NP_442341.1_7 Forward -133 -119 3.8345 0.21
NP_441173.1_9 Forward -318 -310 13.2937 0.17
NP_441173.1_9 Forward -195 -187 10.9338 0.242
NP_442395.2_4 Forward -162 -143 -0.0996487 0.282
NP_440191.1_4 Reverse -223 -233 15.572 0.254
NP_441561.1_7 Forward -157 -138 5.99684 0.274
NP_441842.1_1 Reverse -360 -373 14.4733 0.105
NP_441842.1_10 Forward -374 -360 7.9644 0.238
NP_441635.1_1 Reverse -42 -61 3.96249 0.275
NP_441207.1_7 Reverse -352 -366 10.514 0.262
NP_441207.1_7 Reverse -344 -358 7.90002 0.293
NP_439962.1_8 Reverse -223 -242 8.55425 0.21
NP_440175.1_4 Reverse -144 -163 -2.95047 0.122
NP_441804.1_1 Reverse -116 -135 16.4207 0.113
NP_440216.1_1 Reverse -152 -166 -1.5737 0.034
NP_440216.1_9 Reverse -339 -348 12.5861 0.227
NP_440046.1_7 Reverse -179 -198 8.35759 0.297
NP_441766.1_2 Reverse -159 -168 1.1797 0.299
NP_440416.1_1 Forward -168 -149 -14.0619 0.284
NP_443052.1_8 Reverse -348 -367 -10.7186 0.214
NP_443052.1_9 Forward -166 -147 -6.98204 0.291
NP_443052.1_9 Forward -271 -252 -7.27704 0.295
NP_442403.1_9 Reverse -120 -139 6.68596 0.193
NP_442154.1_1 Reverse -145 -163 -15.2222 0.218
NP_441430.1_2 Forward -195 -176 0.786102 0.161
NP_440261.1_5 Forward -278 -265 -6.76555 0.201
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

TTAAGGTCTCATGGGTGTAAATACGTTTCTGTAGGGGATCGATTTTTTGTACTTTTCCTTGCACCCACTTGAACCCATGCCGTTTTGCCAACATCGGTACATTTAATTGCATGTGGTCTAAGGGGATGTGCCCCAATCCCACCTGAACCAGTCCAGGTACAAATGTGAATTGTGGAAATTCTGAGATCAAAATTACTTGATGAGCTTTTCCCAGGTAATGCCTTAACTCGTAGGCGGCCGGCAGTCCCCCTAACCCCGCTCCAATTACGACAATCTGCGCCATTTTAAACTCCCTCCCCCCAAAAACTATTGACGAATACAACTATGTAGTTATATTCTTATAATATTGGTGCTTGTTCGATTTGGCAAGGACTAGTTCAATAAAAATCAGAGATATAAA

CDS

ATGTATTACTTTAGTAAAAAATTGCTGGTAGGATTTGATGAAGCTATCGGATTAGTAAAGGATTCCCTAGCAAAAGAAGGCATGGGAATAATGACAGAAATGAATCTACAGAAGGCATTCCAACAAAAACTCCATCAGGATTTTCGTCGTTATCAAGTGTTGGGAGCCTGTCATCCCAAGGTTGCCTATGAGATGTTGCAAATTGATGACCAAGCCGGGGTGATGTTCCCCTGCAATGTGGTGGTGCAGGAACACGACGATGGGAGTGTTGAGGTCTCCGCCGTTGATCCTTTGGCAATGTTTTTAATGATTCATTCTGCCCAGGCAAAGGAGATTGCTCTCTACGCCAGCGCCATGATGCAACGGGTGATCGACCATCTTTAG

Protein

No sequence available