Your browser is old and dusty. Try Google Chrome!

Details for slr5023

ORF slr5023
Accession NP_942179.1
Symbol
Category
Definition
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_441061.1_2 Forward -242 -228 0.491246 0.207
NP_441418.1_6 Forward -335 -316 -23.6 0.196
NP_441480.1_1 Forward -157 -138 -0.885524 0.287
NP_442272.1_2 Forward -45 -26 10.265 0.257
NP_442623.1_1 Reverse -201 -220 -17.7985 0.292
NP_441098.1_3 Forward -46 -27 -3.24792 0.28
NP_443002.1_5 Forward -242 -224 15.2596 0.192
NP_439997.1_4 Forward -135 -116 6.68596 0.266
NP_439979.1_9 Reverse -223 -241 9.0656 0.257
NP_441859.1_3 Forward -336 -317 19.4681 0.0319
NP_441200.1_1 Reverse -51 -70 13.4708 0.237
NP_440893.1_3 Forward -346 -327 -0.689632 0.282
NP_442110.1_7 Forward -243 -229 3.8345 0.21
NP_442110.1_7 Forward -275 -261 1.67122 0.222
NP_441533.1_9 Reverse -64 -83 17.109 0.3
NP_440906.1_5 Reverse -265 -272 5.64398 0.292
NP_440842.1_6 Forward -337 -318 11.7983 0.259
NP_440057.1_5 Forward -391 -372 16.2232 0.155
NP_441014.1_10 Forward -298 -279 5.80018 0.181
NP_442848.1_5 Forward -367 -349 7.29564 0.232
NP_442687.1_7 Reverse -200 -210 4.99491 0.225
NP_442958.1_3 Reverse -223 -242 4.52268 0.247
NP_441013.1_2 Forward -203 -185 2.67408 0.237
NP_440662.1_2 Forward -278 -259 -3.54046 0.276
NP_442496.1_5 Reverse -194 -212 11.7205 0.207
NP_440656.1_8 Forward -254 -235 -9.24366 0.28
NP_442911.1_1 Reverse -22 -35 14.5765 0.291
NP_440827.1_3 Forward -149 -130 10.5209 0.298
NP_440827.1_3 Reverse -222 -241 10.4225 0.298
NP_442002.1_9 Forward -336 -329 9.08556 0.289
NP_441294.1_4 Forward -222 -203 6.68596 0.258
NP_441504.1_2 Reverse -126 -143 18.5251 0.0508
NP_440811.1_4 Reverse -184 -203 15.9291 0.157
NP_442771.1_1 Forward -212 -194 -1.06249 0.127
NP_441916.1_7 Reverse -90 -100 3.42162 0.216
NP_441916.1_10 Reverse -226 -245 1.0811 0.27
NP_441041.1_1 Reverse -195 -214 10.7175 0.211
NP_441041.1_4 Forward -149 -130 -13.6686 0.293
NP_442996.1_1 Forward -43 -24 9.69201 0.21
NP_439966.1_9 Reverse -320 -329 4.52295 0.253
NP_442281.1_1 Forward -248 -234 4.03056 0.21
NP_442281.1_1 Reverse -283 -297 3.63724 0.224
NP_441079.1_7 Forward -43 -24 -5.01617 0.26
NP_439983.1_7 Reverse -260 -278 9.0656 0.298
NP_441644.1_6 Forward -389 -379 4.89613 0.22
NP_442215.1_2 Reverse -126 -142 -2.69473 0.202
NP_440253.1_2 Forward -249 -231 -3.12744 0.286
NP_440780.1_1 Forward -54 -35 6.73176 0.295
NP_442933.1_2 Forward -47 -29 6.68642 0.269
NP_442648.1_1 Reverse -346 -365 8.75091 0.248
NP_442970.1_3 Reverse -28 -46 11.4544 0.29
NP_440919.1_1 Forward -255 -236 0.0977854 0.221
NP_443009.1_5 Forward -361 -350 7.138 0.137
NP_440357.1_6 Reverse -149 -168 2.94938 0.296
NP_441339.1_4 Forward -276 -257 -5.21209 0.28
NP_441826.1_2 Reverse -228 -242 -2.26202 0.269
NP_441826.1_2 Reverse -320 -334 -4.4253 0.296
NP_441826.1_5 Forward -242 -223 11.7008 0.148
NP_442719.1_2 Forward -297 -279 -11.6829 0.294
NP_441251.1_2 Reverse -95 -113 9.45892 0.262
NP_442718.1_2 Reverse -261 -280 1.76941 0.203
NP_440038.1_4 Forward -205 -186 8.45592 0.208
NP_442342.1_9 Forward -204 -188 4.48343 0.249
NP_442739.1_2 Reverse -26 -45 10.3654 0.285
NP_440558.1_2 Forward -306 -287 -7.17871 0.289
NP_441036.1_8 Forward -188 -178 8.63316 0.174
NP_442721.1_4 Reverse -84 -103 15.8307 0.291
NP_441458.1_8 Reverse -31 -50 4.11821 0.267
NP_442347.1_2 Reverse -327 -336 3.34298 0.284
NP_441890.1_1 Forward -101 -82 12.7825 0.238
NP_441633.1_3 Forward -337 -324 -7.25721 0.3
NP_442998.1_10 Forward -208 -201 10.4622 0.0819
NP_442334.1_10 Reverse -194 -213 -16.5201 0.234
NP_440256.1_1 Forward -306 -287 -9.93197 0.291
NP_440915.1_6 Reverse -189 -203 4.62115 0.0953
NP_442785.1_7 Reverse -84 -98 9.04604 0.276
NP_442866.1_1 Reverse -259 -278 -0.590531 0.196
NP_442386.1_9 Reverse -287 -296 9.34074 0.166
NP_442386.1_9 Reverse -350 -359 7.07914 0.219
NP_440570.1_5 Reverse -224 -243 -2.85214 0.282
NP_441160.1_9 Forward -296 -277 17.994 0.0829
NP_440211.1_4 Forward -132 -122 15.418 0.22
NP_440586.1_8 Forward -182 -175 8.88855 0.205
NP_440027.1_8 Forward -147 -128 5.40686 0.279
NP_439937.1_8 Forward -337 -318 -3.93378 0.276
NP_441595.1_2 Forward -29 -16 10.6614 0.277
NP_440171.1_2 Reverse -324 -338 16.9276 0.258
NP_440171.1_2 Reverse -262 -276 16.2527 0.258
NP_441138.1_5 Reverse -37 -50 3.78596 0.297
NP_442511.1_6 Forward -137 -118 5.80098 0.202
NP_440267.1_2 Forward -365 -351 4.91554 0.289
NP_440298.1_2 Reverse -177 -196 8.45592 0.225
NP_440888.1_2 Forward -243 -229 14.2569 0.0193
NP_440888.1_2 Forward -303 -289 7.66879 0.186
NP_442710.1_7 Forward -42 -23 -7.99162 0.299
NP_441621.1_7 Reverse -199 -213 -4.81863 0.246
NP_440504.1_6 Forward -40 -22 5.03327 0.268
NP_440255.1_3 Reverse -26 -36 17.7828 0.298
NP_442780.1_3 Reverse -29 -48 7.78217 0.269
NP_441443.1_7 Reverse -198 -217 -3.24547 0.288
NP_442120.1_10 Reverse -234 -253 -1.18052 0.167
NP_442120.1_10 Forward -249 -230 -3.63879 0.199
NP_441867.1_2 Reverse -192 -211 -16.3235 0.291
NP_440673.1_3 Reverse -176 -183 10.9539 0.106
NP_440673.1_3 Reverse -328 -335 7.51227 0.252
NP_440673.1_3 Forward -268 -261 6.72562 0.277
NP_440436.1_4 Forward -296 -287 7.76745 0.124
NP_441004.1_1 Reverse -195 -214 -6.39206 0.186
NP_441004.1_1 Forward -149 -130 -15.1435 0.273
NP_441004.1_2 Reverse -190 -209 -2.26216 0.264
NP_441004.1_2 Reverse -223 -242 -3.44213 0.28
NP_441004.1_4 Reverse -198 -208 10.0098 0.258
NP_442366.1_3 Reverse -226 -244 -2.3408 0.226
NP_442176.1_1 Reverse -274 -293 2.55606 0.294
NP_442873.1_3 Forward -298 -279 3.83357 0.279
NP_440296.1_6 Reverse -27 -45 10.3151 0.295
NP_442694.1_4 Reverse -356 -365 13.8644 0.217
NP_440728.1_1 Reverse -343 -362 11.995 0.234
NP_442026.1_3 Forward -116 -97 13.3725 0.0594
NP_441542.1_4 Forward -216 -202 5.01447 0.264
NP_440593.1_3 Forward -241 -222 0.687771 0.193
NP_440355.1_1 Reverse -131 -150 12.9783 0.282
NP_441661.1_3 Forward -186 -169 -5.86102 0.283
NP_441409.1_6 Reverse -374 -393 -10.3253 0.203
NP_442843.1_1 Reverse -295 -314 6.09597 0.144
NP_442843.1_1 Forward -137 -118 -11.8986 0.295
NP_439960.1_10 Forward -228 -210 -2.3408 0.254
NP_441124.1_5 Forward -36 -26 11.0983 0.267
NP_440588.1_2 Forward -232 -213 -6.1954 0.273
NP_442006.1_3 Reverse -195 -213 -7.25734 0.298
NP_440483.1_1 Reverse -188 -207 0.392778 0.193
NP_441570.1_1 Reverse -380 -398 6.70565 0.0184
NP_442443.1_1 Forward -217 -198 -0.39387 0.222
NP_440526.1_3 Forward -242 -231 1.13984 0.267
NP_441432.1_8 Reverse -233 -242 5.3096 0.17
NP_441432.1_8 Reverse -293 -302 2.65466 0.292
NP_441432.1_8 Forward -138 -129 2.55633 0.298
NP_442344.1_7 Forward -296 -277 -9.73531 0.266
NP_442815.1_1 Reverse -217 -236 7.17762 0.192
NP_442727.1_1 Reverse -386 -400 15.9292 0.197
NP_442400.1_10 Forward -128 -115 7.89211 0.281
NP_442400.1_10 Forward -31 -18 7.22367 0.292
NP_439956.1_7 Reverse -346 -365 2.65439 0.273
NP_442346.1_5 Reverse -260 -270 8.4365 0.137
NP_442346.1_5 Forward -274 -264 5.19158 0.256
NP_441923.1_6 Reverse -262 -276 8.16106 0.28
NP_440459.1_2 Forward -245 -228 9.38028 0.229
NP_441943.1_9 Reverse -325 -339 19.0751 0.125
NP_441502.1_9 Forward -15 -1 15.7491 0.289
NP_442162.1_6 Forward -275 -256 13.8641 0.289
NP_442045.1_5 Forward -306 -287 3.04771 0.239
NP_440875.1_9 Forward -200 -190 6.81464 0.297
NP_442897.1_7 Reverse -195 -214 17.994 0.218
NP_440400.1_1 Forward -279 -260 -3.14789 0.291
NP_441892.1_1 Forward -369 -352 -5.86102 0.29
NP_442270.1_9 Forward -148 -129 -8.06369 0.216
NP_440573.1_3 Forward -92 -79 14.672 0.278
NP_440833.1_6 Forward -113 -99 7.57046 0.278
NP_440354.1_5 Reverse -171 -190 2.16274 0.264
NP_440462.1_6 Reverse -320 -330 3.61828 0.234
NP_442499.1_4 Reverse -225 -239 14.0609 0.226
NP_441848.1_4 Reverse -62 -78 7.74165 0.288
NP_440696.1_3 Forward -231 -213 0.805796 0.225
NP_442358.1_1 Forward -359 -341 17.8171 0.114
NP_441811.1_8 Reverse -320 -334 8.75105 0.231
NP_441811.1_8 Reverse -168 -182 7.76774 0.241
NP_441959.1_8 Forward -39 -26 8.51648 0.29
NP_441252.1_6 Reverse -198 -205 11.9372 0.25
NP_442844.1_2 Forward -51 -36 14.8582 0.229
NP_442532.1_1 Forward -40 -26 15.9443 0.215
NP_440914.1_1 Reverse -288 -298 6.76087 0.267
NP_442541.1_10 Reverse -128 -142 3.14559 0.254
NP_441219.1_6 Reverse -312 -330 14.6705 0.147
NP_441697.1_5 Reverse -17 -36 -10.9342 0.287
NP_439965.1_1 Reverse -368 -387 -3.24547 0.182
NP_440444.1_9 Reverse -246 -265 13.47 0.241
NP_439899.1_1 Reverse -19 -37 3.89531 0.284
NP_441753.1_10 Forward -258 -239 1.57275 0.262
NP_441021.1_1 Forward -242 -223 -0.197208 0.098
NP_441021.1_1 Forward -209 -190 -10.3253 0.234
NP_441463.1_3 Forward -280 -261 0.884433 0.129
NP_441463.1_3 Reverse -312 -331 -7.57203 0.259
NP_440114.1_10 Forward -210 -196 5.99778 0.289
NP_442323.1_7 Forward -202 -183 1.76863 0.278
NP_441156.1_5 Forward -364 -354 16.1594 0.23
NP_442103.1_2 Forward -279 -261 10.0481 0.246
NP_440457.1_1 Reverse -189 -201 0.727295 0.25
NP_440054.1_4 Forward -368 -349 13.4708 0.148
NP_441332.1_6 Forward -203 -193 14.1639 0.158
NP_440554.1_4 Forward -201 -191 3.51995 0.227
NP_442513.1_3 Reverse -310 -329 16.4207 0.198
NP_440091.1_1 Reverse -260 -272 0.432302 0.25
NP_441397.1_3 Forward -45 -26 12.4867 0.293
NP_442451.1_2 Forward -343 -324 -5.31042 0.222
NP_442638.1_3 Forward -116 -97 14.4666 0.275
NP_439962.1_4 Reverse -210 -229 -6.68705 0.283
NP_442495.1_4 Reverse -192 -202 14.238 0.165
NP_442373.1_2 Reverse -192 -211 -9.63698 0.265
NP_440172.1_1 Forward -335 -325 2.7333 0.268
NP_441226.1_7 Forward -201 -194 8.29857 0.205
NP_440416.1_9 Forward -304 -285 -21.6334 0.295
NP_443052.1_9 Forward -229 -210 -6.98204 0.291
NP_442154.1_1 Reverse -262 -280 -5.88071 0.127
NP_442154.1_1 Forward -229 -211 -15.5171 0.22
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

TCGCCAGAAAACGCGATTATCTTCAAGCCAGACTCCAAAAAGCCATTCCAGAGATTCTCGTTAACGGCAATCAATCCCGTCGTTTAGCAGGAAACTTACACATTGCCATTCCTGATATTCCCAACAGCGCTATCATTGCCCGAATTCGGGAGCAAATAGCCATTTCCACTGGCTCAGCTTGCTCTAGCGGCACTATTGCCCCATCCCATGTGCTGAGAGCGATGAATCTCACCTCTAATTTCATTGATGGAGCCTTACGGATTGGAATTGGCAAATTTACTACTAACGCAGAAATTGAACAAGCGGCCGATATTCTGATTAAGACTATTACAATAGTGAAATCATGCCTTAAATCATCATAAATTAATAAAATTTCAGATCAATTCTCTTGTCAGCTAAA

CDS

ATGAAAATTGTTTCTATAAAAATAAAAAATTATCGTGTCTTTGAAGACATCAAAATCACCAACATTCCTAGCTTCTGTGTCATTATTGGAGCCAATGGTACCGGGAAGTCTACTCTGTTTGATGTTTTTGGTTTTCTCCGTGATGCATTGAAAAATAACATTCGCCAAGCCCTGCAAATCAGGGGTGGATTCAAGGAAGTGGTTACTAGAGGAAAAGAGTCCGAAGATATAGAAATTGAACTCAAATTTCGGATGGAAATACTTGCAACAGAACGATTAGTAACCTATATTTTGATTATTGGGCAGGAGGGTAAAAAGCCAGTCATTAAACGAGAAATTTTACGCTATAAACGTGGTGAATATGGTTCTCCTTTTCATTTTTTAGACTTCCATAATGGTCAAGGATATGCTATCAGAAATGAAGAAAGCTTTGAAAGTGACGAAGAACTAGAGCGCGAAGAACAAAAACTTGAATCTGCCGATATATTAGCAATTAAAGGCTTGGGGCAATTTCAACGATTTAAAGCTGCAAATGCCATCCGTTCCTTGATCGAAAACTGGCACGTTTCAGACTTTCATATCAGTGATGCTAGAGGGAGCAAAGCCGCGCTTTATGCTGAACATCTTTCTCCTACTGGCGATAATATACCGATTGTTGCTCAATATATTTATCAAGAACATCCTGAAATATTTGCGGAAATATTACAACGCATGAAACAACGAGTACCTGGAATTTCTAATGTTGAAGCAAAAGAAATAGAGGGTGGTAGTTTAATATTAAAATTTCAGGATCAAGCCTTTGAAGATTCCTTTGTTGATCTCTATGTTTCCGATGGCACCATTAAAATGTTTGCCTATTTAATTTTACTCTTCGATCCTAAGCCTCACCCTTTACTGTGTGTTGAAGAACCTGAAAATCAACTATATCCAACGCTTTTACGGGAACTTGCCGAAGAATTTGCAAGTTATGCGCACCGGGGTGGGCAGGTCTTTGTCTCAACTCATTCCCCTGACTTTCTTAACGCCGTTCCTTTAGATAGTATTTTCTGGTTAATAAAAATCCAAGGTGTTACCAAAGTTGAAAAAGCTGCCGATCATGAAGTCCTGAGAAACTTGATTGCGGCAGGGGATCTTCCCGGTTATCTCTGGAACCAAGGCTGGTTTGAAGGAGTTGCGCCCTAA

Protein

No sequence available