Your browser is old and dusty. Try Google Chrome!

Details for slr5021

ORF slr5021
Accession NP_942177.1
Symbol
Category
Definition
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_441061.1_2 Forward -117 -103 5.60446 0.132
NP_441061.1_2 Reverse -361 -375 4.22782 0.153
NP_441061.1_2 Forward -368 -354 -0.000409212 0.219
NP_440795.1_7 Forward -368 -361 14.6904 0.0123
NP_440795.1_7 Reverse -361 -368 14.6904 0.0123
NP_440795.1_7 Forward -117 -110 14.6904 0.0123
NP_440795.1_7 Reverse -110 -117 14.6904 0.0123
NP_441418.1_6 Forward -118 -99 -29.9915 0.249
NP_442291.1_5 Reverse -359 -375 9.89163 0.0483
NP_442291.1_5 Reverse -108 -124 -4.66135 0.281
NP_441453.1_4 Reverse -360 -368 16.539 0.00633
NP_441453.1_4 Reverse -109 -117 16.539 0.00633
NP_441453.1_4 Forward -369 -361 16.539 0.00633
NP_441453.1_4 Forward -118 -110 16.539 0.00633
NP_442151.1_1 Reverse -171 -190 3.53937 0.287
NP_442151.1_6 Forward -118 -104 18.7808 0.00618
NP_442151.1_6 Reverse -360 -374 13.6676 0.0474
NP_442151.1_6 Forward -369 -355 8.75105 0.164
NP_442151.1_6 Reverse -109 -123 7.17775 0.206
NP_441818.1_1 Reverse -361 -372 18.8393 0.00301
NP_441818.1_1 Reverse -110 -121 9.59626 0.232
NP_440226.1_1 Reverse -109 -128 17.8957 0.0175
NP_440226.1_1 Reverse -360 -379 8.25926 0.0904
NP_440120.1_4 Reverse -292 -306 14.9459 0.273
NP_442744.1_8 Forward -118 -99 -0.983855 0.258
NP_442173.1_1 Forward -368 -360 15.4574 0.00633
NP_442173.1_1 Forward -117 -109 15.4574 0.00633
NP_442173.1_1 Reverse -361 -369 15.4574 0.00633
NP_442173.1_1 Reverse -110 -118 15.4574 0.00633
NP_442173.1_1 Reverse -89 -97 5.32929 0.215
NP_442752.1_4 Forward -369 -362 13.8055 0.0199
NP_442752.1_4 Reverse -360 -367 13.8055 0.0199
NP_442752.1_4 Forward -118 -111 13.8055 0.0199
NP_442752.1_4 Reverse -109 -116 13.8055 0.0199
NP_443027.1_4 Forward -120 -110 16.2046 0.0437
NP_443027.1_4 Forward -371 -361 14.0414 0.0452
NP_441812.1_3 Reverse -108 -122 11.996 0.21
NP_441812.1_3 Reverse -359 -373 11.5043 0.21
NP_442975.1_10 Forward -373 -359 13.1753 0.0459
NP_442975.1_10 Forward -122 -108 12.8803 0.0459
NP_442975.1_10 Reverse -105 -119 2.65393 0.269
NP_442975.1_10 Reverse -356 -370 1.37564 0.299
NP_440784.1_7 Forward -368 -361 15.9687 0.0123
NP_440784.1_7 Reverse -361 -368 15.9687 0.0123
NP_440784.1_7 Forward -117 -110 15.9687 0.0123
NP_440784.1_7 Reverse -110 -117 15.9687 0.0123
NP_442909.1_7 Reverse -361 -375 13.9619 0.12
NP_440061.1_9 Forward -120 -106 9.24208 0.149
NP_440061.1_9 Forward -371 -357 9.14375 0.151
NP_440110.1_4 Reverse -349 -368 8.45592 0.131
NP_440878.1_9 Reverse -350 -369 2.16274 0.177
NP_442062.1_8 Forward -369 -359 17.3846 0.00193
NP_442062.1_8 Reverse -360 -370 17.3846 0.00193
NP_442062.1_8 Forward -118 -108 17.3846 0.00193
NP_442062.1_8 Reverse -109 -119 10.3048 0.0493
NP_440761.1_4 Forward -123 -104 -13.6686 0.257
NP_441859.1_3 Forward -119 -100 8.35677 0.139
NP_440304.1_4 Forward -120 -110 19.9412 0.00364
NP_440304.1_4 Forward -371 -361 10.8948 0.051
NP_440304.1_4 Reverse -358 -368 1.84832 0.299
NP_440304.1_4 Reverse -107 -117 1.84832 0.299
NP_442242.1_4 Forward -368 -361 14.3954 0.0124
NP_442242.1_4 Reverse -361 -368 14.3954 0.0124
NP_442242.1_4 Forward -117 -110 14.3954 0.0124
NP_442242.1_4 Reverse -110 -117 14.3954 0.0124
NP_440044.1_8 Reverse -361 -380 8.06259 0.0788
NP_440044.1_8 Forward -368 -349 6.39097 0.0916
NP_440044.1_8 Reverse -110 -129 -1.47551 0.246
NP_440916.1_1 Forward -155 -141 19.3708 0.0553
NP_439918.1_2 Reverse -172 -191 -4.72043 0.283
NP_439918.1_3 Reverse -106 -125 2.75272 0.281
NP_441620.1_3 Forward -376 -357 18.584 0.132
NP_441619.1_8 Reverse -354 -368 8.75042 0.237
NP_441208.1_9 Reverse -106 -120 16.2242 0.0671
NP_441594.1_6 Reverse -217 -236 1.96607 0.259
NP_442110.1_7 Reverse -360 -374 8.84938 0.0807
NP_442110.1_7 Reverse -109 -123 2.06454 0.222
NP_442110.1_7 Forward -118 -104 1.76955 0.222
NP_441083.1_5 Forward -369 -359 20.3345 0.00053
NP_441083.1_5 Reverse -360 -370 20.3345 0.00053
NP_441083.1_5 Forward -118 -108 20.3345 0.00053
NP_441083.1_5 Reverse -109 -119 11.2881 0.0159
NP_441738.1_2 Forward -367 -360 15.28 0.0102
NP_441738.1_2 Reverse -362 -369 15.28 0.0102
NP_441738.1_2 Forward -116 -109 15.28 0.0102
NP_441738.1_2 Reverse -111 -118 15.28 0.0102
NP_441738.1_2 Forward -95 -88 6.52862 0.261
NP_441738.1_2 Forward -152 -145 6.23363 0.264
NP_441738.1_4 Forward -379 -360 6.78429 0.203
NP_441558.1_5 Forward -120 -101 5.89931 0.236
NP_441558.1_5 Forward -58 -39 4.42435 0.281
NP_440209.1_1 Reverse -360 -368 18.1123 0.00295
NP_440209.1_1 Reverse -109 -117 18.1123 0.00295
NP_440209.1_1 Forward -369 -361 18.1123 0.00295
NP_440209.1_1 Forward -118 -110 18.1123 0.00295
NP_442889.1_8 Forward -121 -107 19.0751 0.0084
NP_442889.1_8 Forward -372 -358 13.1753 0.0588
NP_442889.1_8 Reverse -357 -371 9.73373 0.0945
NP_441713.1_1 Reverse -103 -122 3.83436 0.0568
NP_441713.1_1 Forward -124 -105 -16.4218 0.283
NP_440178.1_7 Reverse -359 -378 13.7658 0.00536
NP_440538.1_1 Reverse -45 -63 16.4404 0.25
NP_441716.1_1 Forward -118 -104 13.1759 0.0689
NP_441716.1_1 Reverse -109 -123 6.3911 0.198
NP_441716.1_1 Reverse -360 -374 4.12949 0.258
NP_441327.1_1 Forward -32 -13 5.27058 0.255
NP_441327.1_5 Reverse -293 -302 14.356 0.192
NP_442111.1_4 Reverse -108 -122 9.63603 0.0593
NP_442111.1_4 Forward -119 -105 9.34103 0.0609
NP_442111.1_4 Forward -370 -356 1.76955 0.294
NP_441163.1_1 Forward -251 -234 5.15133 0.28
NP_441163.1_1 Reverse -101 -118 5.053 0.281
NP_441215.1_1 Reverse -95 -114 15.8307 0.1
NP_440906.1_5 Forward -368 -361 15.8704 0.0124
NP_440906.1_5 Reverse -361 -368 15.8704 0.0124
NP_440906.1_5 Forward -117 -110 15.8704 0.0124
NP_440906.1_5 Reverse -110 -117 15.8704 0.0124
NP_440747.1_10 Reverse -106 -118 24.7201 0.00036
NP_440747.1_10 Reverse -357 -369 14.887 0.00223
NP_440747.1_10 Forward -372 -360 7.51213 0.00286
NP_440747.1_10 Forward -121 -109 -1.92764 0.0192
NP_440747.1_10 Forward -226 -214 -2.51763 0.0509
NP_441486.1_1 Forward -372 -358 23.5007 0.00162
NP_441486.1_1 Forward -121 -107 14.5526 0.00628
NP_441486.1_1 Reverse -357 -371 12.586 0.0112
NP_441486.1_1 Reverse -106 -120 4.22782 0.0475
NP_442634.1_4 Forward -120 -106 -1.47537 0.149
NP_442634.1_4 Reverse -107 -121 -2.06536 0.149
NP_441014.1_10 Reverse -359 -378 9.83173 0.123
NP_442848.1_1 Forward -375 -361 15.4376 0.015
NP_442848.1_1 Forward -124 -110 -4.22864 0.282
NP_443018.1_3 Forward -368 -361 14.8871 0.0123
NP_443018.1_3 Reverse -361 -368 14.8871 0.0123
NP_443018.1_3 Forward -117 -110 14.8871 0.0123
NP_443018.1_3 Reverse -110 -117 14.8871 0.0123
NP_441316.1_7 Forward -51 -36 3.02816 0.15
NP_441316.1_7 Forward -120 -105 2.43817 0.154
NP_441634.1_8 Reverse -358 -372 -4.62196 0.295
NP_441634.1_8 Reverse -107 -121 -4.7203 0.295
NP_440376.1_1 Forward -369 -360 19.4693 0.000692
NP_440376.1_1 Reverse -360 -369 19.4693 0.000692
NP_440376.1_1 Forward -118 -109 19.4693 0.000692
NP_440376.1_1 Reverse -109 -118 19.4693 0.000692
NP_440376.1_1 Forward -223 -214 5.50626 0.131
NP_441588.1_4 Forward -367 -357 15.9097 0.0369
NP_441588.1_4 Forward -116 -106 9.02648 0.14
NP_441588.1_4 Reverse -362 -372 8.63316 0.14
NP_441588.1_4 Reverse -111 -121 6.66654 0.185
NP_441588.1_4 Forward -190 -180 5.38824 0.272
NP_442730.1_8 Reverse -101 -120 4.91521 0.268
NP_442687.1_7 Forward -119 -109 9.02648 0.0994
NP_442687.1_7 Forward -370 -360 8.92815 0.0994
NP_442687.1_7 Reverse -359 -369 8.92815 0.0994
NP_442687.1_7 Reverse -108 -118 8.92815 0.0994
NP_440642.1_10 Forward -151 -137 3.14559 0.277
NP_442658.1_1 Forward -120 -110 13.0576 0.04
NP_442658.1_1 Reverse -358 -368 6.76441 0.214
NP_442658.1_1 Reverse -107 -117 6.76441 0.214
NP_442658.1_1 Forward -371 -361 6.76441 0.214
NP_442658.1_1 Forward -245 -235 5.19112 0.28
NP_440141.1_8 Reverse -64 -83 9.93088 0.211
NP_442782.1_7 Forward -377 -358 1.47442 0.197
NP_442205.1_9 Forward -375 -359 4.48343 0.149
NP_441414.1_9 Forward -369 -350 7.17762 0.0358
NP_441414.1_9 Reverse -360 -379 -2.26216 0.112
NP_441414.1_9 Forward -118 -99 -4.52377 0.156
NP_441414.1_9 Reverse -109 -128 -9.73531 0.266
NP_442937.1_5 Reverse -355 -374 10.8159 0.152
NP_442937.1_5 Forward -374 -355 9.3409 0.196
NP_442937.1_5 Reverse -104 -123 6.39097 0.28
NP_441958.1_5 Forward -119 -109 21.2195 0.000805
NP_441958.1_5 Forward -370 -360 12.2714 0.00183
NP_441958.1_5 Reverse -359 -369 12.2714 0.00183
NP_441958.1_5 Reverse -108 -118 12.2714 0.00183
NP_442836.1_5 Reverse -103 -122 9.53756 0.131
NP_440203.1_5 Forward -115 -105 14.2375 0.0886
NP_440203.1_5 Forward -250 -240 8.92768 0.281
NP_439905.1_5 Forward -277 -263 17.5025 0.201
NP_440984.1_7 Reverse -355 -369 11.0127 0.122
NP_439990.1_5 Reverse -104 -117 20.7671 0.00296
NP_439990.1_5 Reverse -355 -368 7.6891 0.186
NP_439990.1_5 Forward -123 -110 6.80412 0.221
NP_442911.1_2 Reverse -99 -118 6.78429 0.0277
NP_442911.1_2 Forward -379 -360 -3.3438 0.111
NP_442911.1_2 Reverse -350 -369 -3.54046 0.114
NP_442911.1_2 Reverse -204 -223 -6.49039 0.184
NP_442064.1_1 Reverse -104 -123 7.57094 0.0966
NP_442064.1_1 Reverse -355 -374 -12.5869 0.277
NP_442064.1_4 Reverse -356 -375 5.30853 0.271
NP_443055.1_6 Reverse -95 -113 3.16499 0.2
NP_440993.1_3 Forward -152 -133 1.76863 0.225
NP_440809.1_9 Forward -127 -109 11.4255 0.0632
NP_441294.1_7 Forward -122 -108 17.0257 0.0103
NP_441294.1_7 Forward -373 -359 14.914 0.033
NP_441646.1_1 Reverse -102 -121 7.96426 0.152
NP_442438.1_10 Forward -374 -360 8.84938 0.0718
NP_442438.1_10 Forward -123 -109 1.86788 0.188
NP_442438.1_10 Reverse -104 -118 0.786239 0.213
NP_441000.1_6 Reverse -108 -122 -4.52363 0.245
NP_441000.1_6 Reverse -359 -373 -4.7203 0.251
NP_440147.1_4 Reverse -358 -371 11.3273 0.0326
NP_440147.1_4 Reverse -107 -120 10.7374 0.0355
NP_440147.1_4 Forward -120 -107 3.75586 0.181
NP_440147.1_4 Forward -371 -358 2.18257 0.209
NP_441550.1_8 Reverse -358 -368 14.6309 0.0132
NP_441550.1_8 Reverse -107 -117 14.6309 0.0132
NP_441550.1_8 Forward -120 -110 13.0576 0.0273
NP_441550.1_8 Forward -371 -361 12.3692 0.0336
NP_441916.1_7 Reverse -109 -119 18.9579 0.00144
NP_441916.1_7 Forward -369 -359 10.3048 0.0261
NP_441916.1_7 Reverse -360 -370 10.3048 0.0261
NP_441916.1_7 Forward -118 -108 10.3048 0.0261
NP_441916.1_7 Reverse -35 -45 1.84832 0.272
NP_441916.1_10 Forward -377 -358 4.12936 0.223
NP_441916.1_10 Forward -249 -230 2.26107 0.25
NP_441041.1_4 Reverse -360 -379 4.71934 0.0555
NP_441041.1_4 Reverse -109 -128 -8.65367 0.205
NP_441041.1_4 Forward -118 -99 -11.0136 0.239
NP_441041.1_4 Reverse -232 -251 -11.4069 0.246
NP_441041.1_7 Forward -121 -109 9.65268 0.108
NP_441041.1_7 Reverse -106 -118 8.58373 0.133
NP_442396.1_5 Reverse -356 -369 21.1604 0.00421
NP_442004.1_6 Forward -118 -104 5.80112 0.181
NP_442004.1_6 Reverse -360 -374 2.94952 0.254
NP_441725.1_5 Reverse -361 -371 11.2881 0.0247
NP_441725.1_5 Reverse -110 -120 11.1898 0.0247
NP_441725.1_5 Forward -368 -358 2.04498 0.115
NP_441725.1_5 Forward -117 -107 2.04498 0.115
NP_439966.1_7 Forward -371 -361 15.8108 0.0124
NP_439966.1_7 Forward -120 -110 14.8275 0.0177
NP_439966.1_7 Reverse -358 -368 7.25606 0.15
NP_439966.1_7 Reverse -107 -117 7.25606 0.15
NP_442941.1_3 Reverse -361 -371 19.9412 0.00262
NP_442941.1_3 Reverse -110 -120 19.9412 0.00262
NP_442941.1_3 Forward -368 -358 11.0914 0.0116
NP_442941.1_3 Forward -117 -107 11.0914 0.0116
NP_440289.1_2 Forward -121 -108 13.3923 0.0132
NP_440289.1_2 Forward -372 -359 13.294 0.0132
NP_440289.1_2 Reverse -357 -370 -4.9956 0.294
NP_440260.1_8 Reverse -188 -206 -2.93078 0.246
NP_442281.1_1 Forward -374 -360 15.9285 0.00992
NP_442281.1_1 Reverse -104 -118 9.53707 0.0685
NP_442281.1_1 Reverse -355 -369 8.94708 0.0747
NP_440647.1_9 Forward -144 -126 3.26407 0.279
NP_441556.1_10 Reverse -104 -118 13.4339 0.178
NP_440498.1_1 Forward -378 -360 -3.42244 0.261
NP_441644.1_6 Reverse -109 -119 19.0557 0.000803
NP_441644.1_6 Forward -369 -359 17.3841 0.00127
NP_441644.1_6 Reverse -360 -370 17.3841 0.00127
NP_441644.1_6 Forward -118 -108 17.3841 0.00127
NP_442215.1_2 Reverse -358 -374 5.17175 0.0796
NP_442215.1_2 Reverse -107 -123 4.48343 0.0838
NP_442215.1_2 Forward -120 -104 -2.00642 0.191
NP_442215.1_2 Forward -371 -355 -4.85801 0.24
NP_442215.1_2 Reverse -188 -204 -6.92296 0.281
NP_440253.1_2 Reverse -360 -378 6.90232 0.0752
NP_440253.1_2 Forward -369 -351 -3.71743 0.3
NP_440929.1_8 Forward -369 -360 19.2726 0.000701
NP_440929.1_8 Reverse -360 -369 19.2726 0.000701
NP_440929.1_8 Forward -118 -109 19.2726 0.000701
NP_440929.1_8 Reverse -109 -118 19.2726 0.000701
NP_442933.1_10 Forward -369 -360 17.601 0.00325
NP_442933.1_10 Reverse -360 -369 17.601 0.00325
NP_442933.1_10 Forward -118 -109 17.601 0.00325
NP_442933.1_10 Reverse -109 -118 17.601 0.00325
NP_441751.2_8 Reverse -110 -124 13.5693 0.0166
NP_441751.2_8 Forward -117 -103 7.37441 0.0339
NP_441751.2_8 Reverse -361 -375 4.12949 0.0534
NP_441751.2_8 Forward -368 -354 -3.04867 0.134
NP_442554.1_8 Reverse -110 -120 16.9913 0.0065
NP_442554.1_8 Reverse -361 -371 15.9097 0.00747
NP_442554.1_8 Forward -368 -358 15.3197 0.00882
NP_442554.1_8 Forward -117 -107 15.3197 0.00882
NP_441586.1_6 Forward -120 -101 6.58763 0.277
NP_441762.1_7 Forward -119 -107 0.530633 0.0747
NP_441762.1_7 Forward -370 -358 0.432302 0.0747
NP_441762.1_7 Reverse -359 -371 -6.84419 0.284
NP_441762.1_7 Reverse -108 -120 -6.94252 0.284
NP_442142.1_4 Forward -372 -359 14.1783 0.0311
NP_442142.1_4 Forward -121 -108 13.5883 0.0348
NP_442142.1_4 Reverse -106 -119 12.8017 0.0409
NP_442142.1_4 Reverse -357 -370 2.96866 0.269
NP_442292.1_1 Forward -368 -359 18.486 0.00229
NP_442292.1_1 Forward -117 -108 18.486 0.00229
NP_442292.1_1 Reverse -361 -370 18.486 0.00229
NP_442292.1_1 Reverse -110 -119 17.5026 0.00435
NP_442476.1_6 Forward -368 -354 10.9143 0.0601
NP_440895.1_6 Reverse -103 -116 20.1771 0.0221
NP_443009.1_5 Reverse -108 -119 14.5128 0.02
NP_443009.1_5 Forward -119 -108 10.1862 0.0792
NP_443009.1_5 Reverse -359 -370 8.90795 0.0965
NP_443009.1_5 Forward -370 -359 8.90795 0.0965
NP_441715.1_4 Reverse -361 -371 14.828 0.0268
NP_441715.1_4 Reverse -110 -120 14.238 0.0295
NP_441715.1_4 Forward -368 -358 7.94484 0.107
NP_441715.1_4 Forward -117 -107 7.94484 0.107
NP_440015.1_9 Reverse -109 -127 -1.06249 0.268
NP_441198.1_8 Forward -120 -110 13.2713 0.108
NP_440379.1_5 Forward -238 -219 -4.03212 0.208
NP_440464.1_10 Forward -368 -358 13.0082 0.169
NP_440464.1_10 Forward -117 -107 13.0082 0.169
NP_441468.1_1 Forward -368 -361 15.8704 0.0124
NP_441468.1_1 Reverse -361 -368 15.8704 0.0124
NP_441468.1_1 Forward -117 -110 15.8704 0.0124
NP_441468.1_1 Reverse -110 -117 15.8704 0.0124
NP_441673.1_1 Forward -369 -360 20.8459 0.000698
NP_441673.1_1 Reverse -360 -369 20.8459 0.000698
NP_441673.1_1 Forward -118 -109 20.8459 0.000698
NP_441673.1_1 Reverse -109 -118 20.8459 0.000698
NP_441731.1_1 Reverse -242 -260 13.6573 0.281
NP_441731.1_1 Reverse -14 -32 13.6573 0.281
NP_441826.1_2 Reverse -103 -117 6.78443 0.09
NP_441826.1_2 Forward -375 -361 4.32615 0.104
NP_441826.1_2 Reverse -360 -374 -0.590395 0.215
NP_441826.1_2 Forward -124 -110 -4.32697 0.295
NP_442868.1_6 Forward -371 -361 9.91146 0.038
NP_442868.1_6 Reverse -358 -368 9.81313 0.038
NP_442868.1_6 Reverse -107 -117 9.81313 0.038
NP_442868.1_6 Forward -120 -110 1.06167 0.205
NP_442868.1_6 Forward -225 -215 0.471689 0.226
NP_441251.1_5 Reverse -165 -184 14.9458 0.28
NP_441056.1_1 Reverse -360 -379 7.27595 0.102
NP_441612.1_2 Reverse -360 -370 8.54929 0.21
NP_441612.1_2 Forward -369 -359 8.54929 0.21
NP_441612.1_2 Forward -118 -108 8.54929 0.21
NP_443058.1_7 Reverse -108 -127 8.94757 0.206
NP_442427.1_8 Forward -378 -359 15.4374 0.0863
NP_442427.1_8 Reverse -351 -370 9.3409 0.184
NP_441911.1_10 Forward -275 -256 7.49852 0.274
NP_442808.1_1 Forward -119 -109 8.73102 0.0481
NP_442808.1_1 Reverse -359 -369 8.63269 0.0481
NP_442808.1_1 Reverse -108 -118 8.63269 0.0481
NP_442808.1_1 Forward -370 -360 8.63269 0.0481
NP_440145.1_3 Forward -128 -109 5.60432 0.063
NP_440145.1_3 Forward -379 -360 0.786102 0.133
NP_442050.1_5 Forward -120 -110 18.0724 0.00365
NP_442050.1_5 Forward -371 -361 16.4991 0.00812
NP_442050.1_5 Forward -99 -89 9.12434 0.193
NP_442050.1_5 Reverse -358 -368 7.64939 0.243
NP_442050.1_5 Reverse -107 -117 7.64939 0.243
NP_440038.1_4 Reverse -101 -120 -0.590531 0.288
NP_442903.1_2 Forward -276 -257 2.33913 0.287
NP_441114.1_5 Reverse -137 -156 6.88262 0.262
NP_440558.1_2 Forward -378 -359 3.73603 0.153
NP_440558.1_2 Reverse -79 -98 -1.86883 0.218
NP_440558.1_2 Forward -127 -108 -7.4737 0.294
NP_441518.1_3 Forward -379 -360 -4.81876 0.121
NP_441518.1_3 Forward -107 -88 -14.4552 0.276
NP_441878.1_6 Forward -119 -109 10.5014 0.0176
NP_441878.1_6 Forward -370 -360 10.4031 0.0176
NP_441878.1_6 Reverse -359 -369 10.4031 0.0176
NP_441878.1_6 Reverse -108 -118 10.4031 0.0176
NP_441036.1_8 Forward -119 -109 15.713 0.00724
NP_441036.1_8 Forward -370 -360 8.33817 0.174
NP_441036.1_8 Reverse -359 -369 8.33817 0.174
NP_441036.1_8 Reverse -108 -118 8.33817 0.174
NP_442650.1_2 Forward -118 -104 8.25939 0.13
NP_441557.1_5 Forward -369 -360 19.9609 0.000699
NP_441557.1_5 Reverse -360 -369 19.9609 0.000699
NP_441557.1_5 Forward -118 -109 19.9609 0.000699
NP_441557.1_5 Reverse -109 -118 19.9609 0.000699
NP_441445.1_1 Forward -127 -108 17.6007 0.0319
NP_441445.1_1 Forward -378 -359 13.3725 0.0607
NP_441445.1_1 Reverse -100 -119 0.982764 0.264
NP_442066.2_9 Reverse -356 -369 11.1307 0.154
NP_441739.1_2 Forward -156 -140 4.38442 0.245
NP_441308.1_8 Forward -120 -110 13.353 0.218
NP_441458.1_10 Reverse -351 -370 4.81767 0.226
NP_442183.1_1 Reverse -360 -374 14.3559 0.0336
NP_442183.1_1 Forward -369 -355 11.5043 0.0702
NP_442397.1_9 Forward -369 -350 4.22769 0.254
NP_442347.1_2 Forward -368 -359 12.4878 0.056
NP_442347.1_2 Reverse -361 -370 12.4878 0.056
NP_442347.1_2 Forward -117 -108 12.4878 0.056
NP_442347.1_2 Reverse -110 -119 3.34298 0.284
NP_442645.1_2 Forward -377 -358 5.11266 0.0216
NP_442965.1_8 Reverse -332 -351 15.4374 0.24
NP_441037.1_4 Reverse -358 -368 7.9999 0.237
NP_441037.1_4 Reverse -107 -117 7.9999 0.237
NP_441037.1_4 Forward -120 -110 7.31769 0.237
NP_442317.1_6 Reverse -355 -374 4.12936 0.247
NP_441633.1_3 Reverse -358 -371 1.10092 0.109
NP_441633.1_3 Reverse -107 -120 1.00259 0.11
NP_441633.1_3 Forward -371 -358 -5.97891 0.236
NP_440136.1_2 Forward -368 -361 15.9687 0.0123
NP_440136.1_2 Reverse -361 -368 15.9687 0.0123
NP_440136.1_2 Forward -117 -110 15.9687 0.0123
NP_440136.1_2 Reverse -110 -117 15.9687 0.0123
NP_440136.1_2 Reverse -89 -96 3.97235 0.288
NP_442998.1_10 Forward -367 -360 15.5754 0.0102
NP_442998.1_10 Reverse -362 -369 15.5754 0.0102
NP_442998.1_10 Forward -116 -109 15.5754 0.0102
NP_442998.1_10 Reverse -111 -118 15.5754 0.0102
NP_440299.1_1 Reverse -105 -118 22.3398 0.000547
NP_440299.1_1 Reverse -356 -369 12.9984 0.0319
NP_440299.1_1 Forward -227 -214 7.39353 0.113
NP_440299.1_1 Forward -373 -360 4.44361 0.207
NP_441799.1_1 Reverse -356 -370 15.8302 0.0163
NP_441799.1_1 Forward -122 -108 12.487 0.043
NP_441799.1_1 Forward -373 -359 10.0287 0.0797
NP_441799.1_1 Reverse -105 -119 9.83206 0.0838
NP_441007.1_10 Reverse -355 -368 8.27909 0.115
NP_441007.1_10 Forward -374 -361 2.77255 0.183
NP_440256.1_1 Reverse -106 -125 13.1758 0.0106
NP_440256.1_1 Reverse -357 -376 3.93269 0.0488
NP_440256.1_1 Forward -85 -66 -2.75381 0.122
NP_440256.1_1 Forward -372 -353 -3.14714 0.127
NP_440256.1_1 Reverse -130 -149 -10.3253 0.299
NP_441957.1_7 Reverse -252 -271 17.0107 0.193
NP_441512.1_4 Forward -122 -103 11.7992 0.237
NP_441559.1_8 Reverse -104 -118 2.65453 0.143
NP_441559.1_8 Forward -123 -109 -0.295402 0.175
NP_440915.1_6 Reverse -105 -119 12.7826 0.0206
NP_440915.1_6 Forward -122 -108 1.76955 0.131
NP_442158.1_4 Reverse -100 -110 11.4848 0.271
NP_442785.1_7 Forward -120 -106 10.4227 0.228
NP_441704.1_8 Forward -380 -361 12.29 0.122
NP_440695.1_5 Reverse -360 -379 -1.37718 0.284
NP_442993.1_1 Reverse -360 -376 0.156866 0.0653
NP_442993.1_1 Reverse -109 -125 -0.138127 0.0696
NP_442386.1_9 Reverse -359 -368 13.8639 0.0289
NP_442386.1_9 Reverse -108 -117 13.8639 0.0289
NP_442386.1_9 Forward -370 -361 13.8639 0.0289
NP_442386.1_9 Forward -119 -110 6.39082 0.219
NP_440570.1_5 Forward -385 -366 5.211 0.204
NP_441340.1_5 Forward -368 -361 15.6737 0.0124
NP_441340.1_5 Reverse -361 -368 15.6737 0.0124
NP_441340.1_5 Forward -117 -110 15.6737 0.0124
NP_441340.1_5 Reverse -110 -117 15.6737 0.0124
NP_440327.1_6 Reverse -172 -191 5.30933 0.264
NP_441132.1_10 Forward -160 -141 14.6508 0.259
NP_440586.1_8 Forward -368 -361 13.2151 0.026
NP_440586.1_8 Forward -117 -110 13.2151 0.026
NP_440586.1_8 Reverse -361 -368 13.2151 0.026
NP_440586.1_8 Reverse -110 -117 13.2151 0.026
NP_442251.1_6 Forward -368 -361 15.2804 0.0124
NP_442251.1_6 Reverse -361 -368 15.2804 0.0124
NP_442251.1_6 Forward -117 -110 15.2804 0.0124
NP_442251.1_6 Reverse -110 -117 15.2804 0.0124
NP_440684.1_9 Reverse -354 -368 12.586 0.168
NP_440684.1_9 Reverse -103 -117 8.94771 0.221
NP_441262.1_3 Reverse -360 -367 14.7888 0.0223
NP_441262.1_3 Reverse -109 -116 14.7888 0.0223
NP_441262.1_3 Forward -369 -362 14.7888 0.0223
NP_441262.1_3 Forward -118 -111 14.7888 0.0223
NP_440027.1_3 Forward -191 -173 2.57501 0.289
NP_443051.1_1 Forward -119 -110 19.5676 0.00335
NP_443051.1_1 Reverse -359 -368 10.4228 0.00754
NP_443051.1_1 Reverse -108 -117 10.4228 0.00754
NP_443051.1_1 Forward -370 -361 10.4228 0.00754
NP_439937.1_9 Reverse -108 -125 -5.56669 0.157
NP_439937.1_9 Reverse -236 -253 -13.8265 0.287
NP_439937.1_9 Forward -119 -102 -16.2847 0.287
NP_440626.1_1 Forward -368 -349 8.4551 0.299
NP_440439.1_1 Forward -121 -108 1.88757 0.139
NP_440439.1_1 Reverse -106 -119 0.0192843 0.203
NP_440372.1_2 Forward -368 -361 16.3621 0.0124
NP_440372.1_2 Reverse -361 -368 16.3621 0.0124
NP_440372.1_2 Forward -117 -110 16.3621 0.0124
NP_440372.1_2 Reverse -110 -117 16.3621 0.0124
NP_439977.1_5 Forward -124 -105 -0.787193 0.236
NP_440139.1_1 Forward -124 -105 3.04693 0.218
NP_441572.1_7 Forward -124 -105 -0.000545616 0.176
NP_440267.1_2 Forward -123 -109 8.75042 0.162
NP_442384.1_10 Forward -118 -105 17.4239 0.00585
NP_442384.1_10 Forward -369 -356 15.8506 0.00946
NP_442384.1_10 Reverse -109 -122 7.09911 0.0875
NP_442384.1_10 Reverse -360 -373 1.10092 0.268
NP_441018.1_7 Reverse -356 -375 12.2908 0.163
NP_441018.1_7 Reverse -99 -118 7.7676 0.265
NP_442790.1_4 Reverse -100 -119 -0.39387 0.0942
NP_442790.1_4 Reverse -351 -370 -8.26035 0.166
NP_442262.1_10 Forward -368 -361 14.1988 0.0123
NP_442262.1_10 Reverse -361 -368 14.1988 0.0123
NP_442262.1_10 Forward -117 -110 14.1988 0.0123
NP_442262.1_10 Reverse -110 -117 14.1988 0.0123
NP_441689.1_5 Forward -120 -110 17.8758 0.0158
NP_441689.1_5 Forward -371 -361 15.3192 0.0403
NP_441689.1_5 Reverse -358 -368 5.78111 0.197
NP_441689.1_5 Reverse -107 -117 5.78111 0.197
NP_441689.1_5 Forward -99 -89 5.19112 0.282
NP_440163.1_10 Forward -372 -362 11.3864 0.169
NP_440344.1_10 Forward -125 -108 12.0352 0.006
NP_440344.1_10 Forward -376 -359 3.0871 0.0274
NP_440344.1_10 Reverse -353 -370 -2.02611 0.06
NP_440344.1_10 Reverse -102 -119 -7.82764 0.119
NP_440531.1_6 Forward -126 -107 3.6377 0.141
NP_441965.1_3 Reverse -350 -369 0.58944 0.233
NP_441965.1_10 Forward -121 -105 11.1699 0.107
NP_441965.1_10 Forward -372 -356 10.3833 0.107
NP_440297.1_9 Reverse -361 -371 9.32148 0.0917
NP_440297.1_9 Reverse -110 -120 9.22315 0.0917
NP_440297.1_9 Forward -368 -358 -0.118297 0.282
NP_440297.1_9 Forward -117 -107 -0.118297 0.282
NP_441592.1_4 Forward -118 -99 -2.85214 0.272
NP_441103.1_9 Forward -301 -291 13.6614 0.243
NP_440990.1_7 Reverse -348 -367 6.19431 0.248
NP_441679.1_6 Reverse -355 -374 8.75091 0.09
NP_440999.1_9 Reverse -105 -119 0.687908 0.177
NP_440888.1_2 Reverse -109 -123 16.4202 0.00685
NP_440888.1_2 Reverse -360 -374 16.3219 0.00724
NP_440888.1_2 Reverse -40 -54 9.14375 0.137
NP_440888.1_2 Forward -118 -104 9.04542 0.139
NP_440888.1_2 Forward -369 -355 7.07881 0.208
NP_440600.1_4 Reverse -352 -370 -1.25915 0.163
NP_440060.1_1 Reverse -261 -280 10.3242 0.278
NP_442948.1_2 Forward -391 -372 11.7992 0.128
NP_441543.1_2 Forward -368 -359 16.9127 0.00359
NP_441543.1_2 Forward -117 -108 16.9127 0.00359
NP_441543.1_2 Reverse -361 -370 16.9127 0.00359
NP_441543.1_2 Reverse -110 -119 15.9293 0.00518
NP_441543.1_2 Forward -43 -34 4.81794 0.219
NP_442845.1_2 Reverse -103 -117 13.3726 0.0955
NP_442845.1_2 Reverse -354 -368 13.2743 0.0955
NP_442845.1_2 Forward -124 -110 11.6026 0.127
NP_442845.1_2 Forward -375 -361 6.78443 0.202
NP_441469.1_8 Forward -119 -110 6.5879 0.227
NP_441469.1_8 Forward -370 -361 6.48957 0.227
NP_441469.1_8 Reverse -359 -368 6.48957 0.227
NP_441469.1_8 Reverse -108 -117 6.48957 0.227
NP_443064.1_6 Forward -369 -359 12.5669 0.0796
NP_443064.1_6 Reverse -360 -370 12.5669 0.0796
NP_443064.1_6 Forward -118 -108 12.5669 0.0796
NP_443064.1_6 Reverse -109 -119 10.8217 0.13
NP_442578.1_7 Forward -368 -361 14.5921 0.026
NP_442578.1_7 Forward -117 -110 14.5921 0.026
NP_442578.1_7 Reverse -361 -368 14.5921 0.026
NP_442578.1_7 Reverse -110 -117 14.5921 0.026
NP_440710.1_1 Forward -126 -108 -8.83064 0.282
NP_441462.1_2 Reverse -109 -119 20.2362 0.000805
NP_441462.1_2 Forward -369 -359 11.5831 0.00406
NP_441462.1_2 Reverse -360 -370 11.5831 0.00406
NP_441462.1_2 Forward -118 -108 11.5831 0.00406
NP_443062.1_1 Reverse -109 -127 19.9543 0.0208
NP_443062.1_1 Reverse -360 -378 14.8839 0.0427
NP_443062.1_1 Forward -118 -100 3.86557 0.282
NP_443062.1_6 Reverse -101 -120 4.71934 0.214
NP_442204.1_1 Reverse -105 -116 8.7118 0.0852
NP_442204.1_1 Forward -122 -111 0.157002 0.283
NP_442204.1_1 Forward -146 -135 0.0586712 0.284
NP_441560.1_8 Reverse -104 -123 17.7456 0.0406
NP_441560.1_10 Forward -126 -107 6.09597 0.292
NP_442487.1_5 Reverse -108 -127 5.40686 0.227
NP_440516.1_2 Reverse -103 -121 -2.83245 0.299
NP_440516.1_8 Forward -369 -360 16.9127 0.00442
NP_440516.1_8 Reverse -360 -369 16.9127 0.00442
NP_440516.1_8 Forward -118 -109 16.9127 0.00442
NP_440516.1_8 Reverse -109 -118 16.9127 0.00442
NP_441785.1_1 Reverse -360 -374 13.2231 0.231
NP_442428.1_4 Reverse -34 -53 4.03102 0.238
NP_442428.1_5 Forward -368 -361 15.8704 0.0124
NP_442428.1_5 Reverse -361 -368 15.8704 0.0124
NP_442428.1_5 Forward -117 -110 15.8704 0.0124
NP_442428.1_5 Reverse -110 -117 15.8704 0.0124
NP_442428.1_7 Reverse -251 -270 6.29264 0.286
NP_442120.1_10 Reverse -61 -80 -9.14533 0.242
NP_442120.1_10 Reverse -360 -379 -9.53865 0.243
NP_440673.1_2 Reverse -350 -369 14.4868 0.0986
NP_440673.1_3 Forward -367 -360 12.4288 0.0426
NP_440673.1_3 Forward -116 -109 12.4288 0.0426
NP_440673.1_3 Reverse -362 -369 12.4288 0.0426
NP_440673.1_3 Reverse -111 -118 12.4288 0.0426
NP_440865.1_9 Forward -124 -105 -8.85033 0.271
NP_441052.1_2 Forward -369 -359 19.9412 0.00106
NP_441052.1_2 Reverse -360 -370 19.9412 0.00106
NP_441052.1_2 Forward -118 -108 19.9412 0.00106
NP_441052.1_2 Reverse -109 -119 10.4031 0.0285
NP_441052.1_2 Forward -112 -102 1.55333 0.238
NP_442219.1_8 Forward -379 -360 7.10414 0.277
NP_442219.1_9 Forward -368 -359 17.7976 0.00718
NP_442219.1_9 Forward -117 -108 17.7976 0.00718
NP_442219.1_9 Reverse -361 -370 17.7976 0.00718
NP_442219.1_9 Reverse -110 -119 8.25953 0.0681
NP_440436.1_4 Forward -368 -359 17.2072 0.00233
NP_440436.1_4 Forward -117 -108 17.2072 0.00233
NP_440436.1_4 Reverse -361 -370 17.2072 0.00233
NP_440436.1_4 Reverse -110 -119 9.24241 0.0871
NP_440436.1_4 Forward -336 -327 6.09583 0.172
NP_441884.1_9 Forward -372 -353 -15.5368 0.138
NP_440314.1_9 Forward -368 -349 1.17943 0.0933
NP_441719.1_2 Reverse -357 -371 13.925 0.278
NP_441719.1_4 Forward -368 -361 16.3621 0.0124
NP_441719.1_4 Reverse -361 -368 16.3621 0.0124
NP_441719.1_4 Forward -117 -110 16.3621 0.0124
NP_441719.1_4 Reverse -110 -117 16.3621 0.0124
NP_442366.1_3 Forward -119 -101 16.0471 0.0198
NP_442366.1_3 Reverse -189 -207 -5.38906 0.287
NP_442366.1_5 Reverse -357 -367 15.4175 0.0374
NP_442366.1_5 Reverse -106 -116 14.0409 0.0497
NP_439949.1_7 Reverse -76 -90 14.3559 0.226
NP_441115.1_4 Forward -119 -101 13.883 0.067
NP_441115.1_4 Reverse -108 -126 8.76983 0.237
NP_442206.1_10 Forward -369 -354 4.30646 0.178
NP_440328.1_4 Forward -148 -129 8.94757 0.106
NP_443054.1_2 Forward -371 -357 1.57289 0.245
NP_443054.1_2 Forward -120 -106 1.57289 0.245
NP_441851.1_10 Forward -370 -360 15.8113 0.00552
NP_441851.1_10 Reverse -359 -369 15.8113 0.00552
NP_441851.1_10 Reverse -108 -118 15.8113 0.00552
NP_441851.1_10 Forward -119 -109 8.53483 0.114
NP_441851.1_10 Reverse -87 -97 3.91327 0.296
NP_441542.1_4 Reverse -76 -90 3.04785 0.292
NP_441668.1_4 Reverse -99 -118 2.3594 0.2
NP_441668.1_4 Reverse -350 -369 0.884433 0.229
NP_442515.1_1 Forward -370 -356 13.3726 0.0278
NP_442515.1_1 Reverse -359 -373 9.43936 0.0629
NP_442515.1_1 Forward -224 -210 1.27789 0.165
NP_440593.1_10 Reverse -80 -99 9.14423 0.272
NP_440165.1_5 Reverse -108 -127 -7.86702 0.281
NP_441046.1_2 Reverse -203 -222 2.55606 0.24
NP_441349.1_10 Forward -128 -109 16.5191 0.011
NP_441349.1_10 Forward -379 -360 6.4893 0.0358
NP_441349.1_10 Reverse -350 -369 3.04771 0.0704
NP_441349.1_10 Reverse -99 -118 0.0977854 0.0906
NP_441409.1_6 Reverse -354 -373 0.687771 0.0648
NP_441409.1_6 Reverse -103 -122 -0.4922 0.0698
NP_441409.1_6 Forward -124 -105 -5.11376 0.0991
NP_440432.1_9 Forward -368 -353 -1.98672 0.167
NP_440474.1_8 Reverse -110 -124 12.192 0.0915
NP_440431.1_3 Forward -119 -100 6.78429 0.0886
NP_440431.1_3 Forward -45 -26 -6.68705 0.195
NP_442450.1_5 Forward -120 -110 9.41981 0.115
NP_442450.1_5 Forward -371 -361 9.32148 0.115
NP_442450.1_5 Reverse -358 -368 7.55152 0.13
NP_442450.1_5 Reverse -107 -117 7.55152 0.13
NP_440588.1_2 Reverse -100 -119 5.89931 0.0609
NP_440588.1_2 Reverse -351 -370 -2.95047 0.174
NP_441570.1_1 Reverse -360 -378 9.0656 0.0123
NP_441570.1_1 Reverse -109 -127 1.78911 0.0286
NP_440078.1_4 Reverse -98 -117 9.3409 0.295
NP_440078.1_10 Forward -118 -99 7.37428 0.217
NP_441078.1_4 Forward -369 -360 19.6659 0.0007
NP_441078.1_4 Reverse -360 -369 19.6659 0.0007
NP_441078.1_4 Forward -118 -109 19.6659 0.0007
NP_441078.1_4 Reverse -109 -118 19.6659 0.0007
NP_441078.1_4 Reverse -214 -223 -1.08191 0.222
NP_441078.1_4 Forward -223 -214 -2.06522 0.295
NP_442729.1_8 Reverse -356 -369 10.639 0.125
NP_440526.1_3 Reverse -361 -372 10.1862 0.0646
NP_440526.1_3 Forward -117 -106 8.02298 0.126
NP_440526.1_3 Reverse -110 -121 1.82816 0.267
NP_440526.1_3 Forward -368 -357 1.04151 0.267
NP_441432.1_8 Reverse -359 -368 16.8143 0.00595
NP_441432.1_8 Reverse -108 -117 16.8143 0.00595
NP_441432.1_8 Forward -370 -361 16.8143 0.00595
NP_441432.1_8 Forward -119 -110 16.8143 0.00595
NP_441432.1_8 Forward -98 -89 5.3096 0.17
NP_441432.1_8 Reverse -182 -191 2.55633 0.298
NP_442320.1_8 Forward -375 -361 13.9626 0.0144
NP_442320.1_8 Reverse -354 -368 4.62115 0.0472
NP_442320.1_8 Forward -124 -110 -2.16369 0.0867
NP_442344.1_7 Reverse -361 -380 9.43923 0.0407
NP_441732.1_2 Forward -122 -106 -6.92296 0.0558
NP_441732.1_2 Reverse -105 -121 -7.70961 0.0885
NP_441732.1_2 Forward -373 -357 -16.4611 0.167
NP_441732.1_2 Reverse -356 -372 -16.8544 0.207
NP_440760.1_1 Forward -369 -350 -7.4737 0.0704
NP_440760.1_1 Reverse -360 -379 -10.817 0.0847
NP_440760.1_1 Forward -118 -99 -16.0285 0.163
NP_440760.1_1 Forward -243 -224 -23.2067 0.288
NP_440199.1_10 Forward -372 -362 16.7946 0.0381
NP_440199.1_10 Forward -121 -111 14.238 0.0861
NP_440578.1_10 Reverse -95 -114 14.5524 0.246
NP_440713.1_4 Forward -128 -109 11.9958 0.112
NP_440713.1_4 Reverse -99 -118 2.94938 0.254
NP_442489.1_2 Forward -380 -361 11.6025 0.151
NP_442489.1_7 Forward -369 -360 20.1576 0.000695
NP_442489.1_7 Reverse -360 -369 20.1576 0.000695
NP_442489.1_7 Forward -118 -109 20.1576 0.000695
NP_442489.1_7 Reverse -109 -118 20.1576 0.000695
NP_442079.1_7 Reverse -110 -129 2.3594 0.229
NP_442079.1_7 Forward -368 -349 0.392778 0.286
NP_440559.1_1 Forward -368 -359 17.4043 0.00658
NP_440559.1_1 Forward -117 -108 17.4043 0.00658
NP_440559.1_1 Reverse -361 -370 17.4043 0.00658
NP_440559.1_1 Reverse -110 -119 8.65285 0.0586
NP_441659.2_8 Reverse -109 -119 20.9245 0.000805
NP_441659.2_8 Forward -369 -359 18.1713 0.00133
NP_441659.2_8 Reverse -360 -370 18.1713 0.00133
NP_441659.2_8 Forward -118 -108 18.1713 0.00133
NP_441022.1_1 Reverse -250 -259 14.5198 0.183
NP_442913.1_9 Reverse -41 -60 9.14423 0.23
NP_442913.1_10 Forward -378 -359 9.0459 0.0462
NP_442346.1_5 Forward -370 -360 16.6963 0.00248
NP_442346.1_5 Reverse -359 -369 16.6963 0.00248
NP_442346.1_5 Reverse -108 -118 16.6963 0.00248
NP_442346.1_5 Forward -119 -109 16.303 0.00248
NP_440545.1_3 Reverse -105 -122 9.97027 0.0362
NP_440545.1_3 Forward -122 -105 -7.04099 0.295
NP_440025.1_3 Forward -92 -78 10.2235 0.29
NP_440831.1_3 Forward -208 -189 5.61052 0.28
NP_441786.1_10 Forward -378 -359 11.5042 0.157
NP_440555.1_1 Reverse -98 -117 8.55425 0.167
NP_440459.1_2 Reverse -223 -240 8.00365 0.272
NP_442603.1_7 Forward -118 -104 11.307 0.117
NP_442603.1_7 Forward -369 -355 7.17714 0.211
NP_441833.1_4 Forward -368 -361 15.9687 0.0124
NP_441833.1_4 Reverse -361 -368 15.9687 0.0124
NP_441833.1_4 Forward -117 -110 15.9687 0.0124
NP_441833.1_4 Reverse -110 -117 15.9687 0.0124
NP_441329.1_1 Reverse -255 -274 7.87766 0.236
NP_442162.1_9 Forward -368 -361 16.2637 0.0124
NP_442162.1_9 Reverse -361 -368 16.2637 0.0124
NP_442162.1_9 Forward -117 -110 16.2637 0.0124
NP_442162.1_9 Reverse -110 -117 16.2637 0.0124
NP_440671.1_4 Forward -375 -361 15.3392 0.0454
NP_440671.1_4 Forward -124 -110 12.7826 0.101
NP_440671.1_4 Reverse -103 -117 10.7177 0.151
NP_440224.1_1 Forward -129 -110 -0.295539 0.141
NP_441044.1_4 Forward -249 -231 3.65739 0.235
NP_442199.1_5 Forward -377 -358 -2.45882 0.185
NP_442199.1_5 Forward -126 -107 -4.81876 0.231
NP_442140.1_3 Forward -368 -358 12.2714 0.0632
NP_442140.1_3 Forward -117 -107 12.2714 0.0632
NP_442140.1_3 Reverse -361 -371 4.40493 0.243
NP_440875.1_9 Reverse -37 -47 11.7788 0.152
NP_440875.1_9 Reverse -111 -121 7.59334 0.255
NP_441813.1_5 Forward -371 -361 15.9097 0.01
NP_441813.1_5 Forward -120 -110 15.9097 0.01
NP_441813.1_5 Reverse -358 -368 8.63316 0.0367
NP_441813.1_5 Reverse -107 -117 8.63316 0.0367
NP_440590.1_4 Forward -117 -104 12.9006 0.013
NP_440590.1_4 Reverse -361 -374 2.57589 0.0845
NP_440590.1_4 Forward -368 -355 0.805932 0.143
NP_440590.1_4 Reverse -110 -123 -3.81562 0.255
NP_440567.1_1 Forward -368 -354 11.406 0.0286
NP_440567.1_1 Reverse -110 -124 9.43936 0.0442
NP_440567.1_1 Forward -117 -103 4.03116 0.131
NP_440567.1_1 Reverse -361 -375 -0.0987402 0.264
NP_442497.1_10 Reverse -110 -119 17.601 0.00813
NP_442497.1_10 Forward -368 -359 10.4228 0.0087
NP_442497.1_10 Forward -117 -108 10.4228 0.0087
NP_442497.1_10 Reverse -361 -370 10.4228 0.0087
NP_440821.1_4 Forward -371 -361 18.2696 0.00448
NP_440821.1_4 Forward -120 -110 11.0914 0.0146
NP_440821.1_4 Reverse -358 -368 9.41981 0.0286
NP_440821.1_4 Reverse -107 -117 9.41981 0.0286
NP_440227.1_10 Forward -375 -356 11.995 0.212
NP_441239.1_9 Forward -120 -108 12.1337 0.0494
NP_441239.1_9 Forward -46 -34 5.74217 0.21
NP_441239.1_9 Forward -371 -359 4.36554 0.253
NP_441239.1_9 Reverse -358 -370 3.38223 0.285
NP_441239.1_9 Reverse -107 -119 3.38223 0.285
NP_442568.1_8 Forward -271 -257 10.3243 0.257
NP_441727.1_3 Reverse -353 -372 10.8159 0.161
NP_440400.1_1 Forward -221 -202 -3.24622 0.292
NP_441892.1_1 Reverse -100 -117 2.49712 0.14
NP_441892.1_1 Forward -378 -361 -1.92778 0.215
NP_441892.1_1 Forward -127 -110 -1.92778 0.215
NP_440604.1_6 Forward -49 -30 -6.29373 0.294
NP_440219.1_1 Reverse -254 -273 14.8467 0.187
NP_442643.1_1 Forward -124 -105 -10.522 0.231
NP_441017.1_6 Forward -373 -359 14.1586 0.157
NP_441541.1_1 Forward -27 -9 -4.9636 0.291
NP_442138.1_10 Reverse -109 -128 -7.67036 0.29
NP_440546.1_4 Reverse -109 -119 13.5365 0.0459
NP_440546.1_4 Forward -369 -359 10.046 0.109
NP_440546.1_4 Reverse -360 -370 10.046 0.109
NP_440546.1_4 Forward -118 -108 10.046 0.109
NP_439974.1_4 Forward -55 -36 10.9142 0.24
NP_443033.1_7 Forward -129 -110 10.8159 0.293
NP_440462.1_6 Forward -120 -110 16.893 0.00853
NP_440462.1_6 Forward -371 -361 7.74818 0.0699
NP_440462.1_6 Reverse -358 -368 1.35667 0.294
NP_440462.1_6 Reverse -107 -117 1.35667 0.294
NP_440868.1_4 Reverse -356 -368 8.10212 0.0602
NP_440868.1_4 Forward -122 -110 6.23383 0.0878
NP_440868.1_4 Reverse -105 -117 6.1355 0.0878
NP_440868.1_4 Forward -373 -361 5.93884 0.0879
NP_440341.1_7 Forward -154 -140 11.6026 0.24
NP_442402.1_10 Forward -152 -142 11.8776 0.231
NP_441848.1_4 Forward -268 -252 7.1687 0.295
NP_441084.1_6 Forward -46 -32 9.63499 0.273
NP_440696.1_3 Reverse -167 -185 -2.24246 0.274
NP_441843.2_9 Reverse -362 -380 13.3126 0.205
NP_442039.1_4 Forward -368 -361 15.1821 0.0124
NP_442039.1_4 Reverse -361 -368 15.1821 0.0124
NP_442039.1_4 Forward -117 -110 15.1821 0.0124
NP_442039.1_4 Reverse -110 -117 15.1821 0.0124
NP_442039.1_7 Forward -61 -51 10.8948 0.257
NP_442039.1_7 Reverse -140 -150 7.74818 0.271
NP_441811.1_8 Reverse -103 -117 5.80112 0.289
NP_441926.1_3 Reverse -109 -125 6.15506 0.17
NP_440825.1_7 Forward -368 -358 12.9096 0.152
NP_440825.1_7 Forward -117 -107 12.9096 0.152
NP_442696.1_2 Forward -98 -80 9.65558 0.244
NP_442837.1_2 Forward -117 -98 22.1239 0.0411
NP_442837.1_3 Forward -368 -361 15.7721 0.0124
NP_442837.1_3 Reverse -361 -368 15.7721 0.0124
NP_442837.1_3 Forward -117 -110 15.7721 0.0124
NP_442837.1_3 Reverse -110 -117 15.7721 0.0124
NP_439994.1_3 Forward -119 -100 8.24345 0.291
NP_442053.1_1 Forward -369 -360 18.3876 0.0007
NP_442053.1_1 Reverse -360 -369 18.3876 0.0007
NP_442053.1_1 Forward -118 -109 18.3876 0.0007
NP_442053.1_1 Reverse -109 -118 18.3876 0.0007
NP_440505.1_3 Forward -371 -361 16.303 0.00696
NP_440505.1_3 Forward -120 -110 15.123 0.014
NP_440505.1_3 Reverse -358 -368 9.22315 0.122
NP_440505.1_3 Reverse -107 -117 9.22315 0.122
NP_441203.1_1 Forward -117 -98 -20.3551 0.297
NP_442532.1_1 Forward -281 -267 9.7249 0.267
NP_441408.2_7 Forward -120 -101 5.60432 0.172
NP_440914.1_1 Forward -369 -359 17.5935 0.000537
NP_440914.1_1 Reverse -360 -370 17.5935 0.000537
NP_440914.1_1 Forward -118 -108 17.5935 0.000537
NP_440914.1_1 Reverse -109 -119 16.3248 0.00196
NP_440914.1_1 Forward -81 -71 7.44401 0.237
NP_441011.1_8 Reverse -110 -119 16.6177 0.00602
NP_441011.1_8 Forward -368 -359 8.25953 0.144
NP_441011.1_8 Reverse -361 -370 8.25953 0.144
NP_441011.1_8 Forward -117 -108 8.25953 0.144
NP_442533.1_6 Forward -369 -360 17.2076 0.00137
NP_442533.1_6 Reverse -360 -369 17.2076 0.00137
NP_442533.1_6 Forward -118 -109 17.2076 0.00137
NP_442533.1_6 Reverse -109 -118 17.2076 0.00137
NP_442533.1_6 Reverse -35 -44 1.86802 0.284
NP_440263.1_6 Forward -129 -110 15.4374 0.131
NP_442229.1_1 Reverse -45 -59 6.98048 0.2
NP_441482.1_7 Forward -375 -361 0.491246 0.0558
NP_441482.1_7 Reverse -103 -117 -8.45687 0.193
NP_441482.1_7 Forward -124 -110 -10.9151 0.222
NP_441482.1_7 Reverse -220 -234 -11.2101 0.245
NP_439944.1_9 Reverse -361 -371 19.0562 0.00329
NP_439944.1_9 Reverse -110 -120 17.6796 0.00347
NP_439944.1_9 Forward -368 -358 10.5014 0.0887
NP_439944.1_9 Forward -117 -107 10.5014 0.0887
NP_441028.1_6 Forward -301 -291 14.6309 0.158
NP_440116.1_5 Reverse -106 -123 7.41366 0.155
NP_440116.1_8 Reverse -110 -129 -6.68705 0.215
NP_440116.1_8 Reverse -361 -380 -7.96535 0.242
NP_441527.1_4 Forward -271 -252 -11.8892 0.284
NP_441527.1_4 Forward -273 -254 -12.8441 0.294
NP_440115.1_6 Reverse -106 -116 9.32148 0.115
NP_440007.1_9 Forward -122 -108 9.2427 0.171
NP_440007.1_9 Reverse -105 -119 1.37622 0.285
NP_440007.1_9 Forward -373 -359 0.88457 0.29
NP_440608.1_6 Forward -368 -349 3.34192 0.29
NP_441972.1_5 Forward -368 -349 -4.72043 0.211
NP_441106.1_1 Forward -119 -110 18.486 0.0028
NP_441106.1_1 Forward -370 -361 9.63616 0.0311
NP_441106.1_1 Reverse -359 -368 9.63616 0.0311
NP_441106.1_1 Reverse -108 -117 9.63616 0.0311
NP_441106.1_1 Reverse -34 -43 2.65466 0.269
NP_439903.1_6 Forward -121 -102 11.7983 0.093
NP_439903.1_6 Forward -372 -353 0.195343 0.268
NP_440797.1_2 Forward -380 -361 21.7254 0.0269
NP_441286.1_1 Reverse -359 -371 21.3768 0.00196
NP_441286.1_1 Reverse -108 -120 14.3953 0.00424
NP_441286.1_1 Forward -370 -358 12.9203 0.00815
NP_441286.1_1 Forward -119 -107 3.48056 0.0467
NP_440670.1_8 Forward -369 -360 18.3876 0.000699
NP_440670.1_8 Reverse -360 -369 18.3876 0.000699
NP_440670.1_8 Forward -118 -109 18.3876 0.000699
NP_440670.1_8 Reverse -109 -118 18.3876 0.000699
NP_440886.1_7 Forward -119 -109 8.04271 0.0805
NP_440886.1_7 Forward -370 -360 7.94438 0.0805
NP_440886.1_7 Reverse -359 -369 7.94438 0.0805
NP_440886.1_7 Reverse -108 -118 7.94438 0.0805
NP_442614.1_2 Forward -118 -104 8.25939 0.255
NP_442382.1_9 Forward -297 -278 8.65176 0.281
NP_442072.1_9 Reverse -108 -126 -21.417 0.208
NP_440823.1_4 Forward -253 -234 3.34271 0.253
NP_440907.2_8 Reverse -110 -120 9.51767 0.103
NP_440907.2_8 Forward -368 -358 7.64939 0.117
NP_440907.2_8 Forward -117 -107 7.64939 0.117
NP_440326.1_5 Reverse -107 -120 15.2606 0.179
NP_440841.1_4 Forward -371 -352 0.687771 0.119
NP_440841.1_4 Forward -120 -101 -9.53865 0.26
NP_441463.1_2 Reverse -243 -261 3.83061 0.198
NP_441463.1_3 Forward -379 -360 8.35759 0.0487
NP_441463.1_3 Forward -128 -109 3.24438 0.106
NP_441463.1_6 Forward -120 -106 10.088 0.242
NP_441463.1_6 Forward -371 -357 8.0587 0.25
NP_441626.1_2 Forward -368 -361 15.7721 0.0124
NP_441626.1_2 Reverse -361 -368 15.7721 0.0124
NP_441626.1_2 Forward -117 -110 15.7721 0.0124
NP_441626.1_2 Reverse -110 -117 15.7721 0.0124
NP_439958.1_2 Forward -35 -21 13.3726 0.246
NP_442794.1_1 Reverse -105 -117 21.9668 0.00123
NP_442794.1_1 Reverse -356 -368 9.28209 0.0795
NP_442615.1_1 Forward -127 -109 8.08229 0.0297
NP_442615.1_1 Reverse -100 -118 7.68896 0.0306
NP_442615.1_1 Reverse -351 -369 4.24738 0.048
NP_442615.1_1 Forward -378 -360 -2.93078 0.153
NP_441962.1_4 Forward -374 -355 0.58944 0.111
NP_441962.1_4 Forward -117 -98 -11.9969 0.25
NP_441962.1_4 Reverse -361 -380 -13.7669 0.277
NP_441962.1_4 Reverse -178 -197 -14.2585 0.285
NP_440387.1_1 Forward -118 -102 5.36841 0.0325
NP_440387.1_1 Forward -369 -353 5.17175 0.0343
NP_440387.1_1 Reverse -360 -376 -4.66135 0.194
NP_441488.1_8 Reverse -104 -118 12.782 0.146
NP_441836.1_2 Forward -124 -105 -2.95047 0.232
NP_441993.1_1 Reverse -360 -379 0.777198 0.292
NP_440467.1_3 Reverse -110 -129 12.2328 0.246
NP_440114.1_10 Reverse -109 -123 16.2242 0.0194
NP_440114.1_10 Reverse -360 -374 12.291 0.0866
NP_440114.1_10 Forward -81 -67 7.37441 0.236
NP_440114.1_10 Reverse -72 -86 5.99778 0.289
NP_442323.1_7 Forward -392 -373 1.47364 0.279
NP_441510.2_6 Forward -379 -360 11.8967 0.298
NP_440287.1_6 Reverse -100 -119 7.66927 0.151
NP_441237.1_9 Forward -368 -358 14.828 0.0242
NP_441237.1_9 Forward -117 -107 14.828 0.0242
NP_441237.1_9 Reverse -73 -83 10.8948 0.214
NP_439910.1_2 Forward -126 -109 -12.6459 0.0924
NP_439910.1_2 Forward -377 -360 -13.6292 0.162
NP_440457.1_1 Forward -122 -110 9.67541 0.092
NP_440457.1_1 Forward -373 -361 0.0389777 0.25
NP_440457.1_1 Reverse -105 -117 -0.452677 0.263
NP_442297.1_4 Reverse -105 -124 16.0312 0.145
NP_442509.1_9 Forward -369 -359 8.14104 0.192
NP_442509.1_9 Reverse -360 -370 8.14104 0.192
NP_442509.1_9 Forward -118 -108 8.14104 0.192
NP_442509.1_9 Reverse -109 -119 8.04271 0.192
NP_442509.1_9 Forward -56 -46 6.46942 0.268
NP_440554.1_4 Reverse -110 -120 16.1063 0.0189
NP_440554.1_4 Reverse -361 -371 7.05986 0.106
NP_441885.1_5 Forward -369 -359 20.9245 0.000538
NP_441885.1_5 Reverse -360 -370 20.9245 0.000538
NP_441885.1_5 Forward -118 -108 20.9245 0.000538
NP_441885.1_5 Reverse -109 -119 11.3864 0.00668
NP_441885.1_5 Reverse -214 -224 0.471689 0.145
NP_442703.1_9 Forward -275 -257 6.70565 0.244
NP_442341.1_7 Forward -370 -356 13.6676 0.0334
NP_442341.1_7 Reverse -359 -373 8.35772 0.0881
NP_442341.1_7 Forward -119 -105 7.66941 0.0994
NP_442341.1_9 Forward -120 -106 18.4851 0.0166
NP_442341.1_9 Reverse -358 -372 8.65209 0.166
NP_442341.1_9 Reverse -70 -84 7.47213 0.198
NP_442341.1_9 Reverse -107 -121 6.39049 0.228
NP_440750.1_5 Forward -270 -256 12.586 0.166
NP_440423.1_6 Forward -377 -358 -16.0285 0.229
NP_443000.1_7 Forward -120 -110 17.4829 0.00719
NP_443000.1_7 Forward -371 -361 17.0896 0.00865
NP_443000.1_7 Reverse -358 -368 10.3048 0.0345
NP_443000.1_7 Reverse -107 -117 10.3048 0.0345
NP_443000.1_7 Forward -99 -89 4.10993 0.219
NP_440507.2_3 Forward -378 -359 15.0432 0.106
NP_442513.1_5 Forward -377 -358 10.2251 0.266
NP_441842.1_10 Reverse -353 -367 7.86607 0.241
NP_441842.1_10 Forward -125 -111 6.88276 0.271
NP_441842.1_10 Forward -63 -49 6.48943 0.286
NP_440275.1_3 Forward -120 -110 9.12481 0.055
NP_440275.1_3 Forward -371 -361 8.1415 0.0602
NP_440275.1_3 Reverse -358 -368 8.04317 0.0602
NP_440275.1_3 Reverse -107 -117 8.04317 0.0602
NP_440091.1_1 Forward -373 -361 16.4603 0.0153
NP_440091.1_1 Forward -122 -110 10.8554 0.0429
NP_443060.1_2 Forward -379 -360 4.52268 0.183
NP_443060.1_5 Reverse -352 -371 6.78348 0.235
NP_442451.1_2 Forward -377 -358 -11.2103 0.287
NP_441207.1_4 Reverse -235 -254 2.55606 0.291
NP_442495.1_4 Reverse -137 -147 14.4347 0.16
NP_440149.1_8 Reverse -360 -379 1.96607 0.116
NP_440149.1_8 Forward -369 -350 -2.55715 0.172
NP_441105.1_3 Reverse -98 -117 13.4708 0.0292
NP_441105.1_3 Forward -129 -110 0.491109 0.124
NP_441105.1_3 Reverse -227 -246 -1.96717 0.154
NP_441105.1_3 Reverse -355 -374 -4.42544 0.2
NP_440216.1_1 Reverse -109 -123 7.37441 0.00942
NP_440216.1_1 Reverse -360 -374 -1.8687 0.0412
NP_440216.1_1 Forward -118 -104 -10.2268 0.145
NP_440216.1_1 Forward -369 -355 -10.6202 0.145
NP_440216.1_9 Reverse -56 -65 12.7828 0.223
NP_440216.1_9 Forward -110 -101 5.99792 0.289
NP_440172.1_1 Reverse -109 -119 17.5813 0.00421
NP_440172.1_1 Forward -369 -359 15.0247 0.00945
NP_440172.1_1 Reverse -360 -370 15.0247 0.00945
NP_440172.1_1 Forward -118 -108 15.0247 0.00945
NP_442371.1_1 Reverse -292 -302 13.9425 0.191
NP_442015.1_10 Reverse -105 -118 19.8821 0.00366
NP_442015.1_10 Reverse -356 -369 1.39592 0.204
NP_442015.1_10 Forward -373 -360 0.60927 0.221
NP_441226.1_7 Forward -368 -361 14.4934 0.0123
NP_441226.1_7 Reverse -361 -368 14.4934 0.0123
NP_441226.1_7 Forward -117 -110 14.4934 0.0123
NP_441226.1_7 Reverse -110 -117 14.4934 0.0123
NP_441111.1_7 Forward -368 -360 18.7023 0.00294
NP_441111.1_7 Forward -117 -109 18.7023 0.00294
NP_441111.1_7 Reverse -361 -369 18.7023 0.00294
NP_441111.1_7 Reverse -110 -118 18.7023 0.00294
NP_441766.1_2 Forward -369 -360 17.5026 0.00297
NP_441766.1_2 Reverse -360 -369 17.5026 0.00297
NP_441766.1_2 Forward -118 -109 17.5026 0.00297
NP_441766.1_2 Reverse -109 -118 17.5026 0.00297
NP_440416.1_1 Reverse -360 -379 -2.36049 0.116
NP_440416.1_9 Reverse -102 -121 -15.5368 0.193
NP_443052.1_8 Forward -379 -360 -9.83364 0.197
NP_440261.1_5 Forward -117 -104 -2.83231 0.0932
NP_440261.1_5 Forward -368 -355 -10.3055 0.201
NP_440988.1_10 Forward -371 -357 8.28727 0.205
NP_440988.1_10 Forward -120 -106 6.2542 0.232
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

CGTTTTAACCGCAGACCAACTTCGTAGAAATGGCGATCGCCAAAATAGAACCGTAAAGCGTTTAACGCTCCTCGTTATATACTGGATTTAGTCCACTTATTTTCCCCTGTGATTCGTAACTTTAAAGATAAAGAAGCTCAAAAAATCTTTGAACGACAACGCTCCCGCAAACTGCCTGGCGACATCCAACAAGTTGCCCTCAGAAAGCTCCGAATGCTAAACCGAGCCGAGACATTACAAGACCTTAAAGTTCCCCCAGCTAATCGATTAGAAGCTTTGAAAGGCGATCGCCAAGGACAATATAGCATTCGCATTAATGCCCAATGGCGTATCTGTTTCCAATGGGAGAACGGAGAAGCCCTCGACGTAGAAATTATTGACTACCATTAAAAATAAACCC

CDS

ATGAATCCAGACAAACTAAAACCTATTCATCCCGGCGAAGTTCTCCTTGAAGAATTTTTGCAGCCAATGAATCTAAGCCAAAATAAGCTAGCTTTAGCAATTCGTGTACCTGCTCGTCGTATCAACGAAATTGTGCAGGGAAAACGTCGTATTACCGCTGATACCGCCCTACGTTTAGCACTATATTTCAATATGTCTCCTCGGTTTTGGTTAGGCTTGCAAATGGACTATGACCTAGATTTAGCAGAGGATGAAATTGGCGAAAAGCTTCAACAGGAAGTAACGACTTTCAATCTAGACAACGTTGCCGTTTAA

Protein

No sequence available