Your browser is old and dusty. Try Google Chrome!

Details for slr5013

ORF slr5013
Accession NP_942169.1
Symbol
Category
Definition
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_442151.1_6 Reverse -64 -78 5.70279 0.266
NP_441642.1_1 Forward -69 -50 -2.45882 0.289
NP_443027.1_4 Reverse -331 -341 6.96153 0.253
NP_440761.1_4 Forward -78 -59 -20.4534 0.287
NP_441859.1_3 Forward -74 -55 1.37531 0.287
NP_442097.1_2 Reverse -176 -195 1.86774 0.259
NP_441200.1_4 Reverse -291 -310 5.80098 0.294
NP_442276.1_2 Forward -276 -257 3.83436 0.299
NP_440769.1_3 Forward -26 -7 12.88 0.28
NP_442827.1_8 Forward -353 -334 6.29183 0.109
NP_440870.1_3 Reverse -161 -180 3.83436 0.208
NP_441716.1_1 Forward -67 -53 3.24451 0.272
NP_441716.1_2 Forward -23 -4 -0.0896902 0.266
NP_441486.1_1 Forward -70 -56 -5.31028 0.231
NP_442687.1_7 Reverse -32 -42 8.63316 0.104
NP_442687.1_7 Forward -346 -336 7.35486 0.134
NP_440800.1_7 Reverse -224 -238 10.9143 0.294
NP_442321.1_4 Forward -77 -58 -4.6221 0.284
NP_440203.1_5 Reverse -339 -349 10.796 0.213
NP_442690.1_1 Reverse -2 -21 -12.1936 0.241
NP_443055.1_6 Reverse -336 -354 0.510066 0.242
NP_440138.1_6 Forward -72 -53 9.83173 0.171
NP_442002.1_9 Forward -346 -339 12.4288 0.185
NP_442438.1_10 Reverse -196 -210 0.491246 0.225
NP_442438.1_10 Forward -350 -336 -1.18038 0.296
NP_440879.1_6 Reverse -331 -350 3.73603 0.231
NP_440147.1_4 Forward -150 -137 0.117615 0.265
NP_441916.1_10 Forward -75 -56 10.8159 0.141
NP_441041.1_7 Forward -241 -229 6.05711 0.226
NP_440289.1_2 Forward -70 -57 -1.55401 0.24
NP_440260.1_8 Reverse -49 -67 -4.79907 0.273
NP_442215.1_2 Reverse -56 -72 5.17175 0.0796
NP_442215.1_2 Reverse -334 -350 -4.56302 0.235
NP_442554.1_8 Reverse -65 -75 3.12662 0.239
NP_443009.1_5 Forward -239 -228 6.35136 0.165
NP_443009.1_5 Reverse -186 -197 5.26972 0.21
NP_442076.1_5 Forward -188 -169 8.55425 0.233
NP_440970.1_1 Forward -364 -350 15.6342 0.292
NP_441876.1_9 Reverse -341 -351 11.8776 0.269
NP_441876.1_9 Forward -303 -293 10.501 0.292
NP_441826.1_5 Reverse -59 -78 1.86774 0.282
NP_441251.1_9 Forward -331 -312 15.135 0.225
NP_441878.1_6 Forward -68 -58 -7.59145 0.245
NP_441036.1_8 Reverse -130 -140 9.61647 0.174
NP_441445.1_1 Reverse -49 -68 10.1275 0.0981
NP_441445.1_1 Reverse -117 -136 2.26107 0.238
NP_442066.2_4 Reverse -336 -355 -6.68705 0.254
NP_441116.1_6 Forward -347 -328 7.96426 0.287
NP_442632.1_1 Reverse -150 -169 13.9616 0.239
NP_440690.1_5 Forward -166 -147 14.1591 0.272
NP_441633.1_3 Reverse -334 -347 -6.37223 0.248
NP_442998.1_5 Reverse -267 -277 9.22315 0.248
NP_441179.1_4 Forward -61 -42 9.83173 0.225
NP_441464.1_10 Reverse -124 -138 12.0943 0.206
NP_442150.1_8 Reverse -169 -188 16.4198 0.265
NP_440306.1_3 Reverse -57 -76 6.09597 0.295
NP_441939.1_3 Forward -306 -287 5.50599 0.273
NP_440586.1_8 Reverse -334 -341 5.64364 0.297
NP_441912.1_3 Reverse -291 -310 15.4374 0.27
NP_439937.1_9 Reverse -335 -352 -11.2699 0.248
NP_441138.1_5 Forward -381 -368 2.83104 0.297
NP_442511.1_2 Reverse -40 -59 17.4775 0.21
NP_441060.1_3 Reverse -45 -64 9.0459 0.228
NP_441965.1_3 Forward -355 -336 -0.590531 0.266
NP_440297.1_9 Forward -72 -62 0.766681 0.282
NP_440350.1_1 Reverse -337 -356 -5.60541 0.293
NP_443036.1_1 Reverse -341 -360 11.6017 0.244
NP_440999.1_9 Reverse -332 -346 0.0979218 0.193
NP_440888.1_2 Reverse -58 -72 5.70218 0.267
NP_442892.1_9 Forward -31 -17 13.077 0.296
NP_442277.1_7 Reverse -11 -27 -1.61656 0.278
NP_440575.1_8 Forward -46 -27 -6.98204 0.298
NP_442966.1_7 Forward -375 -358 14.3323 0.297
NP_440148.1_1 Reverse -325 -344 -4.22878 0.219
NP_443062.1_6 Reverse -328 -347 6.68596 0.18
NP_440673.1_2 Reverse -48 -67 8.63366 0.264
NP_440673.1_3 Forward -340 -333 10.9539 0.106
NP_440673.1_3 Reverse -141 -148 9.08556 0.202
NP_440673.1_3 Reverse -338 -345 7.51227 0.252
NP_440436.1_4 Reverse -188 -197 5.80084 0.182
NP_441884.1_9 Reverse -333 -352 -23.4033 0.284
NP_442907.1_9 Reverse -100 -119 -6.09707 0.289
NP_441004.1_1 Forward -351 -332 -16.4218 0.284
NP_439949.1_7 Forward -378 -364 12.3893 0.269
NP_442206.1_8 Forward -354 -338 16.4338 0.278
NP_440431.1_3 Reverse -216 -235 -4.13045 0.178
NP_441078.1_4 Reverse -58 -67 -0.68859 0.206
NP_441078.1_4 Forward -67 -58 -1.6719 0.266
NP_441732.1_2 Forward -71 -55 -16.5594 0.174
NP_442489.1_7 Reverse -58 -67 -1.6719 0.235
NP_442489.1_7 Reverse -336 -345 -1.77023 0.247
NP_441968.1_2 Forward -200 -181 11.7992 0.246
NP_440118.1_4 Forward -123 -104 5.11266 0.236
NP_442346.1_5 Forward -346 -336 10.5014 0.0934
NP_442346.1_5 Reverse -332 -342 8.53483 0.133
NP_440459.1_2 Forward -76 -59 8.7903 0.249
NP_441653.1_2 Forward -249 -230 16.5752 0.0555
NP_442875.1_7 Forward -27 -8 14.4533 0.226
NP_441888.1_9 Forward -67 -48 15.6292 0.26
NP_441895.1_9 Forward -151 -132 -8.45701 0.219
NP_442140.1_3 Reverse -334 -344 4.99491 0.232
NP_441239.1_9 Forward -75 -63 10.6587 0.0742
NP_442193.1_3 Reverse -53 -72 16.4644 0.239
NP_440573.1_3 Reverse -6 -19 20.688 0.0368
NP_441541.1_1 Forward -29 -11 -2.95826 0.264
NP_443033.1_7 Reverse -47 -66 12.9791 0.281
NP_440675.1_1 Reverse -55 -74 3.24438 0.252
NP_440653.1_10 Reverse -218 -237 1.96607 0.29
NP_440696.1_3 Reverse -48 -66 -1.84914 0.266
NP_442696.1_6 Forward -61 -42 -12.0953 0.249
NP_440160.1_2 Forward -239 -220 -7.96535 0.286
NP_440505.1_3 Forward -206 -196 5.48657 0.227
NP_442844.1_2 Forward -184 -169 13.7123 0.249
NP_440914.1_7 Reverse -7 -26 7.11373 0.283
NP_441699.1_7 Forward -230 -211 11.405 0.255
NP_441011.1_8 Reverse -127 -136 5.3096 0.271
NP_442232.1_3 Forward -165 -146 -8.26035 0.219
NP_440115.1_6 Forward -348 -338 13.353 0.0766
NP_440115.1_6 Forward -160 -150 6.17489 0.197
NP_440670.1_8 Reverse -336 -345 3.44131 0.267
NP_442072.1_9 Forward -346 -328 -23.0886 0.277
NP_441753.1_10 Forward -354 -335 1.47442 0.264
NP_440907.2_4 Forward -192 -173 8.94367 0.299
NP_441962.1_4 Forward -350 -331 -1.47551 0.123
NP_441962.1_4 Forward -162 -143 -5.31042 0.167
NP_440293.1_3 Forward -354 -335 -4.42544 0.263
NP_439910.1_2 Reverse -325 -342 -14.9075 0.183
NP_442509.1_9 Reverse -336 -346 7.35439 0.225
NP_441496.1_1 Forward -27 -13 15.0039 0.265
NP_441885.1_5 Reverse -58 -68 0.373358 0.164
NP_442341.1_7 Forward -346 -332 3.8345 0.21
NP_441173.1_10 Reverse -12 -31 25.6629 0.00938
NP_440560.1_7 Reverse -164 -183 5.11187 0.292
NP_440091.1_1 Forward -346 -334 0.333971 0.254
NP_441105.1_3 Reverse -53 -72 -3.04881 0.172
NP_441105.1_3 Forward -72 -53 -8.85033 0.279
NP_440261.1_5 Reverse -337 -350 -12.4687 0.297
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

CGAAGAGTCGTTAGACTGTCCTTTTGTTGATTTAGGATTGATAAATCCAGCCGGGGGCAATCATCGCTATTTATTTCGTCTTGGTTATAAGCCCACTTTAGTCCCTGCGGTGATTTTATATTCAGTTTTGCACTATGCTCAGCGAGTTAATGAGACAGCACGGACAATTCCTTTAGCAAGGCTTCTCTATGATGAAGGCAGTCCGGGAATGGTTTTTAAGTTAACAGAAAGTAGTTTATGCGGAGCAATAGAAGCAATCAGTCGAACCCATAACCAATTAGGGTTAGAAGATGCGGCTGGTAAATTACAATTCTGGTTTGATTCAGATCCAATGGCACTAGCCAACCAAGTCCTAGAAACCTATTACGCTGACATTTAGTATTTATCAAAAAAAGTAATC

CDS

GTGACTACACTCAGCCAATATTTTCAGATACATCGACGCTACTATCGTTCAGTCAATTTGGAGCGGGATTTAGGTAAGGCTAGCACAGTTGAGGGCTATGTACTTACGGAGCGCTCTACGGCGACTTTAGAACGGATTTTGCCTGCATTTTCTAAACCCCATACCCATCGTGCTTGGACATTAACAGGGGTTTATGGAACGGGAAAATCTGCATTTATTCATTTTTTGGCGAGTCTTTGTACACCTCAGAATACGGAGGTTCACAGAGTTGCCGTTACGATTGCAGAACGATTTTTGGAGCCAACAAGCCCAATTCTAGAGGCGATCTCCGCTTTGCCTGCTGAGGGATTGATGGTGGCTTTTGCAACTGGTCAACAGGAGCCATTAACCTGGACATTGGCCCGTGCGTTATCCCAAGGGGCAGAGACTTTTTTTCCAAAAAATCAGCGAGCAGATAAGCTTTTGCGCCAACTCACGGATTGGAAAGTTGAAGCGGAGACAGGGGATTGTCAGGTTACGCCAAAGGCAATTTTGCGGGCGATTAAAGAGTTGGTGGTGATAGCCAATAGGCCACTCCTCATAATTGTGGATGAATTAGGCAAGAATTTAGAATATGCTGCCCAAAATCAAGGGATTACGGATTTATATTTACTCCAACAATTAGCGGAGTTGTCCCTTTCTGGGGAGAATCAAGTTTATTTTATTGGACTGCTCCATCAATCTTTTGGGGGCTATGGCGATCGCCTATCAGTAACAGAGCAGAATGAGTGGAATAAAATTCAAGGACGATTTGAAGATATTCCTTTTACAGAATCGCCAAATCAGATGACACGGTTAATTGCTCAGGTAATTGATCGAGAAAATGCCAAACCAATCTTAGAAGAAGTACAGAAAACAAGTAATCAATGGCATCAAACCTTATCTAGCTTAATTAGTGATCTGGAAACTACCCCAGAGTTATTGACACATATTTATCCATTGCATCCGCTGACAGCTTTTGCTTTGCCACTTTTATGTACTCGTTATGCTCAAAATGATCGATCATTGTTTACGTTTTTAACAAGTGATGAACCCCATTCTTTTAAACATTTTTTAGAAACAACAGTTATTGACTTAAGCTTACCAACTCTCAAGCTTTATCATTTATATGACTACTTTGTAGAAACTGTTACAGGGTTAGCATCCCGGTTAAATTTACAACGGTGGGTAGAAATTCAGAGCTTAATTGAAGATGCCCGTGATCAATCTCCCCAAACACTCCAAGTTTTAAAAACGGTTGGGATTTTAAATTTGGTGACAACGACAGGAAACCTAAAAGCGACTTCAGCATTGGTTACTTGGGCATTATGTGATCAGGCGGACGGTGAGCAATCCAATTATTGGCAGGCTGAAATTGAACGGTTAATGCAAAAGGGCTTGATTACCCATCGTCGCCAGTTGGATGAGTTACGTATTTGGCAAGGATCTGATTTTAATGTGGAGTTGGCGATCGCCGAACAAGTAGAAAAGAATCGTAGTCATCTAGCAAATTTGCTACAAGAGGTAGCTCCATTAAAACCTTTAGTTGCCCAGAGACATTACAACCAAACAGGAAATTTACGTTATTTTGAACAACGTTATGGTGACGGAACTGAGAAATGGGAAAACTTAACCTGTTCCGATCTAAGTTTTGAAAAATTTATTTCTGCATAA

Protein

No sequence available