Your browser is old and dusty. Try Google Chrome!

Details for slr5012

ORF slr5012
Accession NP_942168.1
Symbol
Category
Definition
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_442100.1_7 Reverse -57 -75 24.6389 0.0218
NP_442272.1_2 Forward -103 -84 9.40553 0.29
NP_440561.1_9 Reverse -216 -229 18.9972 0.177
NP_441818.1_9 Reverse -310 -329 -10.817 0.299
NP_441098.1_3 Forward -70 -51 -5.44911 0.28
NP_442744.1_9 Reverse -143 -157 12.3505 0.288
NP_439997.1_4 Reverse -126 -145 9.43923 0.204
NP_440769.1_8 Forward -239 -220 8.75091 0.225
NP_440769.1_8 Reverse -54 -73 8.75091 0.225
NP_441434.1_1 Forward -179 -165 7.74647 0.267
NP_441327.1_1 Reverse -77 -96 3.82894 0.276
NP_441387.1_5 Reverse -140 -159 17.4284 0.261
NP_441533.1_8 Reverse -377 -391 20.0584 0.268
NP_442145.1_4 Reverse -145 -164 4.34446 0.282
NP_441077.1_6 Reverse -75 -91 2.60905 0.276
NP_442690.1_1 Reverse -41 -60 -1.08219 0.128
NP_442690.1_1 Forward -98 -79 -9.44032 0.197
NP_441654.1_5 Reverse -270 -289 14.7995 0.252
NP_441654.1_6 Forward -22 -4 15.0897 0.229
NP_441654.1_6 Reverse -11 -29 14.0393 0.296
NP_442996.1_7 Reverse -59 -78 12.9937 0.278
NP_441568.1_6 Forward -43 -25 10.8881 0.295
NP_441547.1_2 Reverse -321 -339 16.3421 0.0911
NP_441554.1_1 Reverse -164 -182 19.0031 0.25
NP_441514.1_1 Forward -182 -172 14.4405 0.274
NP_441079.1_7 Reverse -162 -181 2.06362 0.177
NP_441079.1_7 Forward -31 -12 -2.8529 0.223
NP_441079.1_7 Reverse -122 -141 -4.1312 0.241
NP_441079.1_7 Reverse -10 -29 -5.50783 0.266
NP_441079.1_7 Reverse -9 -28 -6.3928 0.276
NP_440780.1_1 Forward -232 -213 6.92274 0.289
NP_442933.1_1 Forward -75 -56 12.1748 0.242
NP_442933.1_2 Reverse -62 -80 8.1188 0.257
NP_442933.1_6 Forward -90 -71 18.3818 0.12
NP_442970.1_3 Forward -81 -63 12.4897 0.235
NP_442970.1_3 Forward -83 -65 11.2662 0.299
NP_440125.1_1 Reverse -78 -97 15.8307 0.0538
NP_441637.1_9 Reverse -14 -32 -1.55415 0.292
NP_441637.1_9 Reverse -213 -231 -4.01242 0.296
NP_441764.1_4 Forward -65 -48 13.8013 0.154
NP_441764.1_4 Reverse -68 -85 12.6554 0.181
NP_440385.1_6 Forward -98 -79 18.7637 0.107
NP_440385.1_8 Reverse -74 -93 9.11906 0.272
NP_440084.1_8 Forward -27 -13 8.60589 0.299
NP_441458.1_8 Reverse -99 -118 8.05871 0.229
NP_441458.1_8 Forward -92 -73 5.75208 0.259
NP_441458.1_8 Reverse -76 -95 3.34933 0.273
NP_442347.1_2 Forward -272 -263 4.22796 0.284
NP_442594.1_8 Reverse -314 -333 4.52268 0.26
NP_441633.1_3 Forward -309 -296 -4.89726 0.216
NP_441728.2_4 Forward -107 -88 11.7928 0.287
NP_442998.1_5 Reverse -265 -275 9.91146 0.232
NP_442504.1_4 Forward -161 -142 0.85048 0.277
NP_440709.1_1 Reverse -79 -98 2.85027 0.219
NP_440709.1_1 Reverse -44 -63 0.490334 0.259
NP_440709.1_1 Reverse -54 -73 -0.492971 0.295
NP_441866.1_4 Reverse -25 -38 11.9805 0.299
NP_441199.1_10 Reverse -141 -159 15.9491 0.232
NP_442327.1_3 Forward -85 -66 6.63627 0.26
NP_440372.1_3 Reverse -57 -71 15.8633 0.165
NP_441138.1_5 Reverse -215 -228 3.49948 0.297
NP_442339.1_9 Reverse -72 -91 19.764 0.101
NP_440699.1_1 Forward -176 -157 9.02356 0.232
NP_442085.1_1 Reverse -59 -78 9.31004 0.286
NP_441877.1_9 Forward -75 -58 4.95539 0.284
NP_441018.1_7 Reverse -26 -45 8.65258 0.241
NP_442917.1_1 Forward -90 -71 8.16011 0.254
NP_442280.1_10 Reverse -311 -329 9.15564 0.236
NP_441896.1_1 Forward -175 -156 7.37347 0.266
NP_442129.1_7 Forward -310 -291 18.0934 0.272
NP_441268.1_1 Reverse -125 -144 11.8883 0.27
NP_442277.1_7 Reverse -159 -175 -1.71205 0.284
NP_441178.1_10 Forward -151 -132 17.5015 0.251
NP_442966.1_7 Reverse -22 -39 14.6194 0.29
NP_442710.1_7 Reverse -63 -82 5.36764 0.133
NP_442710.1_7 Reverse -65 -84 -4.14723 0.269
NP_442710.1_7 Forward -180 -161 -4.72389 0.272
NP_442710.1_7 Forward -31 -12 -4.82 0.272
NP_442710.1_7 Reverse -9 -28 -6.26165 0.294
NP_442710.1_7 Forward -324 -305 -6.45386 0.294
NP_442710.1_7 Forward -28 -9 -7.89551 0.299
NP_440314.1_9 Reverse -280 -299 -4.52377 0.209
NP_440577.1_6 Reverse -172 -191 16.0274 0.222
NP_442577.1_9 Reverse -381 -395 13.077 0.228
NP_440728.1_1 Forward -151 -132 12.1917 0.234
NP_442709.1_4 Forward -82 -63 6.72632 0.183
NP_442689.1_8 Reverse -45 -62 5.34871 0.155
NP_441349.1_10 Reverse -322 -341 -7.4737 0.251
NP_440431.1_3 Forward -193 -174 -11.2103 0.284
NP_440431.1_4 Reverse -63 -82 -9.40638 0.284
NP_440431.1_4 Forward -38 -19 -9.97933 0.295
NP_440040.1_8 Reverse -60 -79 11.2199 0.203
NP_442443.1_4 Forward -36 -26 13.7459 0.229
NP_441432.1_9 Forward -76 -63 8.30749 0.29
NP_441432.1_9 Reverse -167 -180 7.91967 0.298
NP_441333.1_1 Forward -73 -63 12.1619 0.241
NP_441945.1_6 Forward -76 -57 10.4225 0.249
NP_440386.1_6 Forward -275 -256 9.14342 0.146
NP_440352.1_5 Forward -64 -45 9.93029 0.289
NP_442551.1_3 Forward -103 -84 17.5223 0.229
NP_442828.1_2 Reverse -72 -91 18.3818 0.196
NP_443040.1_1 Forward -162 -148 10.6671 0.291
NP_441329.1_6 Reverse -62 -81 4.91741 0.198
NP_441329.1_6 Reverse -60 -79 3.67602 0.212
NP_441329.1_6 Forward -63 -44 0.142815 0.264
NP_441329.1_6 Forward -39 -20 -0.0481691 0.266
NP_442028.1_1 Forward -20 -7 10.5659 0.251
NP_441508.1_1 Forward -62 -43 11.3264 0.247
NP_441541.1_1 Reverse -86 -104 -0.28449 0.237
NP_441541.1_1 Reverse -49 -67 -4.29515 0.273
NP_441541.1_1 Forward -64 -46 -4.48614 0.277
NP_441541.1_1 Forward -65 -47 -5.05909 0.291
NP_440212.1_9 Forward -29 -10 11.3255 0.14
NP_440212.1_9 Forward -28 -9 7.19276 0.165
NP_440212.1_9 Reverse -161 -180 3.54061 0.214
NP_440212.1_9 Reverse -5 -24 3.54061 0.214
NP_440212.1_9 Reverse -7 -26 2.29119 0.252
NP_441497.1_2 Reverse -307 -326 5.211 0.239
NP_441848.1_4 Reverse -55 -71 11.6568 0.216
NP_441848.1_4 Forward -60 -44 11.3703 0.224
NP_441848.1_4 Forward -189 -173 8.12362 0.288
NP_439942.1_2 Forward -193 -174 15.3173 0.228
NP_440825.1_7 Reverse -124 -134 11.0554 0.278
NP_440805.1_8 Forward -306 -287 15.0441 0.221
NP_440505.1_3 Reverse -330 -340 4.50326 0.284
NP_441959.1_8 Forward -94 -81 8.61288 0.286
NP_442532.1_1 Reverse -161 -175 11.0854 0.23
NP_442532.1_2 Reverse -62 -81 1.76618 0.226
NP_440914.1_7 Forward -175 -156 6.44528 0.283
NP_441699.1_7 Reverse -57 -76 2.06362 0.266
NP_442597.1_6 Forward -72 -53 15.135 0.292
NP_441697.1_5 Forward -180 -161 3.867 0.177
NP_441697.1_5 Reverse -162 -181 -1.86252 0.206
NP_441697.1_5 Forward -28 -9 -8.83343 0.268
NP_441697.1_5 Forward -99 -80 -8.92892 0.268
NP_441697.1_5 Reverse -305 -324 -9.40638 0.268
NP_441697.1_5 Reverse -122 -141 -10.6478 0.28
NP_442202.1_6 Reverse -279 -298 8.45592 0.24
NP_441527.1_4 Forward -192 -173 -4.4408 0.186
NP_441527.1_4 Reverse -62 -81 -8.45146 0.244
NP_440608.1_1 Forward -331 -312 8.44375 0.223
NP_441930.1_3 Reverse -63 -82 5.17542 0.266
NP_441930.1_3 Reverse -286 -305 4.0221 0.276
NP_439899.1_1 Forward -76 -58 9.1515 0.179
NP_439899.1_1 Forward -66 -48 6.52341 0.205
NP_441463.1_6 Forward -232 -218 6.22266 0.279
NP_441431.1_1 Forward -96 -78 4.5856 0.256
NP_442020.1_1 Reverse -280 -299 -1.08295 0.291
NP_441421.1_6 Reverse -59 -76 13.3255 0.221
NP_442743.1_8 Reverse -83 -102 10.6537 0.252
NP_441489.1_3 Reverse -57 -71 7.17351 0.279
NP_442936.1_10 Forward -22 -8 9.07246 0.269
NP_440191.1_6 Forward -172 -158 13.3805 0.294
NP_440552.1_8 Reverse -48 -65 10.8427 0.262
NP_441842.1_10 Reverse -325 -339 10.816 0.151
NP_443046.1_9 Forward -331 -313 7.88485 0.168
NP_441397.1_8 Reverse -335 -348 12.6667 0.256
NP_442638.1_3 Forward -129 -110 16.4719 0.235
NP_441635.1_1 Forward -28 -9 4.63094 0.272
NP_441635.1_2 Reverse -61 -80 9.40553 0.29
NP_442127.1_9 Forward -103 -84 9.40553 0.292
NP_442116.1_6 Forward -149 -132 13.039 0.172
NP_442116.1_6 Reverse -78 -95 6.83207 0.271
NP_442116.1_6 Reverse -56 -73 5.59067 0.293
NP_442046.1_2 Reverse -85 -98 15.4346 0.229
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

TGGAGTTGCTTCTGGTAAATCTGGTGATTTACGCTTCCTCAAAGGAACTATGTTATATCTACTATCTCCATCCTAAAACAAAACCAGAACATTTTTAATCACCGGATATTTTGGAGATTATGAGTCGTTTTATCCCAGATTAACGTTACAGCCAAGATTTTATTATTGAAGTAAATCCTCATCAAATTCAGATTCACTAGATTCGTTGAACAGATACCAGAAAAATTATTATATTCATTTAAAAAAATCACAATCTTCGAAACAATTTTGCAATTAAGTAATTAATGAATTGAGATTATCAAAATAACTTAATCTTAAATATTTATTTGTATATTTTTATAAATTATAGTAAAACTACAAGTATAAATGCTAAAATAACAAAGTATTTTTTTATATCGTC

CDS

ATGAAAGTTCAGCTTGGTCTTGATATTCCAAAACATCAAAATCAATTAAAGCCTATTTTTGCAAGGCATGAGACATTTCATCCCCGTTTTGGTTGGCTCAAAAAAGGATTTGATCGAGCAAGGGATAATTCGCGCATTTTTTTAGCAGAAGATGCGCCAGTGTTGCTTGGAGTCGGAAAAAATATGGTGCGATCAATTCGTTACTGGTGCGAAGCATTCAAGCTTTTAGACAATGATCAGCCTACTCTTTTTGGTGAAACTTTATTAGGAAATCAAGGTTGGGATCCCTATCTAGAAGATCCTGCATCATTATGGTTATTACATTGGAAGTTACTAGAACCTCCTTGTTTAGCTTCTGCTTGGTGGTTTACTTTTAATCAATTTAATCGTTTGGAATTTACCGATCGAGATCTATTTGATGCCTTAGTAGATTACGGCGATCGCCTATCGGGAAATATTGCTGAATCCTCTCTCAAAAAGGATGTTAGTTGTTTGCTCAGGATGTATGCAAAACAGCCAAACATTAAAAAATTTGTTGCCAGCGAAGAGTCGTTAGACTGTCCTTTTGTTGATTTAGGATTGATAAATCCAGCCGGGGGCAATCATCGCTATTTATTTCGTCTTGGTTATAAGCCCACTTTAGTCCCTGCGGTGATTTTATATTCAGTTTTGCACTATGCTCAGCGAGTTAATGAGACAGCACGGACAATTCCTTTAGCAAGGCTTCTCTATGATGAAGGCAGTCCGGGAATGGTTTTTAAGTTAACAGAAAGTAGTTTATGCGGAGCAATAGAAGCAATCAGTCGAACCCATAACCAATTAGGGTTAGAAGATGCGGCTGGTAAATTACAATTCTGGTTTGATTCAGATCCAATGGCACTAGCCAACCAAGTCCTAGAAACCTATTACGCTGACATTTAG

Protein

No sequence available