Your browser is old and dusty. Try Google Chrome!

Details for slr5005

ORF slr5005
Accession NP_942161.1
Symbol
Category
Definition
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_442272.1_6 Forward -52 -38 19.1735 0.285
NP_441623.1_2 Reverse -355 -374 18.4848 0.111
NP_440996.1_2 Reverse -318 -327 13.9627 0.293
NP_442975.1_10 Forward -114 -100 2.8506 0.269
NP_442062.1_3 Reverse -317 -336 -2.36049 0.271
NP_441434.1_1 Forward -336 -322 19.9694 0.0521
NP_441434.1_1 Reverse -321 -335 11.1842 0.233
NP_440053.1_5 Reverse -16 -35 9.93088 0.231
NP_442111.1_3 Reverse -316 -329 17.2503 0.144
NP_440851.1_3 Forward -69 -50 1.47442 0.285
NP_442634.1_4 Reverse -248 -262 -3.93365 0.176
NP_441634.1_9 Reverse -10 -29 10.4217 0.252
NP_441080.1_7 Forward -336 -318 7.29487 0.238
NP_441097.1_2 Reverse -282 -299 3.38209 0.293
NP_442690.1_1 Reverse -104 -123 -12.9802 0.252
NP_442690.1_1 Forward -339 -320 -16.8151 0.291
NP_440993.1_4 Forward -29 -12 3.18543 0.294
NP_441099.1_10 Forward -189 -179 15.9091 0.254
NP_442598.1_2 Reverse -341 -350 13.8644 0.292
NP_441041.1_7 Reverse -198 -210 5.76558 0.241
NP_442396.1_5 Reverse -346 -359 6.4108 0.238
NP_441406.1_3 Reverse -324 -336 17.6402 0.235
NP_441514.1_4 Forward -379 -360 15.1241 0.226
NP_441079.1_7 Reverse -319 -338 -1.27961 0.201
NP_442500.1_8 Forward -348 -334 8.9251 0.285
NP_442671.1_2 Reverse -320 -339 -0.477563 0.297
NP_442476.1_1 Reverse -317 -336 11.1244 0.276
NP_440286.1_2 Forward -244 -231 15.7522 0.296
NP_441764.1_1 Reverse -100 -119 13.5691 0.117
NP_442868.1_6 Forward -30 -20 2.83163 0.205
NP_441251.1_7 Forward -236 -223 18.8988 0.264
NP_440785.1_1 Forward -346 -327 2.75272 0.2
NP_440785.1_1 Reverse -311 -330 -1.96717 0.265
NP_442808.1_1 Forward -30 -20 3.02785 0.25
NP_440385.1_6 Reverse -39 -58 13.7982 0.215
NP_442977.1_2 Forward -348 -330 20.6282 0.118
NP_441590.1_4 Forward -28 -9 6.58682 0.254
NP_441739.1_2 Forward -338 -322 2.81113 0.288
NP_440899.1_8 Reverse -333 -352 -5.50708 0.231
NP_440787.1_5 Reverse -320 -334 15.2409 0.215
NP_441340.1_9 Reverse -316 -326 8.06241 0.256
NP_441952.1_9 Reverse -197 -216 13.3078 0.282
NP_441248.1_10 Reverse -319 -329 14.9073 0.277
NP_440211.1_4 Reverse -207 -217 14.3364 0.29
NP_443051.1_5 Reverse -166 -185 8.06259 0.235
NP_439943.1_2 Reverse -362 -381 10.5209 0.259
NP_441293.1_3 Forward -270 -252 11.1745 0.295
NP_442790.1_4 Forward -255 -236 -15.6352 0.295
NP_442262.1_10 Reverse -202 -209 7.6106 0.274
NP_442917.1_1 Reverse -47 -66 7.17681 0.254
NP_442454.1_2 Reverse -381 -400 10.074 0.29
NP_441771.1_7 Forward -219 -200 9.63507 0.294
NP_442277.1_7 Forward -350 -334 -0.470657 0.224
NP_442286.1_7 Reverse -264 -283 13.0766 0.288
NP_440673.1_2 Forward -104 -85 9.02386 0.259
NP_441004.1_1 Reverse -159 -178 -15.0452 0.271
NP_441668.1_5 Forward -341 -322 6.78429 0.279
NP_441982.1_6 Forward -275 -266 14.1087 0.274
NP_442689.1_8 Forward -121 -104 -5.86102 0.279
NP_441124.1_5 Reverse -326 -336 11.9577 0.239
NP_441031.1_1 Reverse -176 -195 9.4257 0.212
NP_440040.1_5 Forward -231 -212 18.6683 0.221
NP_441539.1_1 Forward -50 -36 12.9786 0.284
NP_441432.1_9 Forward -333 -320 12.9614 0.189
NP_441945.1_6 Reverse -258 -277 12.1925 0.173
NP_442749.1_5 Reverse -320 -337 12.8512 0.159
NP_442749.1_5 Forward -337 -320 10.2482 0.192
NP_442875.1_8 Reverse -310 -329 12.5858 0.221
NP_441329.1_1 Reverse -125 -144 4.72643 0.281
NP_441329.1_6 Reverse -114 -133 8.6416 0.147
NP_441329.1_6 Forward -270 -251 5.87233 0.191
NP_441329.1_6 Forward -362 -343 1.00224 0.245
NP_441329.1_6 Forward -272 -253 0.90675 0.245
NP_440204.1_5 Forward -137 -118 12.7459 0.249
NP_442568.1_1 Forward -135 -116 3.34192 0.267
NP_440573.1_3 Reverse -373 -386 17.2503 0.143
NP_440354.1_5 Reverse -292 -311 3.93269 0.235
NP_440546.1_6 Reverse -143 -162 7.27595 0.277
NP_440675.1_10 Reverse -6 -25 15.1424 0.228
NP_442465.1_2 Reverse -251 -270 2.55527 0.243
NP_441848.1_4 Reverse -311 -327 7.07321 0.297
NP_441848.1_7 Forward -186 -167 -4.52452 0.294
NP_439948.1_2 Forward -348 -330 14.8987 0.259
NP_441084.1_6 Forward -349 -335 10.6046 0.234
NP_441843.2_9 Forward -26 -8 13.7017 0.205
NP_442696.1_4 Forward -337 -323 19.3965 0.281
NP_442532.1_1 Reverse -322 -336 9.23901 0.284
NP_442532.1_3 Forward -332 -313 18.0371 0.16
NP_442532.1_4 Reverse -320 -338 16.4972 0.124
NP_441408.2_7 Reverse -119 -138 6.19431 0.172
NP_440724.1_5 Reverse -117 -135 17.5221 0.262
NP_442322.1_4 Forward -32 -15 -0.256846 0.213
NP_440854.1_7 Forward -66 -52 14.8115 0.246
NP_441697.1_5 Forward -338 -319 -10.9342 0.287
NP_441527.1_4 Forward -349 -330 -10.5523 0.272
NP_441527.1_4 Forward -272 -253 -11.0297 0.278
NP_441527.1_4 Forward -269 -250 -11.5072 0.282
NP_441527.1_4 Forward -270 -251 -12.1756 0.285
NP_441527.1_8 Forward -360 -341 3.93269 0.279
NP_441106.1_3 Forward -119 -100 9.93088 0.29
NP_440646.1_1 Reverse -154 -173 -1.37718 0.296
NP_440664.1_9 Reverse -202 -221 9.3409 0.259
NP_442615.1_1 Reverse -18 -36 -3.12744 0.156
NP_441836.1_2 Forward -106 -87 -5.50708 0.283
NP_440358.1_8 Reverse -146 -165 0.687771 0.263
NP_442743.1_8 Reverse -378 -397 14.7864 0.132
NP_442930.1_1 Forward -380 -370 11.1893 0.26
NP_442930.1_1 Forward -338 -328 9.12434 0.295
NP_440798.1_1 Forward -72 -54 11.798 0.294
NP_440054.1_9 Reverse -230 -249 13.2733 0.205
NP_441885.1_3 Reverse -336 -355 19.6867 0.0522
NP_442703.1_9 Reverse -102 -120 3.75572 0.276
NP_442703.1_9 Forward -158 -140 3.3624 0.292
NP_442932.1_9 Reverse -171 -190 3.83436 0.289
NP_442638.1_3 Reverse -196 -215 12.3658 0.298
NP_441207.1_7 Forward -270 -256 16.9036 0.179
NP_441207.1_7 Reverse -319 -333 10.4172 0.263
NP_441730.1_3 Forward -336 -318 12.9098 0.234
NP_441045.1_4 Reverse -181 -200 15.8307 0.268
NP_440244.1_8 Reverse -339 -358 1.37609 0.298
NP_442154.1_3 Reverse -209 -228 19.6232 0.125
NP_440988.1_5 Forward -213 -194 14.0305 0.235
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

GAGTAAAAAATACTTTGATCAAATAATTATCTTGGGCTTCTATGAATTGACAAAACAAAGAGTAAAATTTACCTAATTTTTCATTGATGTGCTGAATCAAATCAACTCTCTATCCTAGGATTGTATCGTCGAAAAATACAAAGAAATAGACTGCTGCGACAGTATTATTGGATACATTGAATTTGATTTTCTCAATCTCTCCTTATTCAGTTTCTCAAAATTACTCCTCCTTTTTGCAAGCTAAAGTTTCAGCATTGATAATTCAGCTTTACCTATTACTTTTATGCTACAATTATTTCCAACGAGTGCTACAGTTAGCTTTAGTATAAGACAGTTAACCACATTTTTTAAATTCAGTTATTCTATCTAACGCTCAACCCCTAACTGAGCAAGGTTTTCC

CDS

ATGGCCAATCCTTATGCCTCCTATGCCGCCCCTGTTGTCGATGCGGCAGGTACTAAACACCTCGTTTGGGAAGACAATGGCCGTCTTTACCATGCTCACTATGATAGCCGTGCTGGGGCCTGGGTAGATAAAAATACAGTCAGTAATGCCCAAGGCGGCTCTGACATTAAGCTCCTGGCCGGTAATATTATCCCCGTTGACCAAAGTGGAAAGCTATACGCTCCAGGCCTGGTAGCTGCCTGGATTCAGGGCATAGGCAACGCCGCCGAAATTTACGTCTCCGTGGGTCGCTACACAGACGATGGCAGGCTGGAATGGTCCGATGCAGTGCAAGTTAGCAAAGATGCGGTAGCTAATACCAGTTTTGATTTGGGCATTGGGCAAGATGGTCTAATACAAGTCGTTACTCAAAAAGTTTTAAAGATAGCGGATCCCCGCAAGTCCGACTATCAAAACAACCCAGGGCAGTTGGCGGAGGACATAAAAAGCCCGCAACAGGGAGATAAGGATCTTTACTACTCAACTTTGCTAATAGAGCTAGAGCGAAAAACTGGAAGCCTATTCCTTGTTCCTAACCCTGAAGTAAATGCTTCCGGCACCACCGACATTCCCGATGATGCAGATGCCCTTAATTTCAATCCCGATTTCTACGTAGCCAAAACTAATCGGACAGGTAGTTTGAGCCAAATACTGCTCAATGCACCTCCCTCAAATTCCCCAAGTCTTCAACAGTCGGGTTTCCAAAGTGCTGGCTTGTTGTCCGCTTCTTCCCCAACCCCTGGCAATGGTTTTTTGTCCAATACTGATTCAGATTCCCAGAATGATATTTCTTTGCCTGCCACAGGCGGACCAGCTTGGGGATTTGATATCACCATTGGTACAACTCAACATACTACTGAAGGTACAACATTCCCTCTTCCTGTACTAGAAGAAGCCAATAAATTTGCCAGTTTGTTTGGGGTTGAGCTAGGTATAAACTTGTCTGGTGCTATTAAAACAAAGGTGTCGAGGGACTCAGATGACGTTTATTCCGTTGACGCTGATCTAGCTTTAAGTGTTGACCTTGTTAAGGAGCAAACACGCTGGAAAGCGTTTGGGCGTAACCAAAAGCTAGATCCAAGAATAGATGATCCGGTCAACGGCGGACTTATGCCGGATCCAAATAACCCCGCCTACAACGCCTCAATAGATACCAATCAAGGATTTAGTGGAATTCAATTTTCCCTTAACTTTAGTGGCTCCCAATCTTCCAATGCAAACGGGGAATTGCAATCCCTCGAAAATTTTTATGGTTTGAAAGTCGCTTTTCCCAAAAGAGTTACCTTCAATATCCCGTCAATACCTGGTTTGGAGGGAGCCTTAGCCCGACTCCAGGCGTTAATACAGTTCTCCCTTGCCATTGGCTATCAGGGAATTGGTAGCGATCCAGGCCCCAATGCCGAAGCCCCATTCACATTAAAACCCGATACGAAGCCAAATCTTTATGATGGACTGTCTGGAGCTGGTGGAGGAGGGGCTGGGTTCTTTCAGGCAATAACTTGGTTAACAGCTTACAACAACTATAAAAAGGGAACTCCAGGGCTAGGCGCTGGAGGCAAAATCTTTGCTGGAGTAAATACAGCTTTTTCTTTATTGGCCGCCAGTGACATCCTTGCCGCTAGTGGTCCCTTAATTTTTCCGGGTGAATTTGATGACTTTAATACAACCCAGAGAGGTTTATTAATAGAAATTTTAGCTACTGGTGGTCTTTCTGGAAGTATTTTGGCTGGTTTGTTAGGAGCAGAAGGAACTATCAGTACAGGCTTTGATTTTGAGTTTTTGAGTGGCCCCCAGCCCTTCATTTTCAAAATACCCTACGAATTATCCATTGAAGCCAGAGCCGCCGTTTTAACATTCAGTTGGGACATAAGTGGCGACATTGTAGATACGACGGATTCATCTGCTCAAACCACAAGCATTGGTCTATTGTCAGACGATGCTAGTCATAACGACCAAAACTCTGAAATGGTCAGACTGAAACTGGCCTATAGTCCCTATCAAGGAAGCACTGCTATCCATGAGAACGGACGTTTTAGCACCGTTAGCCCCACTACCCGCATTGCCCAACCTCAGTTATTGACAGCTTTTCCATCAACAGCCTCGCAGAATAATTATGTTATTGGATCTGTTTCAGTTGAGGAAGGGGGTAGTGGCTATCTTGGGGGAGAAAGTGGCAACTTCTTGGTTGTTCCCAGCATCGGCAATGCCTTATTGATGGCCTATGTAGAAAAGGGGGTGATCCAACAAATTGTGGTGGAAAGCCCTGGCATTGGCTACGACAGAAACAACCCACCTACACTAGATTTCAGTCAGTATGGAGGAGGGGGAAGTGGAGCTAAGGCAAAAGTTAATTTAATAGATCGGGAAGTTCTTGATCTAACTAACGATGGTCGCCCCTTTGTAGATTCTGTAGTCTTTTTTGCGGGTCCTAGTGCCCAAGCGGAGACTGCGCTGATTTGGATTGCCGACGGAGCGGACAGCACCAAACCCATTAGTGACAGTGCCAATCAATTGACCACCAGGGTTCAAGTTAGTGAACTGGCTGGCACCAACTGGTCGATCCCCACCGCCCTTCCTCTCCAAGGCTCCGAGGGCATGAACTATGACCCAGTTATTGCCAAATTTATTAGCCGAGATAATCGATCTAGCTTGTTGGCTGTTTGGGCTCATGCTCGGGCAGACGGAATTGGTAGCCACAGTGTCGATGATTTGACCAATACCCTAGACAGCATTCTGGAAACAGACATCTACTACTCCGTCCGAATTGGCAATGGCACCTGGTCAAATCCAGAAAAGTTGATCACCTTGGAGGGAACTGATAATCGTCTTGACATAGGTCGCCTCAATGATGGGCGATTGCATTTGGCTTGGGTTAATGCTGAGGCCAATGCCACAGAAGGCGGCATCCAGAGGATTTATAGCGCATTCTTTGATCCGACTGAAGAAACGTGGAGTACTCCGGTTGCGATAGATCCGACAAAAGATATTGACACGCCAAATCGCTCTGAGATTTCTAGCCTCAAGGTAGGACAGTTAGAGGGCGAACCGGCAATGTACTGGAGCAATACCGCTGAAACTCCCTACGTTGTGAGTGTTCTCAATGATTCCCCTGAGCTTTACTTTCGACTGGAATCATCCGCCATCAACCAGTCCGAAATCAACTATGGAAATCTTGGTAACAGCATTGTCAGTAATCTGAGTTTCTACGATGGAAATATGACTTTTGGCCAGGAAGGAGCACTCAGCCAAGACCCAGATCCGGCGGTTCGATTCAATGGCCAAGGTGCTTTTGTCATTGGTATTCCAGATAAGCAAACCGTCACCCCAACAAGTTTTAGCGTAGAAACTTGGGTCAAACTTACAGACACCGCCGCCGGCAAAGGCATTGTCACCCGTGGTCAGCCTATTACCATTCCTGCAACTCTTCCCACGGCTACCCTCACCTACAAAGTTACCCAGGGGCAAGACACAGATGGTAAATGGTTTTACTTGATCACGCCAGATAGCGTTGATCTAGGTAATTCAGGACAAGATATATTTCCCAATACTTTACGGGTAACTAACTTTCGAGCTAATGAACAGCTTGACATTCCTTTTAATCCGATAGAAAGTTTTGCCCTTCGTGCTGAACCAGATGATTTTTTAGGATTAGACTTCATTGGAACTGATGATGTCTACATCATACGAAATACTCCCCAGGATGTTGTTATTGGTGATGGCACACTTATTGTCCGCCGTTTTGACCCTGGCACCGATAAAAATAGAGAAGAAAGAATCGAATTGAGCGCAGGTCAAAAAATTCAAATAGGTGGACAAATCTATACCATTACGGCTGGAGAAACCTTTACTGTTAGCCTGAAGGCTGGGGACAACATCTCTATTTTCGATGCTAATCCCCCCGGCACCATCTCTCAGTCCCTAGCTCCCAACTTTAACTTTACCCCCGATGAATCTGGGAGTTTGTCGGGGATACAGGTTAATAGTAACCAAATTCTCAGTTCAGGAACTGGCTTTTCCAACAGGCCTTTTGTCAATGAAGCAGAAAGCTTTACTCTCACCGCAGAACTTGAATTTGAGCAGATAGAAGATTGGTATTTAGTGACTGGGAACAATGGAAGTATTGTCTTTAACTCCGGAGCCGGGGAAATTAGTTCTGAATCTTTAGACCAAGGCCAATGGCACCATGTTGTTGCCACCCATAACAGCACCACAAAAGAATCTATTCTTTACATCAATGGACAAGAAGTTGCTAAAACCATCGGGGAAAGGTTTGCCCCCAGTGATAATCCGATTCTGGTGGGCTATAACCTTAACGGTTTTCTAGATGAAGTTGCTATTTATAACAAACCCCTCACCGTGGCCGATCCTAATGCGGTAGAGTTCGACAGCACAGGCAAATATGTTGTTGCTTTTAATCCCAATGCCCCTGCGGGGGAAATTACCAGTCACTTTAACGCGAGAGACGTTGATCCTGACAGTGCGGAAGAAGCCACTTACTACAGCGTTTGGAATGGCGAAAGATGGGGTACCCCGGAGCAGTTTGCCGCTGAATATAAATTAACCCCAACCCAAGCCAGTCTTAGCCGCACTCCCGCTGTTGATATGGTCGGATCCAATGGATTGCAACCTGATGGAGTATTGGATCAACATCTGCAAGTTACCCTGGCTTTGCCAAATGAGTTCCTTTTTGGACGCACCATCACTGGCATTGAAATCAAGGATGCACAAGGCAATACTTGGTCGATCAATAACAACATTGAAAGCCCATTAGGATCAAATTTAGTGGGGGCAATGTTGGCAGGTCAAAGGGTCAATGACCTGAAAAATGGGGCGTTTGAACATACTGTCATGGGGGTCAAAGAAGTATTAGATCTGTACTTTGATGATCCCAATGTTCAGTCAGATAAGACCTACAGTGTTACCTTTACCATGAAAGATGGTGGAACTATCCCCCCCTTGGATAATCTCGCCCCCTCCCCCAACATTCAAGGCAGTAGCAGTAAAAGTTCCATCGTCAAAGCAGAAATTTTGGAAAAAGAAGTTACTTCCCTGGCTGAAGTAGATAGTGGTGTAATTATTGACATAGATACCGTTGGAGCTGGGCAATCCCTCGCCGCCGGCAAAATTCGCAATGGGGAGATTGGTTTTGCCATTGGTCATCCCTATCAAATCGATGAAGATTTGAATAAAAGAGGTTTAGTTTGGGTGTTGCCCGCCGGGACTAATAAAAAGCTGAATGAGCTAACAGGAATCCCGCTAAAAAATGATGATGTTCCAGCAGAAGGCGCTTTAATTATAGGCAAAAATGGAGACAAAATTGGCTACGCCATGGCGGTGGGAGATATTGACGGGGATGGCATTGATGATTTAATTATCGGGGCACCGGATGCGGATGATAAAAAAGGAAAAATTTATGTCATCAGTGGTAAATATCTAGGTTCAGGACACACCATTAATTTAGCCTCTCTACCAGATAATGCCGTGGTGACAATCGAGGGGACAAGGCTTAGTAATGCCGGTTTTTCTCTGGCGGCCGGAGATGTGAACGGTAATCAATTTGATGATATTGTCATTGGCGCTCCCAATGCCCTAAATAGTGAAGGTAAAGCTGTTGGTGCCGTACATCTCATTTACGGAAGCGCCGATTTTTTCTCCGGCAATAAAACCATAGTTCTGGGAACTAATAACTTACTGTTTGAGGGAAAACGAGGCACAGCAAAAAGTAAGTTTGAGCTTTTCCCCAACCCGGCCAATCAATGGCATAGTCAAGTCGGTTATTCCGTTGCTATTGTCCGTCCTGGGGCTACTGGTAACCCCAACGCCCATAGCTTCAATGCAGATCTTGTTGCTGACATTTTAATTGGAGCACCGGGGTATCACCAGACTGTTCAGTTTGACAGGCAAGGTTTTCCCCAAGGAATTTCCGCCGAGCAGTTAGGCAGATATCGATCCGTGTTGAATCATGTTCCCAACTTTGGTACTGATTCAGTTGCCCCCGAAAGAGACCTTAATACAGGTAGGGCTTACCTGATCTTTGGTGGTGATAATTTGACCGTTAATGGTCCCCTCAATGATGAAAATTTGAGTGGCAAAGGGGTGATCTTCGATGGCTCACCCTTGGAAGATGGGGATATGCGCTTAGGGGAAGTTGTCACCAGTGCCGGGGACATGAACGGGGATGGTTATATTGACATTTCTATGGCCGCTCCAGAAGCCGCTGGGCGATCGGGTTTAGTGTTCATCTTCGGAGGTCGGGGCGGTAGTGATAGCATCCGGCTCAAAGATAAATATTCTGTAATGACAGAAAGTGATGTACTGATTGCAGGGGGAGATGTCTTTAACTATGCTGGTCAGTCCTTGGGCGGTGTGGGCGATGTAAACAACGACAAAATTGATGATCTTCTAGTGGGTGTTCCCCAAGCAGGTGGAGCAAAAGGCCAAAACTACGTCATCTTCGGCGTTGAGAATTTTGAAATTGGCAAAGGGAATTTCCCCACCACTATCAGCCTTAAACAAGGTATTCCCGATGATAGTTTTGTTTTTAACGGCGGTATAGCCCAAGGTTTAGCTGGTTACGCCGTAGCCAAAGGATTTGATCTCAACGGAGATACAGTGGGGGATATGCTCCTCAGCGCCCCTTTTGCCAATCAGGTTTATGTGGGTTTTGGTCATCCCTGGTTAAAAAAAGAAGGCAGTGTCCGCCTCGATAATTTAGCCAACGATAACGGTATTATCATCAACCGCTACGAAGGAAGTGAACCCAAATATTCCTTTGATGGCCGTCGTGTGACTAACTTGGGGGATATTAACGGTGACGGCTATGCAGACACTGGGGTGGCGGGGAATGGGGATAGTATCCTTATTCAGTTTGGCGGCCCCACGTGGGATTTAATCGATGCCGGTTTTGGAGTGGGTCAGTTATCCGTTTTCCTGAGAAAAGATGTAATAACAGATATTAATTTTGAAAGTATTGAGGGTGTTGGTGATATTAATAATGATGGTTTTGATGACTTTATTATCTATAATTCCCGCTCCAAAACCAAAGAAGTCCATGATTTCACTATCGTTTATGGTGGCGACTATCTAAATAGTCTGGGCAGCGCCACCATTGATGTAGTTGTTGCCCCAGGGGAGGAAATAAGACAGCGTGAACGGTTAGCAAATCCGGGATTTGTTTTAAGCAATTCAGCGACAGATCTAAAACTCTACCATTCCTCTCTCGGTTTAGGAGAGTCTATATATGCTCCAGGTGTCGGCTTCAATGGAAAACAGTCTCGATTAACTTTAGAAGAGAATGGTGAACTAATTTTTTATCTTCATGGTACACCTCAAAAGATAGGTGGCCAAGCCAATGCTGGCATCGTTAAGATGGAAATTGGTGTTTTGGATGGAAAAGATCGTCTTCTGTTTAAAGATAAATCAGATAAGATTGTTACTTATTCTGAAGAACATTATAACCAAACCGAAGAACAAATAACTTATTTGAGGGTAGGGGATGATTTTGTAATGTTATCGAACAGATTTAACTATGCAGTTCCTGGTCGAAACGACATCAAAATATTCGGATATGATTTTGATCAATCTGTTAATGTTGTTCAACAACATTATCCTAGTAGTGTATGGGGATCTGTTTTGCCATCCTTACTAGCTGGGGAATCCATAACAGCTCCGGATGGCCAAAGAAGTTTTATGGTCATGCCTCTCAATTACAACTTGAAAGCAGAAGATGGACAAAGAGTTGTTGCTGGCATTGTAGACAAAGAATTTAATGTTATTTCATCCTTAATTAGCACAAGACGTGTGCCAATGATAACCAGCGACTTGGAATTCAGAAGCGCGCGCGATGCTTACCTTATTTTGGGGAATGATACCGTCGTCACACCAAGTAGCGGAGGTGATTTCACCCATACAAAAGGAAGTCTTTTGTTTGTTTATAACGGCTTTTATTATGATGGAAATGCGTTGCGTAACATATTGGGTGGAGCTTCGAGGACAGGTCGTGATTATGAAATTGAATGGACATCAGAAACTCAAGGTCAGGATCTATTATTCCACTTGGATAGCAATATAAAAAATATTAACCTTGCTCAAAAAGGAACTGCTTTTGACGGTTCTCAAGGAACTTTACAATATAAAAATTTCCACGGTTCTAAATTAGAAGAAAAATTATTTGAATTTCTTCCAGTAGGGGATCTAAATGGTGATGGTTATGGTGATATTGTTGCCTTCGATTCAGAATTTACATACATCTATCTCGGCAATGCTTCTGGGAAAATTTCCACCTTACCTTCTAGTAACTATTCTGGAGATGAGGGAATGGTGTTCAGTAGTCGTTGGGCTGTGGGTAGTGGTATTGGAGATATTAATGGAGATGGCTATGACGATCTTCTAAGTCAATCAAAGGATGGGATATTCATCGTGTTTGGTGGCCCCATATTATCTTCTGCTCAAAGGATCTCAATATCTAATTTTCTCACCATTGATAGTCAATTTAGTCAATCCCCTTCAACGTATGAGGCGGGCGACGTAAATGGTGATGGTTTTGCGGACTTCATCGTGCGGGATTCCCATGTGGTTGCTGGCAGTACCAGGGGAGCACTCCGGTTAGTTTACGGCAATGCTACGGGGAAAAATTTCCAATCCACCCAGATCCAGACCTATTTACCTGTTTATTACCCTTTACCAGTGACGAGGGCGGGAGATGTTAACGGAGACGGCTATGACGACATTATTTTTTCAGATCCCAGCTACCTCGATAACAATGCTGGGCGGGTTTACATTCTTTTTGGTGGTTCCCATCTAACAAATAAGGCGACTATCACCCCGGAAGAAATTAATTCCCTAGAAGGCAAAGATGGCTTTGTCATTGATGGCTTGGCCAGCTCAGATTCCTATTCCCGTGCTGGGGAATCCGTCAGTGGCGGTGGAGACATGAATGGAGATGGTTTCAAGGACTTCATCATTGGTGCCCCTGGGACTGATGGCACAGTGGGATTAACCTATGGACTGTTTGGAGGAGACTTCACTAAATCCGTCAATCAGGCAGGAACCCTAGCCAATGACATCCTAGAAGGAACTGGTACAGGGGATGTAATCATCGGACTAGCAGGGGATGATACCCTTATGGGCAATGGTGGCCGAGATGTACTCTATGGTGGGGCTGGGGACGATACCATCATCATTGCTGATACCTACTTCCAAAGGATAGATGGGGGCAGTGGCTTTAACAACCTCAAACTGGAAGGATACCGGGGACAGGATTGGGATTTAACGCCCCTTTCTCCAGGCTTGCGCCTACAAAATATCTCTGCCATTGACATGACGAACTATGGCAGTAACACCCTCACCCTCAATAAGACCACTGTCATGAAAATGACTGGCACCCAAAACAACTTAGTGATTTTAGGGGATGCCAACGATGAAATTATCCTTGATGCTGAATTCCGAAAAGTAGATTCCTTCAACCTATTTGGTACCCTATTCGACCGTTACCAAGCTGGCACTGCCAATGTTTTGGTTGCCCCCAACATTAAGACAGAAGTGAAGTTCACCGCAAATCGAATTAATCAAACCATTGGATTATCGAATGCCACTCCGGTTACAAATTCTCGACTACTTTCTGCCGCTTCTCCGAATAGGATCACCACAATTATCCCAGCAAGCAACGGCCAACCAACCCAATTCTTTGTGGTGGCAAACCCTACCAGGGAAGATGCCGGAGTCTTTACTTTCACCGTTAACCGCAGTGGGGATTTGAGTAAATCCGTTACCGCCCTTTATCAAACCGTCAATGATACGGCGATCGCCGGTCGGGACTATACCGCCATTTTGGGCACATTGGTGTTTGCACCGGGGGAAATCTCGAAAGTGATTGAAGTTCCTCTGTTGGACAATAACGAGTATGGAGGCAACAACCGCAGTTTTGGCTTAGCAATTCAAGCCATCGACGATATTTTTGGGGAAAGATACGGCTCTAATTTCCTGCAACTGAGCACAGATAATGGTAATCAAATTCGTAACCTCGACTCAGGTTCCCTTGCACCAGAGGTAGTAAAACAGTTAGGTGCGGCCCTTCCCTTTGGGGCCATGGGCTTCAGTGTTACGGCCCCCGAAGGTTCAGCGAGCGTTACCATGCCATTCCAAGGCATTACTGAACTAAATAGCTATTTCCGTTTTAACCAAATTAGTGGTCAGTACGAAGAATTCCTCTATAACGGAGAGAGTGGAGTGGAATTCCTTGACACCACCAACGATGGTCGTGCCGATACCCTGAAAATACATCTTCTCGATCAGGGCAGGGGGGACGGAGATGGTTTGGGCAACGGTGTGATCACAGGCTTAAATGTTCCTGCCATCGTCAACCCTGGCTTAGTACAGGTCAATCCTGGCGTATTCCTGGCCCCCACCAATGGGGACGGAGTCTTACAACTCCGACTGATTACCAACCAACAGGAAAGTAATCAAATCGGTTGGGTAATGGTGGATGATGCCAATGGCTCCATTGATGGTTTGTTGCCAGATGCCCCAGGTTATCTGGAGGCGGCCCTAGCAAGAAAGCAAGTGGTTTTTGAAAATGCCTATTCCGCTTCTGGGCAAGCGTTTGACCGTGCTTCCGCCCAGCAAAGTTTTACGGAACTGAATGCCTTGATTCAAACGGAATCACAATTTTTTGGTAGTCTACAAAGCCTGGAGTTAGGGGGCGGTGGGTACTATATTTTTTATAACGAAAGTTCAAGCCAGACTGTTTTCTCAGTTAACACTCCGGTGACTGTGGAAACAGAAAGTCGTGGATATCACCAGATTAGTTTTGATGGGCTGACCATGGAAATTGCTTCTAAGGCCCTGGTGGTCCCTGGCAATTTAGATGACTTGGTGGTGGGGCAAATCTCCATCGGCCGGGCTGGGGCTTACGAAAATCAGATTTTGCTCTATCAAGTGGATAGCTTAAGCGGGGGCATAGATACCGATGGCGATCGCCAAATTAATCTCCGGCCGGGGGATACAGGTTACGTGGAAGCGGCATTAAAACGGGCCCAAAATCCGGCAACAGGAGCGAGCTTCAATGCCCCGGAAGGTTTCTTTAGCACAGGGCAAGAAACAGTTAACCTGCGGGGAGGAAGTATGTATGGCATGGCGATCATTCCCAATGCCACCATTGGAGAAGTGCTGAGTTTGAATCCCAACAACAATCCTGAACTTGGCCCCGTGGCCCTGTTCTCCTTTGATGGGGCTAATCCTGCTGGCATCAGTCAAATGTCCCGCCTGGGTAGTAACCTGTTTGGTTTTGAAGACATGGTTGGCGGGGGAGATGCGGACTATAACGATGTAATTTTAGAATTTTCCCATCAGTTTTGA

Protein

No sequence available