Your browser is old and dusty. Try Google Chrome!

Details for slr1844

ORF slr1844
Accession NP_440772.1
Symbol uvrA
Category excinuclease ABC subunit A
Definition DNA replication, restriction, modification, recombination, and repair
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_442711.1_1 Reverse -250 -264 15.7325 0.104
NP_441061.1_2 Reverse -64 -78 4.71948 0.145
NP_440795.1_7 Forward -71 -64 14.6904 0.0123
NP_440795.1_7 Reverse -64 -71 14.6904 0.0123
NP_441418.1_6 Reverse -63 -82 -29.0082 0.215
NP_442291.1_5 Reverse -62 -78 12.8416 0.0314
NP_442291.1_5 Forward -73 -57 10.5799 0.0434
NP_442291.1_5 Reverse -171 -187 2.22182 0.13
NP_442291.1_5 Reverse -369 -385 -4.1697 0.266
NP_440897.1_6 Forward -72 -53 4.12856 0.14
NP_441453.1_4 Reverse -63 -71 16.539 0.00633
NP_441453.1_4 Forward -72 -64 16.539 0.00633
NP_441453.1_4 Forward -181 -173 4.14932 0.264
NP_441453.1_7 Reverse -255 -262 13.4121 0.23
NP_442151.1_6 Reverse -63 -77 15.6342 0.0221
NP_441818.1_1 Reverse -64 -75 18.8393 0.00301
NP_441818.1_1 Forward -71 -60 18.0527 0.00639
NP_440226.1_1 Forward -72 -53 17.5024 0.0184
NP_440226.1_1 Reverse -63 -82 3.34271 0.229
NP_440150.1_6 Forward -75 -56 8.55425 0.2
NP_442173.1_1 Forward -71 -63 15.4574 0.00633
NP_442173.1_1 Reverse -64 -72 15.4574 0.00633
NP_442752.1_4 Forward -72 -65 13.8055 0.0199
NP_442752.1_4 Reverse -63 -70 13.8055 0.0199
NP_443027.1_4 Forward -74 -64 14.0414 0.0452
NP_443027.1_4 Forward -141 -131 12.8614 0.0624
NP_443027.1_4 Reverse -61 -71 11.0914 0.107
NP_443027.1_4 Reverse -176 -186 7.25653 0.24
NP_441812.1_3 Reverse -62 -76 11.5043 0.21
NP_442975.1_10 Forward -76 -62 13.1753 0.0459
NP_440784.1_7 Forward -71 -64 15.9687 0.0123
NP_440784.1_7 Reverse -64 -71 15.9687 0.0123
NP_440061.1_9 Forward -74 -60 21.5334 0.00189
NP_440061.1_9 Forward -273 -259 10.8154 0.122
NP_440061.1_9 Forward -179 -165 7.47213 0.205
NP_442062.1_8 Forward -72 -62 17.3846 0.00193
NP_442062.1_8 Reverse -63 -73 17.3846 0.00193
NP_442062.1_8 Forward -181 -171 6.46988 0.125
NP_440304.1_4 Forward -74 -64 10.8948 0.051
NP_440304.1_4 Reverse -61 -71 1.84832 0.299
NP_442242.1_4 Forward -71 -64 14.3954 0.0124
NP_442242.1_4 Reverse -64 -71 14.3954 0.0124
NP_440044.1_8 Reverse -131 -150 0.294447 0.202
NP_440044.1_8 Forward -186 -167 -3.93378 0.295
NP_441594.1_6 Forward -158 -139 3.34271 0.231
NP_442110.1_7 Reverse -166 -180 7.27608 0.121
NP_442110.1_7 Reverse -63 -77 0.294584 0.264
NP_441083.1_3 Forward -399 -389 12.4676 0.253
NP_441083.1_5 Forward -72 -62 20.3345 0.00053
NP_441083.1_5 Reverse -63 -73 20.3345 0.00053
NP_441738.1_2 Forward -70 -63 15.28 0.0102
NP_441738.1_2 Reverse -65 -72 15.28 0.0102
NP_441558.1_5 Reverse -61 -80 11.9958 0.0736
NP_441558.1_5 Forward -74 -55 6.88262 0.2
NP_440209.1_1 Reverse -63 -71 18.1123 0.00295
NP_440209.1_1 Forward -72 -64 18.1123 0.00295
NP_442889.1_8 Forward -75 -61 4.12889 0.27
NP_442889.1_8 Reverse -60 -74 3.8339 0.273
NP_440447.1_1 Forward -144 -126 4.14905 0.242
NP_441713.1_1 Forward -78 -59 -14.0619 0.257
NP_441713.1_1 Reverse -57 -76 -15.7335 0.27
NP_442920.1_3 Reverse -110 -129 19.2412 0.183
NP_440178.1_7 Reverse -62 -81 -14.4552 0.153
NP_441716.1_1 Forward -72 -58 23.1074 0.00274
NP_441716.1_1 Reverse -63 -77 13.4709 0.0689
NP_441716.1_1 Reverse -370 -384 2.65453 0.298
NP_440644.1_3 Forward -322 -303 7.37428 0.17
NP_442111.1_4 Forward -73 -59 10.3243 0.0545
NP_440906.1_5 Forward -71 -64 15.8704 0.0124
NP_440906.1_5 Reverse -64 -71 15.8704 0.0124
NP_440747.1_10 Reverse -60 -72 16.8536 0.00143
NP_440747.1_10 Forward -75 -63 7.51213 0.00286
NP_441130.1_10 Forward -74 -60 17.3058 0.0167
NP_441130.1_10 Reverse -61 -75 5.70279 0.218
NP_442973.1_7 Reverse -167 -186 15.9291 0.209
NP_441486.1_1 Forward -75 -61 14.2576 0.00654
NP_441486.1_1 Reverse -60 -74 12.4876 0.0116
NP_441486.1_1 Forward -184 -170 1.86788 0.0969
NP_441486.1_1 Reverse -175 -189 -1.37704 0.171
NP_442634.1_4 Reverse -61 -75 -2.06536 0.149
NP_440470.1_5 Reverse -18 -37 7.11373 0.279
NP_440403.1_4 Reverse -276 -295 -7.67036 0.248
NP_440842.1_4 Reverse -16 -35 5.85867 0.148
NP_441014.1_10 Reverse -62 -81 8.4551 0.133
NP_441014.1_10 Reverse -139 -158 -2.55791 0.28
NP_442848.1_1 Forward -187 -173 -1.8687 0.263
NP_442848.1_1 Forward -78 -64 -2.26202 0.263
NP_442848.1_1 Reverse -57 -71 -2.45868 0.263
NP_442848.1_5 Reverse -382 -400 -1.35749 0.276
NP_442848.1_9 Forward -275 -256 -0.39387 0.278
NP_443018.1_3 Forward -71 -64 14.8871 0.0123
NP_443018.1_3 Reverse -64 -71 14.8871 0.0123
NP_443018.1_3 Reverse -173 -180 4.26735 0.267
NP_443018.1_3 Forward -180 -173 4.16902 0.278
NP_441634.1_8 Reverse -61 -75 5.01447 0.114
NP_441634.1_8 Forward -74 -60 2.94952 0.158
NP_441634.1_8 Forward -183 -169 2.35953 0.168
NP_441634.1_8 Forward -273 -259 0.196253 0.237
NP_440376.1_1 Forward -72 -63 19.4693 0.000692
NP_440376.1_1 Reverse -63 -72 19.4693 0.000692
NP_440376.1_1 Reverse -370 -379 4.22796 0.166
NP_440376.1_1 Reverse -172 -181 4.22796 0.166
NP_441588.1_4 Reverse -65 -75 8.63316 0.14
NP_443065.1_6 Forward -263 -244 8.55425 0.158
NP_442687.1_7 Reverse -369 -379 9.51814 0.0994
NP_442687.1_7 Forward -73 -63 8.92815 0.0994
NP_442687.1_7 Reverse -62 -72 8.92815 0.0994
NP_441013.1_2 Forward -182 -164 0.0191479 0.254
NP_442658.1_1 Reverse -61 -71 7.94438 0.199
NP_442658.1_1 Forward -74 -64 6.76441 0.214
NP_442658.1_1 Reverse -170 -180 5.87944 0.246
NP_442782.1_2 Reverse -377 -391 1.57289 0.281
NP_442205.1_9 Forward -78 -62 -3.08806 0.278
NP_441414.1_9 Forward -72 -53 -6.88371 0.206
NP_441414.1_9 Forward -139 -120 -10.9153 0.297
NP_440184.1_5 Forward -229 -210 3.14605 0.283
NP_442937.1_5 Reverse -365 -384 9.0459 0.204
NP_441958.1_2 Reverse -159 -178 11.3075 0.229
NP_441958.1_5 Forward -73 -63 12.2714 0.00183
NP_441958.1_5 Reverse -62 -72 12.2714 0.00183
NP_441127.1_1 Reverse -367 -381 9.83269 0.267
NP_442836.1_5 Forward -78 -59 6.68596 0.171
NP_442836.1_5 Reverse -57 -76 5.01433 0.196
NP_439905.1_1 Forward -71 -58 9.75405 0.216
NP_439905.1_1 Forward -242 -229 8.18076 0.236
NP_443001.1_7 Reverse -70 -89 8.65258 0.199
NP_440995.1_8 Reverse -120 -139 -0.688862 0.288
NP_439990.1_5 Forward -77 -64 9.95071 0.128
NP_439990.1_5 Reverse -157 -170 5.52582 0.289
NP_439990.1_5 Reverse -58 -71 5.32916 0.298
NP_442690.1_1 Forward -132 -113 -14.6519 0.273
NP_442911.1_1 Reverse -16 -29 18.9692 0.159
NP_442911.1_2 Reverse -53 -72 3.93269 0.0406
NP_442911.1_2 Forward -82 -63 -10.522 0.282
NP_442911.1_2 Forward -396 -377 -10.6203 0.284
NP_441580.1_6 Reverse -167 -186 -8.45701 0.262
NP_440153.1_5 Reverse -371 -385 8.16106 0.149
NP_440153.1_5 Forward -71 -57 2.94952 0.219
NP_440153.1_8 Reverse -172 -185 -2.83231 0.266
NP_440153.1_8 Reverse -272 -285 -3.32397 0.295
NP_440153.1_8 Reverse -162 -175 -3.4223 0.295
NP_440153.1_8 Reverse -383 -396 -3.61896 0.296
NP_440993.1_3 Reverse -53 -72 0.686995 0.247
NP_440993.1_4 Reverse -261 -278 8.29864 0.216
NP_441348.1_3 Forward -77 -58 7.07928 0.265
NP_441129.1_8 Forward -396 -377 16.9124 0.195
NP_441099.1_5 Forward -82 -63 6.39097 0.0458
NP_441294.1_7 Reverse -59 -73 19.1375 0.00332
NP_441294.1_7 Forward -76 -62 14.914 0.033
NP_441294.1_7 Reverse -366 -380 9.92255 0.219
NP_441646.1_1 Reverse -255 -274 0.786102 0.243
NP_442438.1_10 Reverse -58 -72 3.04785 0.166
NP_442438.1_10 Forward -77 -63 -0.393733 0.259
NP_442438.1_10 Forward -264 -250 -1.18038 0.296
NP_441000.1_6 Forward -73 -59 4.71948 0.0933
NP_441000.1_6 Reverse -167 -181 -3.73699 0.225
NP_441000.1_6 Reverse -62 -76 -4.7203 0.251
NP_441000.1_6 Reverse -202 -216 -5.40861 0.275
NP_440147.1_4 Forward -74 -61 9.75405 0.0371
NP_440147.1_4 Reverse -61 -74 8.67241 0.0475
NP_441550.1_8 Reverse -61 -71 15.1225 0.0132
NP_441550.1_8 Forward -74 -64 12.3692 0.0336
NP_441916.1_7 Forward -72 -62 10.3048 0.0261
NP_441916.1_7 Reverse -63 -73 10.3048 0.0261
NP_441916.1_7 Reverse -172 -182 6.76487 0.0841
NP_441916.1_10 Forward -80 -61 5.11266 0.216
NP_441041.1_4 Reverse -63 -82 -5.31042 0.151
NP_441041.1_4 Forward -187 -168 -13.5702 0.291
NP_441041.1_4 Forward -287 -268 -13.9635 0.299
NP_441547.1_2 Forward -83 -65 6.41066 0.215
NP_442004.1_6 Forward -385 -371 5.99778 0.181
NP_442004.1_6 Forward -72 -58 2.06454 0.274
NP_441725.1_5 Reverse -64 -74 11.2881 0.0247
NP_441725.1_5 Forward -71 -61 2.04498 0.115
NP_439966.1_7 Forward -74 -64 15.8108 0.0124
NP_439966.1_7 Reverse -61 -71 15.3192 0.0152
NP_442941.1_3 Reverse -64 -74 19.9412 0.00262
NP_442941.1_3 Forward -71 -61 19.2529 0.00262
NP_442941.1_3 Reverse -173 -183 0.668351 0.19
NP_440289.1_2 Forward -75 -62 13.294 0.0132
NP_440289.1_2 Reverse -60 -73 3.16588 0.0811
NP_440983.1_5 Forward -335 -316 -0.197208 0.223
NP_442281.1_1 Forward -77 -63 9.14375 0.0736
NP_442256.1_2 Reverse -61 -79 -8.83064 0.236
NP_001035871.2_7 Reverse -331 -341 13.5497 0.219
NP_441556.1_10 Forward -277 -263 9.92981 0.281
NP_441644.1_6 Forward -72 -62 17.3841 0.00127
NP_441644.1_6 Reverse -63 -73 17.3841 0.00127
NP_441644.1_6 Reverse -172 -182 3.8145 0.261
NP_442215.1_2 Forward -251 -235 -3.28472 0.213
NP_442215.1_2 Reverse -61 -77 -4.1697 0.228
NP_440253.1_2 Reverse -63 -81 11.9172 0.0302
NP_440929.1_8 Forward -72 -63 19.2726 0.000701
NP_440929.1_8 Reverse -63 -72 19.2726 0.000701
NP_442933.1_10 Forward -72 -63 17.601 0.00325
NP_442933.1_10 Reverse -63 -72 17.601 0.00325
NP_442933.1_10 Reverse -172 -181 4.71961 0.22
NP_441751.2_8 Reverse -64 -78 13.7659 0.015
NP_441751.2_8 Forward -71 -57 4.91614 0.0453
NP_442926.1_1 Forward -183 -164 -6.1954 0.278
NP_442926.1_3 Forward -89 -70 2.26107 0.295
NP_439922.1_3 Forward -96 -77 15.0396 0.124
NP_442554.1_8 Forward -71 -61 16.2046 0.0065
NP_442554.1_8 Reverse -64 -74 15.9097 0.00747
NP_442554.1_8 Reverse -173 -183 5.28991 0.153
NP_441762.1_7 Forward -73 -61 -6.74586 0.284
NP_441762.1_7 Reverse -62 -74 -6.84419 0.284
NP_442142.1_4 Forward -75 -62 14.1783 0.0311
NP_442142.1_4 Reverse -165 -178 12.9984 0.0406
NP_442142.1_4 Reverse -60 -73 4.34528 0.223
NP_442292.1_1 Forward -71 -62 18.486 0.00229
NP_442292.1_1 Reverse -64 -73 18.486 0.00229
NP_442292.1_1 Reverse -173 -182 -0.786921 0.287
NP_442476.1_6 Forward -71 -57 11.3077 0.056
NP_442476.1_6 Reverse -263 -277 6.48943 0.126
NP_441264.1_1 Reverse -373 -392 12.6841 0.232
NP_443009.1_5 Reverse -62 -73 8.90795 0.0965
NP_443009.1_5 Forward -73 -62 8.90795 0.0965
NP_443009.1_5 Forward -182 -171 5.85971 0.185
NP_443009.1_5 Reverse -261 -272 4.8764 0.226
NP_443009.1_5 Reverse -249 -260 4.48308 0.244
NP_442301.1_2 Reverse -379 -398 18.1898 0.0906
NP_441715.1_4 Forward -71 -61 17.3846 0.0106
NP_441715.1_4 Reverse -64 -74 14.828 0.0268
NP_440620.1_4 Reverse -82 -96 14.4309 0.272
NP_441088.1_1 Forward -187 -168 21.1406 0.0296
NP_441088.1_2 Forward -316 -297 32.7437 0.000094
NP_441088.1_3 Forward -232 -213 33.137 0.0000242
NP_441088.1_4 Forward -343 -324 25.7622 0.00302
NP_441088.1_6 Forward -382 -363 26.7455 0.00444
NP_441088.1_7 Forward -274 -255 21.8289 0.0673
NP_441198.1_8 Reverse -260 -270 14.7362 0.0644
NP_441468.1_1 Forward -71 -64 15.8704 0.0124
NP_441468.1_1 Reverse -64 -71 15.8704 0.0124
NP_441468.1_1 Reverse -173 -180 4.26735 0.246
NP_441015.1_10 Forward -186 -167 -5.21209 0.219
NP_441015.1_10 Reverse -365 -384 -7.67036 0.27
NP_441673.1_1 Forward -72 -63 20.8459 0.000698
NP_441673.1_1 Reverse -63 -72 20.8459 0.000698
NP_440265.1_4 Reverse -58 -77 16.2729 0.297
NP_441426.1_4 Forward -182 -163 12.4875 0.228
NP_441826.1_2 Forward -78 -64 6.09611 0.0946
NP_441826.1_2 Forward -187 -173 -0.295402 0.208
NP_441764.1_4 Forward -35 -18 11.0321 0.232
NP_441764.1_8 Forward -30 -20 14.7561 0.284
NP_442868.1_6 Reverse -61 -71 19.2529 0.00563
NP_442868.1_6 Forward -74 -64 9.91146 0.038
NP_441056.1_1 Reverse -63 -82 1.27776 0.151
NP_441612.1_2 Reverse -63 -73 8.54929 0.21
NP_441612.1_2 Forward -72 -62 8.54929 0.21
NP_442808.1_1 Reverse -62 -72 8.63269 0.0481
NP_442808.1_1 Forward -73 -63 8.63269 0.0481
NP_441101.1_7 Reverse -164 -183 14.1591 0.29
NP_441849.1_2 Reverse -30 -49 5.68135 0.245
NP_442718.1_9 Forward -118 -100 18.8004 0.135
NP_442542.1_2 Reverse -61 -74 9.75405 0.131
NP_442542.1_2 Reverse -368 -381 9.2624 0.137
NP_442542.1_9 Reverse -345 -359 11.602 0.111
NP_442050.1_5 Forward -74 -64 16.4991 0.00812
NP_442050.1_5 Reverse -61 -71 14.3359 0.0206
NP_441518.1_3 Forward -82 -63 -13.8652 0.264
NP_441878.1_6 Forward -73 -63 10.4031 0.0176
NP_441878.1_6 Reverse -62 -72 10.4031 0.0176
NP_441878.1_6 Reverse -171 -181 -7.88644 0.278
NP_441036.1_8 Forward -73 -63 8.33817 0.174
NP_441036.1_8 Reverse -62 -72 8.33817 0.174
NP_440614.1_1 Forward -30 -11 10.8159 0.285
NP_441557.1_5 Forward -72 -63 19.9609 0.000699
NP_441557.1_5 Reverse -63 -72 19.9609 0.000699
NP_441557.1_5 Forward -181 -172 -0.590259 0.219
NP_441445.1_1 Forward -81 -62 12.2908 0.0716
NP_441445.1_1 Reverse -54 -73 10.9142 0.0912
NP_441445.1_1 Forward -190 -171 3.6377 0.21
NP_441458.1_10 Reverse -169 -188 1.27776 0.292
NP_442183.1_1 Reverse -63 -77 7.37441 0.143
NP_441819.1_5 Reverse -18 -37 10.8379 0.261
NP_441574.1_1 Reverse -377 -396 -7.27704 0.286
NP_442347.1_2 Forward -71 -62 12.4878 0.056
NP_442347.1_2 Reverse -64 -73 12.4878 0.056
NP_442645.1_2 Forward -80 -61 -16.6185 0.237
NP_442645.1_2 Reverse -55 -74 -21.535 0.29
NP_440151.1_6 Forward -387 -368 16.5191 0.139
NP_441633.1_3 Reverse -61 -74 3.36254 0.0699
NP_441633.1_3 Forward -273 -260 -4.30728 0.191
NP_441633.1_3 Forward -74 -61 -5.97891 0.236
NP_440136.1_2 Forward -71 -64 15.9687 0.0123
NP_440136.1_2 Reverse -64 -71 15.9687 0.0123
NP_442590.1_10 Reverse -370 -389 12.7825 0.145
NP_442590.1_10 Forward -187 -168 8.45592 0.208
NP_442590.1_10 Forward -184 -165 4.52268 0.274
NP_442998.1_10 Forward -70 -63 15.5754 0.0102
NP_442998.1_10 Reverse -65 -72 15.5754 0.0102
NP_440299.1_1 Reverse -59 -72 14.1783 0.0259
NP_440299.1_1 Reverse -174 -187 9.95012 0.0631
NP_440299.1_1 Forward -76 -63 4.44361 0.207
NP_441799.1_1 Reverse -59 -73 16.3219 0.0152
NP_441799.1_1 Forward -76 -62 10.0287 0.0797
NP_441799.1_1 Forward -185 -171 6.39049 0.174
NP_440256.1_1 Forward -75 -56 7.17762 0.027
NP_440256.1_1 Forward -184 -165 -3.73712 0.138
NP_440256.1_1 Forward -190 -171 -5.70374 0.189
NP_441559.1_8 Reverse -58 -72 10.226 0.0596
NP_441559.1_8 Forward -264 -250 -6.98191 0.281
NP_440915.1_6 Reverse -59 -73 0.0979218 0.176
NP_440915.1_6 Forward -263 -249 -1.5737 0.239
NP_440717.1_2 Reverse -163 -182 -10.1286 0.245
NP_442785.1_7 Forward -74 -60 11.2093 0.228
NP_439985.1_7 Forward -78 -59 6.39097 0.192
NP_442993.1_1 Reverse -63 -79 11.1699 0.0146
NP_442993.1_1 Reverse -203 -219 -9.5779 0.188
NP_442386.1_9 Reverse -62 -71 13.8639 0.0289
NP_442386.1_9 Forward -73 -64 13.8639 0.0289
NP_442386.1_9 Forward -272 -263 6.19416 0.23
NP_442386.1_9 Reverse -171 -180 5.40752 0.253
NP_441340.1_5 Forward -71 -64 15.6737 0.0124
NP_441340.1_5 Reverse -64 -71 15.6737 0.0124
NP_441340.1_5 Forward -180 -173 4.07068 0.239
NP_440168.1_2 Reverse -164 -183 -3.83545 0.276
NP_442714.1_7 Forward -71 -52 -0.295539 0.263
NP_440586.1_8 Forward -71 -64 13.2151 0.026
NP_440586.1_8 Reverse -64 -71 13.2151 0.026
NP_440586.1_8 Forward -138 -131 12.6251 0.0546
NP_442251.1_6 Forward -71 -64 15.2804 0.0124
NP_442251.1_6 Reverse -64 -71 15.2804 0.0124
NP_442959.1_6 Forward -212 -193 3.14605 0.245
NP_440684.1_9 Forward -78 -64 9.34103 0.221
NP_441262.1_3 Reverse -63 -70 14.7888 0.0223
NP_441262.1_3 Forward -72 -65 14.7888 0.0223
NP_440027.1_3 Forward -72 -54 6.70489 0.223
NP_440027.1_3 Reverse -376 -394 4.63995 0.255
NP_440027.1_3 Reverse -162 -180 3.36165 0.273
NP_440027.1_3 Forward -187 -169 1.78836 0.295
NP_440027.1_8 Reverse -373 -392 13.9616 0.175
NP_443051.1_1 Reverse -62 -71 10.4228 0.00754
NP_443051.1_1 Forward -73 -64 10.4228 0.00754
NP_439937.1_9 Forward -73 -56 -4.97671 0.157
NP_440408.1_7 Forward -225 -206 9.14423 0.264
NP_440439.1_1 Reverse -60 -73 4.24752 0.104
NP_440372.1_2 Forward -71 -64 16.3621 0.0124
NP_440372.1_2 Reverse -64 -71 16.3621 0.0124
NP_441803.1_2 Forward -186 -167 0.196116 0.258
NP_439977.1_5 Reverse -57 -76 -1.96717 0.266
NP_441572.1_7 Forward -78 -59 -1.18052 0.186
NP_441572.1_7 Forward -265 -246 -5.31042 0.257
NP_442384.1_10 Forward -72 -59 21.4554 0.00194
NP_442384.1_10 Forward -187 -174 3.5592 0.186
NP_442384.1_10 Reverse -63 -76 1.10092 0.268
NP_442790.1_4 Forward -385 -366 -13.3736 0.26
NP_442262.1_10 Forward -71 -64 14.1988 0.0123
NP_442262.1_10 Reverse -64 -71 14.1988 0.0123
NP_441689.1_5 Forward -74 -64 15.3192 0.0403
NP_441689.1_5 Reverse -61 -71 5.78111 0.197
NP_440163.1_10 Forward -75 -65 11.3864 0.169
NP_440344.1_10 Forward -79 -62 -6.35267 0.113
NP_440344.1_10 Reverse -56 -73 -8.12263 0.123
NP_440344.1_10 Reverse -255 -272 -8.22096 0.124
NP_440344.1_10 Forward -156 -139 -9.10594 0.139
NP_440531.1_6 Reverse -55 -74 -1.96717 0.241
NP_441965.1_10 Forward -75 -59 5.46674 0.204
NP_440297.1_9 Reverse -64 -74 9.32148 0.0917
NP_440297.1_9 Forward -71 -61 -0.118297 0.282
NP_440297.1_9 Reverse -173 -183 -0.41329 0.283
NP_440350.1_2 Reverse -171 -190 4.71934 0.289
NP_442280.1_10 Forward -252 -234 5.06482 0.291
NP_443036.1_1 Forward -394 -375 10.1267 0.267
NP_440999.1_9 Reverse -168 -182 9.83269 0.0589
NP_440999.1_9 Forward -380 -366 1.67122 0.16
NP_440999.1_9 Reverse -59 -73 -0.393733 0.205
NP_440999.1_9 Forward -263 -249 -0.492064 0.209
NP_440888.1_2 Forward -72 -58 17.3052 0.00418
NP_440888.1_2 Reverse -63 -77 16.4202 0.00685
NP_440600.1_4 Reverse -122 -140 -3.81576 0.243
NP_440575.1_8 Forward -26 -7 -7.57203 0.298
NP_441543.1_2 Forward -71 -62 16.9127 0.00359
NP_441543.1_2 Reverse -64 -73 16.9127 0.00359
NP_441543.1_2 Reverse -169 -178 4.91628 0.213
NP_441543.1_2 Forward -378 -369 4.0313 0.293
NP_442845.1_2 Reverse -370 -384 17.0108 0.0608
NP_442845.1_2 Forward -78 -64 12.6843 0.104
NP_442845.1_2 Reverse -57 -71 5.40779 0.233
NP_442845.1_2 Forward -282 -268 5.21113 0.24
NP_441551.1_5 Reverse -59 -75 7.13767 0.249
NP_442710.1_7 Reverse -111 -130 -8.27995 0.299
NP_441469.1_8 Forward -73 -64 6.48957 0.227
NP_441469.1_8 Reverse -62 -71 6.48957 0.227
NP_443064.1_6 Forward -72 -62 12.5669 0.0796
NP_443064.1_6 Reverse -63 -73 12.5669 0.0796
NP_442337.1_8 Reverse -52 -71 2.94938 0.217
NP_442337.1_8 Reverse -309 -328 -0.688862 0.278
NP_440257.1_6 Reverse -348 -367 16.5182 0.238
NP_442578.1_7 Forward -71 -64 14.5921 0.026
NP_442578.1_7 Reverse -64 -71 14.5921 0.026
NP_442578.1_7 Forward -138 -131 12.6255 0.0418
NP_440148.1_6 Reverse -120 -134 15.4762 0.3
NP_441462.1_2 Forward -72 -62 11.5831 0.00406
NP_441462.1_2 Reverse -63 -73 11.5831 0.00406
NP_441621.1_7 Reverse -164 -178 -4.62196 0.238
NP_443062.1_1 Forward -259 -241 8.2534 0.157
NP_443062.1_1 Reverse -63 -81 6.8883 0.19
NP_443062.1_6 Reverse -55 -74 6.88262 0.179
NP_443062.1_6 Forward -80 -61 4.42435 0.218
NP_443062.1_6 Forward -189 -170 3.93269 0.225
NP_441601.1_2 Forward -78 -59 -4.13045 0.28
NP_442204.1_1 Reverse -59 -70 0.0586712 0.284
NP_440544.1_5 Reverse -23 -30 13.8024 0.28
NP_442487.1_5 Forward -188 -169 11.2084 0.198
NP_440516.1_2 Forward -78 -60 -2.63579 0.299
NP_440516.1_8 Forward -72 -63 16.9127 0.00442
NP_440516.1_8 Reverse -63 -72 16.9127 0.00442
NP_441785.1_1 Reverse -63 -77 11.9627 0.278
NP_442428.1_5 Forward -71 -64 15.8704 0.0124
NP_442428.1_5 Reverse -64 -71 15.8704 0.0124
NP_442428.1_5 Reverse -173 -180 4.66067 0.244
NP_441267.1_1 Reverse -57 -76 14.9458 0.14
NP_442120.1_10 Reverse -63 -82 -7.4737 0.222
NP_442823.1_8 Forward -397 -378 11.0125 0.296
NP_440673.1_3 Forward -70 -63 12.4288 0.0426
NP_440673.1_3 Reverse -65 -72 12.4288 0.0426
NP_440673.1_3 Reverse -132 -139 11.7405 0.0653
NP_440673.1_3 Forward -179 -172 10.4622 0.139
NP_441714.1_3 Forward -336 -318 14.6697 0.171
NP_440865.1_9 Forward -78 -59 -8.26035 0.263
NP_441052.1_2 Forward -72 -62 19.9412 0.00106
NP_441052.1_2 Reverse -63 -73 19.9412 0.00106
NP_441052.1_2 Forward -149 -139 1.55333 0.238
NP_440992.1_2 Forward -397 -378 8.16093 0.293
NP_442219.1_9 Forward -71 -62 17.7976 0.00718
NP_442219.1_9 Reverse -64 -73 17.7976 0.00718
NP_440436.1_4 Forward -71 -62 17.2072 0.00233
NP_440436.1_4 Reverse -64 -73 17.2072 0.00233
NP_440436.1_4 Forward -180 -171 4.7192 0.244
NP_441884.1_9 Forward -75 -56 -21.6334 0.256
NP_441884.1_9 Reverse -317 -336 -22.3217 0.277
NP_441893.1_10 Forward -213 -194 13.6675 0.186
NP_440314.1_9 Reverse -82 -101 -3.04881 0.173
NP_441719.1_2 Reverse -127 -141 13.0601 0.289
NP_441719.1_4 Forward -71 -64 16.3621 0.0124
NP_441719.1_4 Reverse -64 -71 16.3621 0.0124
NP_441719.1_4 Forward -138 -131 3.77569 0.285
NP_442366.1_3 Reverse -62 -80 1.78911 0.141
NP_440296.1_6 Forward -203 -185 10.4106 0.295
NP_442854.1_6 Reverse -370 -389 1.47442 0.279
NP_443054.1_2 Reverse -61 -75 1.08123 0.251
NP_441851.1_10 Forward -73 -63 15.8113 0.00552
NP_441851.1_10 Reverse -62 -72 15.8113 0.00552
NP_441851.1_10 Forward -272 -262 9.61647 0.114
NP_441851.1_10 Reverse -261 -271 4.3066 0.277
NP_442856.1_7 Reverse -163 -182 10.6192 0.0826
NP_442515.1_1 Reverse -62 -76 9.43936 0.0629
NP_442515.1_1 Forward -73 -59 9.04604 0.0671
NP_442515.1_1 Forward -347 -333 -0.000409212 0.206
NP_441683.1_5 Forward -390 -371 7.66927 0.256
NP_441982.1_10 Forward -95 -76 7.57013 0.186
NP_441349.1_10 Reverse -53 -72 2.16274 0.0762
NP_441349.1_10 Forward -82 -63 -1.47551 0.104
NP_441349.1_10 Reverse -156 -175 -4.22878 0.164
NP_441349.1_10 Reverse -367 -386 -7.96535 0.262
NP_441349.1_10 Forward -389 -370 -9.83364 0.297
NP_441409.1_6 Reverse -57 -76 8.45592 0.026
NP_440474.1_8 Reverse -64 -78 7.57046 0.204
NP_441477.1_5 Reverse -330 -349 6.58763 0.28
NP_441477.1_10 Forward -386 -368 9.36059 0.181
NP_440431.1_3 Forward -91 -72 -8.65367 0.236
NP_442450.1_5 Forward -74 -64 9.32148 0.115
NP_440588.1_2 Reverse -54 -73 -2.55715 0.167
NP_441031.1_1 Forward -47 -28 14.8245 0.0999
NP_443047.1_7 Forward -258 -239 4.22769 0.271
NP_442243.1_1 Reverse -57 -75 0.510066 0.231
NP_441570.1_1 Reverse -370 -388 -10.6989 0.177
NP_441570.1_1 Forward -72 -54 -14.2388 0.225
NP_441570.1_1 Reverse -63 -81 -17.2871 0.269
NP_441078.1_4 Forward -72 -63 19.6659 0.0007
NP_441078.1_4 Reverse -63 -72 19.6659 0.0007
NP_441078.1_4 Forward -379 -370 -1.27858 0.246
NP_441078.1_4 Reverse -172 -181 -1.86856 0.272
NP_442729.1_8 Reverse -258 -271 9.16406 0.125
NP_440526.1_3 Reverse -64 -75 10.1862 0.0646
NP_440526.1_3 Forward -71 -60 0.943182 0.267
NP_441432.1_8 Reverse -62 -71 16.8143 0.00595
NP_441432.1_8 Forward -73 -64 16.8143 0.00595
NP_441432.1_8 Reverse -376 -385 5.50626 0.151
NP_441432.1_8 Forward -380 -371 2.65466 0.292
NP_442320.1_8 Forward -78 -64 4.71948 0.0472
NP_442320.1_8 Forward -155 -141 -4.4253 0.168
NP_441732.1_2 Forward -76 -60 -6.7263 0.0495
NP_441732.1_2 Reverse -59 -75 -16.4611 0.167
NP_440760.1_1 Forward -72 -53 -16.0285 0.163
NP_442797.1_7 Reverse -56 -74 2.67408 0.238
NP_442797.1_7 Forward -278 -260 1.00246 0.267
NP_440199.1_10 Forward -75 -65 16.7946 0.0381
NP_440199.1_10 Forward -152 -142 13.8447 0.0988
NP_440199.1_10 Forward -184 -174 7.64985 0.231
NP_442353.1_4 Forward -78 -59 5.2102 0.185
NP_442353.1_4 Reverse -166 -185 3.63691 0.213
NP_441072.1_2 Reverse -52 -71 6.88262 0.264
NP_442400.1_1 Reverse -60 -79 2.85105 0.179
NP_440713.1_4 Reverse -53 -72 11.9958 0.112
NP_442489.1_2 Forward -83 -64 10.2259 0.168
NP_442489.1_7 Forward -72 -63 20.1576 0.000695
NP_442489.1_7 Reverse -63 -72 20.1576 0.000695
NP_442489.1_7 Reverse -172 -181 -1.37691 0.195
NP_440559.1_1 Forward -71 -62 17.4043 0.00658
NP_440559.1_1 Reverse -64 -73 17.4043 0.00658
NP_441659.2_8 Forward -72 -62 18.1713 0.00133
NP_441659.2_8 Reverse -63 -73 18.1713 0.00133
NP_441659.2_8 Reverse -172 -182 3.22496 0.169
NP_440363.1_9 Reverse -163 -181 13.1955 0.254
NP_442008.1_2 Reverse -153 -172 3.24438 0.26
NP_442346.1_5 Forward -73 -63 16.6963 0.00248
NP_442346.1_5 Reverse -62 -72 16.6963 0.00248
NP_442346.1_5 Forward -182 -172 5.5849 0.238
NP_440545.1_3 Forward -76 -59 -5.46769 0.25
NP_440545.1_3 Reverse -269 -286 -6.746 0.287
NP_440459.1_2 Forward -221 -204 7.512 0.288
NP_441653.1_2 Reverse -161 -180 10.0041 0.137
NP_440010.1_4 Forward -185 -166 2.26028 0.225
NP_442603.1_7 Forward -72 -58 10.9137 0.125
NP_441888.1_7 Reverse -167 -181 0.589577 0.292
NP_441833.1_4 Forward -71 -64 15.9687 0.0124
NP_441833.1_4 Reverse -64 -71 15.9687 0.0124
NP_441329.1_6 Forward -42 -23 -1.00309 0.288
NP_441895.1_10 Forward -36 -17 -18.7818 0.282
NP_442060.1_10 Forward -227 -208 8.94757 0.269
NP_442162.1_9 Forward -71 -64 16.2637 0.0124
NP_442162.1_9 Reverse -64 -71 16.2637 0.0124
NP_440671.1_4 Forward -78 -64 15.3392 0.0454
NP_442943.1_1 Reverse -113 -128 13.2502 0.117
NP_440772.1_1 Forward -21 -2 20.1573 0.0378
NP_440772.1_4 Forward -391 -372 23.4022 0.0394
NP_440772.1_8 Forward -78 -59 20.944 0.182
NP_442140.1_3 Forward -71 -61 10.3048 0.0902
NP_442140.1_3 Reverse -64 -74 4.40493 0.243
NP_440875.1_9 Reverse -236 -246 9.54007 0.233
NP_442547.1_7 Reverse -236 -255 9.93029 0.3
NP_441813.1_5 Reverse -61 -71 18.1713 0.00743
NP_441813.1_5 Forward -74 -64 15.9097 0.01
NP_441813.1_5 Reverse -170 -180 -0.609952 0.261
NP_440594.1_8 Forward -71 -58 11.9167 0.152
NP_440590.1_4 Forward -71 -58 13.4906 0.013
NP_440590.1_4 Reverse -64 -77 4.54251 0.0601
NP_440567.1_1 Forward -71 -57 4.81781 0.111
NP_442497.1_10 Forward -71 -62 10.4228 0.0087
NP_442497.1_10 Reverse -64 -73 10.4228 0.0087
NP_440821.1_4 Forward -74 -64 18.2696 0.00448
NP_440821.1_4 Reverse -61 -71 9.41981 0.0286
NP_441239.1_9 Reverse -61 -73 5.25052 0.223
NP_441239.1_9 Forward -74 -62 4.36554 0.253
NP_441951.1_4 Forward -398 -379 1.0811 0.288
NP_441951.1_9 Forward -67 -48 -0.885524 0.283
NP_441892.1_1 Forward -148 -131 -3.50107 0.242
NP_441892.1_1 Reverse -169 -186 -3.79607 0.249
NP_441017.1_6 Forward -76 -62 14.1586 0.157
NP_440546.1_4 Forward -72 -62 10.046 0.109
NP_440546.1_4 Reverse -63 -73 10.046 0.109
NP_440462.1_6 Reverse -61 -71 9.61647 0.0429
NP_440462.1_6 Forward -74 -64 7.74818 0.0699
NP_440462.1_6 Forward -141 -131 3.22496 0.255
NP_442340.1_3 Forward -396 -377 -4.6221 0.217
NP_440868.1_4 Reverse -59 -71 17.6402 0.0124
NP_440868.1_4 Forward -76 -64 5.93884 0.0879
NP_440868.1_4 Forward -181 -169 -0.649339 0.28
NP_441879.1_3 Reverse -64 -83 2.75272 0.261
NP_440696.1_3 Reverse -136 -154 -2.83245 0.279
NP_440696.1_3 Forward -181 -163 -2.93078 0.28
NP_442039.1_4 Forward -71 -64 15.1821 0.0124
NP_442039.1_4 Reverse -64 -71 15.1821 0.0124
NP_442039.1_7 Reverse -256 -266 11.3864 0.257
NP_442039.1_7 Forward -223 -213 7.64985 0.273
NP_441926.1_3 Reverse -63 -79 16.0865 0.0428
NP_442837.1_3 Forward -71 -64 15.7721 0.0124
NP_442837.1_3 Reverse -64 -71 15.7721 0.0124
NP_442837.1_3 Reverse -131 -138 9.87221 0.106
NP_441760.1_4 Forward -287 -269 11.6222 0.235
NP_439994.1_3 Forward -73 -54 13.8039 0.118
NP_442053.1_1 Forward -72 -63 18.3876 0.0007
NP_442053.1_1 Reverse -63 -72 18.3876 0.0007
NP_440505.1_3 Reverse -61 -71 18.3679 0.00213
NP_440505.1_3 Forward -74 -64 16.303 0.00696
NP_440505.1_7 Forward -288 -269 -1.86883 0.284
NP_441203.1_1 Reverse -131 -150 -19.7651 0.297
NP_440914.1_1 Forward -72 -62 17.5935 0.000537
NP_440914.1_1 Reverse -63 -73 17.5935 0.000537
NP_441011.1_8 Forward -71 -62 8.25953 0.144
NP_441011.1_8 Reverse -64 -73 8.25953 0.144
NP_441011.1_8 Reverse -131 -140 5.3096 0.271
NP_442533.1_1 Forward -316 -297 -16.7168 0.275
NP_442533.1_6 Forward -72 -63 17.2076 0.00137
NP_442533.1_6 Reverse -63 -72 17.2076 0.00137
NP_442533.1_6 Forward -181 -172 12.7828 0.0265
NP_442533.1_6 Forward -379 -370 3.04799 0.228
NP_439944.1_9 Reverse -64 -74 19.0562 0.00329
NP_439944.1_9 Forward -71 -61 10.5014 0.0887
NP_439944.1_9 Reverse -173 -183 7.05986 0.157
NP_442351.1_6 Reverse -170 -189 16.5191 0.245
NP_441527.1_4 Forward -38 -19 -0.812105 0.146
NP_441527.1_4 Forward -142 -123 -7.78302 0.237
NP_440115.1_6 Reverse -60 -70 15.0247 0.0505
NP_440007.1_9 Forward -76 -62 0.88457 0.29
NP_439965.1_1 Reverse -54 -73 -6.39206 0.213
NP_441347.1_9 Reverse -16 -29 12.7424 0.17
NP_441602.1_3 Reverse -371 -390 -0.590531 0.224
NP_441602.1_3 Forward -276 -257 -1.96717 0.231
NP_441972.1_5 Reverse -141 -160 -7.57203 0.25
NP_441106.1_1 Reverse -171 -180 11.4061 0.0311
NP_441106.1_1 Forward -73 -64 9.63616 0.0311
NP_441106.1_1 Reverse -62 -71 9.63616 0.0311
NP_442306.1_10 Reverse -58 -77 -10.6203 0.11
NP_442306.1_10 Forward -182 -163 -21.7317 0.286
NP_441286.1_1 Reverse -62 -74 21.3768 0.00196
NP_441286.1_1 Forward -73 -61 12.9203 0.00815
NP_441286.1_1 Forward -272 -260 -6.35254 0.26
NP_440670.1_8 Forward -72 -63 18.3876 0.000699
NP_440670.1_8 Reverse -63 -72 18.3876 0.000699
NP_440886.1_7 Forward -73 -63 7.94438 0.0805
NP_440886.1_7 Reverse -62 -72 7.94438 0.0805
NP_440886.1_7 Forward -380 -370 5.48612 0.181
NP_442614.1_2 Forward -72 -58 14.4542 0.0984
NP_442614.1_2 Reverse -63 -77 5.89945 0.296
NP_442072.1_9 Reverse -62 -80 -11.4856 0.0789
NP_442213.1_5 Reverse -52 -71 -1.47551 0.293
NP_440907.2_8 Forward -270 -260 5.78111 0.188
NP_442264.1_2 Forward -76 -59 4.6604 0.295
NP_441021.1_1 Reverse -64 -83 -5.21209 0.177
NP_440841.1_4 Forward -74 -55 -5.80207 0.208
NP_441463.1_3 Forward -191 -172 -2.65548 0.158
NP_441463.1_3 Forward -82 -63 -9.047 0.276
NP_441463.1_6 Forward -80 -66 10.6678 0.242
NP_441463.1_6 Forward -74 -60 8.34861 0.25
NP_441626.1_2 Forward -71 -64 15.7721 0.0124
NP_441626.1_2 Reverse -64 -71 15.7721 0.0124
NP_442365.1_7 Forward -76 -57 -4.91709 0.254
NP_442615.1_1 Forward -81 -63 1.39578 0.0853
NP_440387.1_1 Reverse -63 -79 -2.10475 0.146
NP_440387.1_1 Reverse -370 -386 -6.03799 0.262
NP_441431.1_2 Forward -389 -375 8.94708 0.2
NP_441431.1_2 Reverse -169 -183 8.06211 0.226
NP_441836.1_2 Reverse -57 -76 -4.13045 0.254
NP_441993.1_1 Forward -287 -268 5.74752 0.195
NP_440143.1_1 Forward -99 -80 12.2908 0.287
NP_440114.1_10 Reverse -63 -77 8.55439 0.2
NP_441552.1_3 Reverse -56 -75 13.9616 0.257
NP_440293.1_3 Forward -283 -264 -1.08219 0.239
NP_439988.1_3 Reverse -378 -392 4.52282 0.295
NP_442743.1_5 Forward -186 -167 3.24438 0.276
NP_439910.1_2 Forward -80 -63 6.92201 0.00731
NP_440457.1_1 Reverse -59 -71 10.7571 0.092
NP_440457.1_1 Forward -76 -64 0.0389777 0.25
NP_440987.1_7 Forward -141 -127 21.5341 0.198
NP_442680.1_5 Reverse -84 -103 -1.19775 0.299
NP_440801.1_10 Forward -185 -166 5.80098 0.289
NP_441984.1_2 Forward -393 -374 9.93088 0.213
NP_441436.1_8 Forward -220 -201 13.0775 0.215
NP_442509.1_4 Reverse -165 -184 13.1758 0.276
NP_442509.1_9 Forward -72 -62 8.14104 0.192
NP_442509.1_9 Reverse -63 -73 8.14104 0.192
NP_442514.1_5 Reverse -254 -273 -7.27777 0.276
NP_440554.1_4 Forward -71 -61 8.92815 0.0646
NP_440554.1_4 Reverse -64 -74 7.05986 0.106
NP_440554.1_4 Forward -180 -170 6.17489 0.126
NP_441885.1_5 Forward -72 -62 20.9245 0.000538
NP_441885.1_5 Reverse -63 -73 20.9245 0.000538
NP_441885.1_5 Reverse -370 -380 -0.904945 0.241
NP_440478.1_7 Forward -396 -377 17.699 0.25
NP_442341.1_7 Forward -380 -366 8.45605 0.0881
NP_442341.1_7 Reverse -62 -76 8.35772 0.0881
NP_442341.1_7 Forward -73 -59 1.08123 0.299
NP_442341.1_7 Reverse -139 -153 1.08123 0.299
NP_442341.1_9 Reverse -61 -75 10.5204 0.133
NP_440409.1_2 Forward -230 -211 15.7324 0.0994
NP_440423.1_6 Forward -80 -61 -14.0619 0.224
NP_443000.1_7 Reverse -61 -71 19.9412 0.00223
NP_443000.1_7 Forward -74 -64 17.0896 0.00865
NP_443000.1_7 Forward -141 -131 4.20827 0.209
NP_440507.2_3 Forward -190 -171 11.11 0.195
NP_441842.1_1 Forward -70 -57 19.7832 0.0111
NP_440275.1_3 Reverse -61 -71 15.123 0.0182
NP_440275.1_3 Forward -74 -64 8.1415 0.0602
NP_440091.1_1 Forward -76 -64 16.4603 0.0153
NP_440091.1_1 Reverse -59 -71 8.29878 0.0653
NP_443060.1_5 Reverse -55 -74 4.81688 0.279
NP_443010.1_10 Forward -75 -58 10.5981 0.121
NP_442451.1_2 Reverse -164 -183 -10.7186 0.278
NP_441122.1_1 Forward -304 -289 8.82968 0.28
NP_439962.1_4 Reverse -164 -183 3.93269 0.187
NP_440149.1_8 Forward -187 -168 7.37428 0.0628
NP_441105.1_3 Reverse -161 -180 0.196116 0.129
NP_440216.1_1 Forward -72 -58 9.63603 0.00589
NP_440216.1_1 Reverse -63 -77 -1.77037 0.0383
NP_440216.1_9 Reverse -241 -250 11.5045 0.262
NP_440172.1_1 Forward -72 -62 15.0247 0.00945
NP_440172.1_1 Reverse -63 -73 15.0247 0.00945
NP_442015.1_10 Reverse -59 -72 11.819 0.0372
NP_442015.1_10 Reverse -136 -149 8.77074 0.0605
NP_442015.1_10 Reverse -168 -181 2.96921 0.187
NP_442015.1_10 Forward -76 -63 0.60927 0.221
NP_442015.1_10 Forward -275 -262 -0.37404 0.264
NP_442015.1_10 Forward -263 -250 -0.570702 0.272
NP_441226.1_7 Forward -71 -64 14.4934 0.0123
NP_441226.1_7 Reverse -64 -71 14.4934 0.0123
NP_441226.1_7 Forward -180 -173 11.5435 0.0757
NP_441111.1_7 Forward -71 -63 18.7023 0.00294
NP_441111.1_7 Reverse -64 -72 18.7023 0.00294
NP_441111.1_7 Reverse -173 -181 -0.570565 0.233
NP_442379.1_10 Forward -79 -62 -1.14113 0.223
NP_441766.1_2 Forward -72 -63 17.5026 0.00297
NP_441766.1_2 Reverse -63 -72 17.5026 0.00297
NP_441766.1_2 Forward -181 -172 4.81794 0.158
NP_440416.1_9 Forward -188 -169 -19.2734 0.272
NP_440416.1_9 Forward -277 -258 -20.1584 0.282
NP_442154.1_6 Reverse -165 -184 2.94938 0.234
NP_440261.1_5 Forward -71 -58 3.26421 0.0649
NP_440261.1_5 Reverse -64 -77 -12.4687 0.297
NP_440988.1_7 Forward -288 -269 -3.83545 0.296
NP_440988.1_10 Forward -74 -60 16.9036 0.112
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

TTTGGAGTGGCCGCAGCGGATGCCTATCACCGCCTTTTATTAGATTGTATGTTGGGAGACCAAACCCTGTTCACAAGAGCCGACGAGGTAGAAGAAGCTTGGCGAGTAGTAACTCCGGTGTTGTCGGCTTGGGATGCCCCCAGTGATCCTCTTTCCATGCCCTTGTACGAAGCTGGAACCTGGGAACCAGCGGAGGCAGAATGGTTAATTAATAAAGATGGCCGTCGCTGGCGCCGACTTTAGACTGCAACGGTCATCGAAAGCGATCAAAAAAATCTGTATCAATTTCGTAAACTGTTCTGGGTTTTAAGCCTATTTCTAAGTAAATGGCGATCGCCAGCCAAGATTAGCAAAGACAGTTTAAAATCGTGAAGAAAAGTTAAGAGCCTTGTCTCCCCCT

CDS

ATGCCCGAACAAAATAGCATCCGTATTCGAGGCGCTAGACAACATAACCTAAAAAATGTGAATCTAGACCTGCCCCGCGATCGCCTGATTGTGTTTACGGGGGTGTCGGGGTCAGGCAAATCTTCCCTAGCTTTTGACACTATCTTTGCAGAGGGACAACGGCGTTATGTGGAATCCCTCAGTGCTTACGCCCGACAGTTTTTGGGGCAGTTGGATAAGCCTGATGTGGACAGCATCGAAGGGTTGAGTCCGGCTATTTCCATCGATCAGAAATCCACTTCCCACAATCCCCGCTCCACCGTGGGTACGGTAACGGAAATTTACGACTACCTCCGTCTGTTATTTGGCAGGGCTGGCAGTCCCCATTGTCCCCACTGCCAACGGAATATTGCCCCCCAAACCATTGACCAAATGTGTGATCGGGTGATGGAGTTACCGGACAGAACTAAGTTTCAAATTCTTGCTCCGGTGGTAAAGGGCAAAAAAGGGACCCATGTGCAACTACTTTCTAGCTTAGTTTCCCAAGGCTTTGTGCGGGTAAGAATTAACGGCGAAGTGCGAGAATTAAGTGACAATATTGAATTAAAAAAGAACCAAGCCCACACCATTGAAATAGTTATTGATCGCCTGATCAAAAAAGAAGGTTTACAGGAACGATTGGTAGACTCACTCAGTACTTGTTTGAAGCAAGCAGAAGGCACCGCCATTATTGACATTTTGGACAAGCCAACGCTGGCAGTGTTAGATGGAGGTAAAAAAGACGACAAAGAAGCATTAAAAGCGGCAGAAAACGGCCAGGCTTACCATGCAGAGTTACCCAAGGAAATTATCTTTTCAGAAAACTTTGCCTGTCCAGAACATGGGGCGGTGATGGATGAACTTTCCCCCCGCTTATTTTCTTTCAACTCCCCCTACGGTGCTTGTCCCGATTGCCATGGAATTGGCTTTGTGCGGTCTTTTTGCCCAGATTTGGTCATTCCTGATCCCGAAAAACCAGTGTATGTGGCGATCGCCCCCTGGTCAGAAAAAGATAATTCCTATTACTTGTCGTTACTGTACAGTTTAGGACAGCATTTTGATTTTCAGTTACAAACTCCCTGGAAAAAGCTAACCAAAGAGCAAAAGGAAATAATTTTATACGGCACAGAAGAAGAAATTTGGTTTGAAGGGGAATCCCGTTACCGCAATAAACAAGGTTATTATCGTCGTTTTGCTGGAGCATTAAATATCCTGCAAAAAAATTATGATGAAACCAATTCCGATGCCATTAAGCAAAAGTTAGAAAAATATATTATTAATCAACCCTGTCACACCTGTGGCGGCAAAAGGTTAAAGCCAGAAGCATTAGCAGTAAAACTAGGGCAGTACAACATTAACAATTTAACCAGTGTGCCCATCCGCCAGACCCTGGAACGGATTGAAAATCTAGAGTTGACTTCCCGGCAAGCCATGATTGGGGAATTGGCGTTAAAGGAAATCAAAGCCCGTTTGCAATTTCTCCTGGACGTAGGTTTGGATTATCTGACCCTCGACCGGGCCGCCATGACTCTATCTGGCGGAGAAGCCCAACGGATTCGCCTGGCCACCCAAATTGGTTCCGGTCTCACCGGAGTTTTATACGTTTTGGATGAACCAAGCATTGGTTTGCATCAACGGGACAACAATCGCCTGTTGGCCACTCTGACTAAGTTAAGGGATCTGGGCAATACGTTAATTGTGGTGGAGCATGATGAAGATACTATCCGCCACGCCGATTATATTGTTGACATTGGTCCGAAGGCGGGCATCCATGGTGGAGAAATTGTCTGTCAGGGGGATTTTCAGACTCTACTAAAAAATCAAAGGTCTCTTACTGGGGCTTACCTATCCGGTCGGGAGGCGATCGCCACTCCGGAGGAACGGAGAAATGGCAACGGAGCCAAGTTAACCCTCCAAGGTTGTTGCCATAATAATTTGCGTAATATTGATGTGACCATTCCCCTGGGCAAACTGGTGTGTGTTACAGGGGTATCCGGTTCCGGCAAGTCCACCCTAGTCAATGAATTGCTCCATCCGGCTCTGCAACATTATCTTTCTCGCCAAGTAGCTTTTCCCAAGAATTTAGGGGAAATCACCGGCCTCCAGGCGATCGATAAAGTCATTGTCATTGACCAATCCCCCATTGGCCGCACTCCCCGCTCCAACCCCGCCACCTATACAGGTATTTTTGACTCCATTCGAGAAATTTTCACCCAAACCATTGAAGCTAAAGCTAGGGGTTATAAGCCGGGACAATTTTCTTTCAACGTCAAAGGGGGACGCTGTGAAGCCTGCGCTGGTCAGGGAGTTAACGTGATTGAAATGAATTTTTTGCCCGATGTGTATGTGCAATGTGATGTGTGCAAAGGAGCCAGATATAACCGGGAAACGTTGCAGGTGAAGTATAAAGGTCATTCCATTGCCGATGTGTTGGCCATGACCACCGAGGAAGCCCTGACAGTGTTTGAGAATATTCCCAGGGCAGTAAATCGCCTGCAAACCTTGGTAGATGTGGGTTTGGGTTACATCAAACTGGGTCAACCGGCCCCCACTTTATCCGGGGGAGAAGCCCAACGGGTCAAACTAGCTTCCGAGTTATCTCGCCGGGCCACGGGCAAAACTTTGTATTTAATTGATGAACCCACCACCGGGCTATCTTTTTATGATGTCCACCATTTGCTCAACGTTTTGCAAAGACTAGTGGATAAAGGCAATTCTGTTTTAGTCATTGAACATAACCTGGATGTAATCCGCTGTAGCGATTGGATTATTGATCTGGGCCCCGAAGGTGGCGATCGGGGTGGAAAAATTATGGTTGCAGGAACCCCGGAAACAGTGGCGCAACATCCAAGTTCTTACACAGGGAAATATTTAGCGAAGGTATTGCAATCTTAA

Protein

MPEQNSIRIRGARQHNLKNVNLDLPRDRLIVFTGVSGSGKSSLAFDTIFAEGQRRYVESLSAYARQFLGQLDKPDVDSIEGLSPAISIDQKSTSHNPRSTVGTVTEIYDYLRLLFGRAGSPHCPHCQRNIAPQTIDQMCDRVMELPDRTKFQILAPVVKGKKGTHVQLLSSLVSQGFVRVRINGEVRELSDNIELKKNQAHTIEIVIDRLIKKEGLQERLVDSLSTCLKQAEGTAIIDILDKPTLAVLDGGKKDDKEALKAAENGQAYHAELPKEIIFSENFACPEHGAVMDELSPRLFSFNSPYGACPDCHGIGFVRSFCPDLVIPDPEKPVYVAIAPWSEKDNSYYLSLLYSLGQHFDFQLQTPWKKLTKEQKEIILYGTEEEIWFEGESRYRNKQGYYRRFAGALNILQKNYDETNSDAIKQKLEKYIINQPCHTCGGKRLKPEALAVKLGQYNINNLTSVPIRQTLERIENLELTSRQAMIGELALKEIKARLQFLLDVGLDYLTLDRAAMTLSGGEAQRIRLATQIGSGLTGVLYVLDEPSIGLHQRDNNRLLATLTKLRDLGNTLIVVEHDEDTIRHADYIVDIGPKAGIHGGEIVCQGDFQTLLKNQRSLTGAYLSGREAIATPEERRNGNGAKLTLQGCCHNNLRNIDVTIPLGKLVCVTGVSGSGKSTLVNELLHPALQHYLSRQVAFPKNLGEITGLQAIDKVIVIDQSPIGRTPRSNPATYTGIFDSIREIFTQTIEAKARGYKPGQFSFNVKGGRCEACAGQGVNVIEMNFLPDVYVQCDVCKGARYNRETLQVKYKGHSIADVLAMTTEEALTVFENIPRAVNRLQTLVDVGLGYIKLGQPAPTLSGGEAQRVKLASELSRRATGKTLYLIDEPTTGLSFYDVHHLLNVLQRLVDKGNSVLVIEHNLDVIRCSDWIIDLGPEGGDRGGKIMVAGTPETVAQHPSSYTGKYLAKVLQS