Your browser is old and dusty. Try Google Chrome!

Details for slr1689

ORF slr1689
Accession NP_441704.1
Symbol fpg
Category formamidopyrimidine-DNA glycosylase
Definition DNA replication, restriction, modification, recombination, and repair
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_440815.1_2 Reverse -322 -336 14.7486 0.234
NP_441480.1_1 Forward -341 -322 0.982764 0.287
NP_440897.1_6 Forward -388 -369 -3.93454 0.259
NP_441818.1_1 Forward -288 -277 8.51463 0.288
NP_441818.1_9 Forward -347 -328 -5.40875 0.253
NP_441818.1_9 Reverse -80 -99 -11.0136 0.3
NP_442169.1_1 Forward -194 -175 3.83436 0.26
NP_440150.1_2 Reverse -132 -151 6.09517 0.261
NP_442752.1_4 Forward -393 -386 9.47889 0.109
NP_442975.1_10 Reverse -290 -304 6.19383 0.188
NP_441250.1_3 Forward -44 -25 4.62101 0.249
NP_440061.1_9 Forward -330 -316 8.25877 0.177
NP_440631.1_9 Reverse -62 -81 13.7264 0.262
NP_441499.1_1 Forward -275 -256 15.6341 0.158
NP_440761.1_4 Forward -234 -215 -12.2919 0.241
NP_441900.1_2 Reverse -375 -393 1.5917 0.25
NP_441900.1_2 Reverse -43 -61 -6.17641 0.293
NP_440908.1_4 Forward -61 -42 17.8957 0.187
NP_439918.1_2 Forward -345 -326 0.982764 0.217
NP_441352.1_2 Forward -392 -373 0.0977854 0.276
NP_441208.1_9 Forward -342 -328 5.99778 0.254
NP_440518.1_7 Reverse -96 -115 18.9765 0.187
NP_441925.1_4 Reverse -376 -395 -14.3576 0.262
NP_441925.1_4 Reverse -379 -398 -15.2425 0.263
NP_441925.1_4 Reverse -375 -394 -15.8325 0.274
NP_441925.1_4 Reverse -183 -202 -16.0292 0.278
NP_441738.1_2 Forward -287 -280 8.1019 0.204
NP_442889.1_1 Reverse -312 -331 -11.9969 0.218
NP_441713.1_1 Forward -101 -82 -16.6185 0.285
NP_442570.1_3 Forward -342 -323 -5.40875 0.243
NP_442570.1_6 Forward -318 -299 17.8957 0.0757
NP_441716.1_1 Forward -152 -138 8.06273 0.152
NP_442111.1_4 Reverse -129 -143 4.22782 0.216
NP_440842.1_5 Reverse -326 -345 14.6176 0.269
NP_440842.1_5 Reverse -319 -338 14.5204 0.269
NP_440842.1_5 Reverse -336 -355 12.7713 0.283
NP_440842.1_10 Reverse -132 -146 2.35953 0.274
NP_442848.1_5 Reverse -323 -341 1.59244 0.276
NP_442687.1_7 Forward -96 -86 5.38824 0.206
NP_442485.1_3 Forward -357 -338 -3.63879 0.277
NP_441846.1_10 Forward -394 -375 -11.3086 0.19
NP_441846.1_10 Forward -397 -378 -21.535 0.256
NP_441846.1_10 Forward -400 -381 -21.7317 0.256
NP_441682.1_6 Forward -210 -191 11.9958 0.291
NP_441422.1_7 Reverse -128 -145 -4.48438 0.245
NP_441763.1_10 Forward -55 -36 5.80018 0.284
NP_441763.1_10 Reverse -342 -361 5.11187 0.294
NP_441127.1_1 Forward -53 -39 7.76774 0.3
NP_440203.1_1 Reverse -324 -343 17.0107 0.27
NP_442911.1_2 Forward -149 -130 -9.53865 0.258
NP_441099.1_3 Forward -338 -319 -4.13045 0.299
NP_442002.1_1 Forward -396 -378 -3.12744 0.209
NP_441646.1_1 Forward -340 -321 -1.86883 0.296
NP_441646.1_7 Forward -344 -330 18.3875 0.133
NP_442431.1_10 Forward -344 -326 10.3439 0.12
NP_442431.1_10 Forward -205 -187 8.47561 0.148
NP_442431.1_10 Forward -202 -184 0.117479 0.281
NP_441000.1_6 Reverse -142 -156 -4.91696 0.254
NP_442771.1_1 Reverse -31 -49 -10.9939 0.294
NP_440465.1_10 Forward -394 -375 4.22769 0.232
NP_439966.1_7 Reverse -382 -392 5.38779 0.226
NP_440260.1_8 Reverse -163 -181 -6.66736 0.294
NP_441079.1_4 Forward -343 -324 16.4667 0.219
NP_439983.1_1 Reverse -382 -400 9.85146 0.289
NP_442068.1_8 Reverse -42 -61 18.1907 0.0791
NP_442215.1_2 Reverse -84 -100 -6.62797 0.277
NP_442247.1_8 Reverse -43 -57 7.86607 0.292
NP_440929.1_8 Reverse -45 -54 3.53964 0.225
NP_441523.1_6 Forward -99 -80 6.09597 0.22
NP_442271.1_5 Forward -347 -328 17.3057 0.173
NP_441448.1_1 Forward -202 -183 3.24438 0.299
NP_439939.1_1 Reverse -43 -62 12.3883 0.278
NP_441015.1_8 Reverse -318 -337 -0.39387 0.292
NP_441015.1_10 Forward -398 -379 -11.2103 0.292
NP_441637.1_9 Reverse -78 -96 -1.45582 0.292
NP_442559.1_7 Reverse -137 -156 19.5673 0.162
NP_442227.1_2 Reverse -380 -399 8.65258 0.171
NP_442227.1_2 Reverse -377 -396 6.4893 0.198
NP_442427.1_8 Forward -298 -279 4.916 0.288
NP_442808.1_1 Reverse -317 -327 1.5529 0.282
NP_442542.1_2 Forward -193 -180 10.344 0.126
NP_442050.1_1 Forward -394 -375 7.27595 0.274
NP_440342.1_1 Forward -395 -376 11.2092 0.279
NP_441557.1_8 Reverse -385 -395 11.8776 0.236
NP_441433.1_8 Forward -35 -16 2.0644 0.228
NP_442777.1_3 Reverse -377 -395 9.55647 0.158
NP_440101.1_3 Forward -398 -379 1.47442 0.274
NP_440547.1_1 Forward -126 -107 10.1267 0.237
NP_441633.1_3 Reverse -84 -97 -3.52063 0.177
NP_441633.1_3 Reverse -374 -387 -4.20895 0.185
NP_442590.1_9 Forward -113 -94 3.44104 0.287
NP_442998.1_5 Reverse -287 -297 8.04317 0.274
NP_441799.1_1 Forward -293 -279 5.40719 0.21
NP_441007.1_10 Forward -196 -183 -0.570702 0.287
NP_441559.1_8 Reverse -314 -328 -4.22864 0.219
NP_441559.1_8 Forward -333 -319 -6.78525 0.279
NP_441296.1_9 Reverse -379 -392 15.555 0.18
NP_440717.1_3 Reverse -381 -395 18.8785 0.156
NP_441866.1_6 Reverse -39 -58 9.24175 0.248
NP_441704.1_1 Forward -157 -138 32.3503 0.0000181
NP_441704.1_2 Forward -97 -78 28.9078 0.000755
NP_441704.1_3 Forward -223 -204 32.6453 0.0000384
NP_441704.1_4 Forward -193 -174 27.5321 0.00138
NP_441704.1_5 Forward -136 -117 26.3522 0.00472
NP_441704.1_6 Forward -247 -228 29.9904 0.000125
NP_441704.1_7 Forward -77 -58 22.2223 0.0743
NP_441704.1_9 Forward -115 -101 20.5508 0.079
NP_441464.1_10 Forward -337 -323 8.65272 0.275
NP_439976.1_4 Reverse -41 -60 9.24175 0.278
NP_442240.1_1 Reverse -298 -317 7.17681 0.253
NP_440586.1_1 Forward -336 -317 -4.32711 0.278
NP_440192.1_4 Reverse -98 -117 9.88271 0.26
NP_440192.1_4 Forward -365 -346 9.20356 0.279
NP_440192.1_5 Forward -346 -327 10.5209 0.172
NP_439996.1_6 Forward -346 -327 7.52459 0.257
NP_439937.1_9 Reverse -99 -116 -14.5148 0.287
NP_439937.1_9 Forward -87 -70 -16.4814 0.287
NP_443039.1_7 Reverse -54 -68 7.47213 0.19
NP_442239.1_8 Reverse -109 -128 8.25926 0.249
NP_441803.1_2 Forward -262 -243 4.22769 0.18
NP_442887.1_5 Forward -90 -71 -10.0303 0.264
NP_441689.1_4 Reverse -2 -21 11.5064 0.268
NP_440350.1_5 Reverse -370 -389 -3.73712 0.266
NP_441592.1_4 Reverse -378 -397 -2.36049 0.262
NP_441592.1_4 Forward -393 -374 -2.55715 0.265
NP_441896.1_3 Forward -63 -44 2.75272 0.186
NP_441103.1_9 Reverse -380 -390 12.2942 0.299
NP_440575.1_1 Reverse -78 -97 -2.95123 0.294
NP_441178.1_6 Reverse -375 -394 3.14526 0.269
NP_442315.1_3 Forward -88 -69 7.7676 0.23
NP_440071.1_6 Forward -398 -384 13.7079 0.261
NP_443062.1_6 Reverse -78 -97 4.12936 0.221
NP_440939.1_5 Forward -365 -349 13.1366 0.204
NP_440544.1_5 Reverse -169 -176 14.5681 0.264
NP_440673.1_3 Forward -189 -182 8.59391 0.213
NP_441884.1_9 Forward -169 -150 -18.9784 0.143
NP_441004.1_1 Forward -344 -325 -8.65367 0.201
NP_442873.1_2 Reverse -316 -335 11.995 0.224
NP_442873.1_5 Reverse -93 -112 7.57013 0.276
NP_440296.1_10 Forward -396 -377 -13.2752 0.269
NP_440328.1_4 Reverse -116 -135 -1.08219 0.298
NP_442026.1_10 Reverse -363 -382 20.4523 0.069
NP_441542.1_4 Reverse -70 -84 5.1128 0.264
NP_441982.1_6 Forward -78 -69 10.5755 0.295
NP_442314.1_2 Forward -329 -310 2.45773 0.248
NP_442843.1_1 Forward -62 -43 -11.8003 0.293
NP_441477.1_5 Reverse -338 -357 5.70265 0.293
NP_441124.1_5 Forward -366 -356 10.1434 0.297
NP_440877.1_1 Reverse -324 -343 12.2908 0.223
NP_440588.1_2 Reverse -369 -388 -1.27885 0.155
NP_441031.1_8 Reverse -107 -126 -5.01543 0.268
NP_442006.1_3 Forward -399 -381 -6.66736 0.298
NP_441570.1_1 Forward -112 -94 -17.6804 0.287
NP_441732.1_7 Forward -48 -29 6.68596 0.298
NP_440321.1_1 Forward -394 -377 14.4935 0.27
NP_442815.1_1 Forward -61 -42 4.42435 0.288
NP_442797.1_1 Reverse -183 -202 -4.52377 0.286
NP_442797.1_6 Forward -344 -325 8.51591 0.265
NP_442797.1_7 Reverse -377 -395 0.805796 0.271
NP_442400.1_1 Reverse -154 -173 -6.1954 0.299
NP_442400.1_10 Forward -82 -69 7.51014 0.284
NP_440565.1_3 Reverse -373 -392 14.8062 0.257
NP_440860.1_10 Reverse -94 -113 11.9958 0.286
NP_441040.1_5 Reverse -314 -333 1.76941 0.299
NP_442346.1_1 Forward -62 -43 11.1109 0.27
NP_442346.1_5 Reverse -253 -263 9.12481 0.118
NP_441629.1_3 Reverse -323 -342 -4.42619 0.29
NP_440010.1_7 Forward -393 -374 18.1907 0.184
NP_442900.1_1 Forward -399 -380 -5.99873 0.238
NP_441888.1_4 Forward -134 -115 19.0757 0.0705
NP_441888.1_7 Forward -314 -300 2.06454 0.229
NP_441948.1_9 Reverse -145 -163 13.6872 0.249
NP_442073.1_6 Reverse -38 -57 -0.000545616 0.255
NP_442073.1_8 Reverse -289 -308 12.9783 0.197
NP_442723.1_1 Reverse -375 -394 7.17681 0.276
NP_441609.1_5 Forward -31 -12 8.45592 0.279
NP_440590.1_4 Forward -53 -40 -5.29059 0.277
NP_440400.1_1 Reverse -175 -194 -0.0996487 0.281
NP_442399.1_4 Reverse -332 -346 17.7213 0.271
NP_441541.1_1 Reverse -276 -294 5.25404 0.165
NP_441526.1_6 Forward -396 -377 6.88262 0.258
NP_441567.1_10 Reverse -58 -77 19.7631 0.164
NP_440675.1_1 Forward -342 -323 5.30933 0.223
NP_440462.1_6 Reverse -128 -138 2.14332 0.294
NP_442840.1_2 Reverse -88 -107 15.2408 0.033
NP_442402.1_2 Reverse -166 -180 12.487 0.271
NP_442402.1_4 Reverse -39 -58 -9.9327 0.295
NP_442258.1_3 Reverse -310 -329 4.03102 0.187
NP_440843.1_8 Forward -345 -326 12.5858 0.297
NP_441811.1_8 Forward -344 -330 7.86607 0.241
NP_441811.1_8 Forward -112 -98 7.17775 0.257
NP_440505.1_7 Reverse -255 -274 1.0811 0.25
NP_442360.1_1 Reverse -74 -92 13.9821 0.291
NP_441536.1_8 Forward -127 -108 16.6174 0.266
NP_441252.1_6 Reverse -71 -78 11.6422 0.288
NP_441252.1_6 Forward -57 -50 11.6422 0.288
NP_442533.1_1 Forward -400 -381 -6.58872 0.175
NP_442533.1_6 Reverse -254 -263 2.06468 0.275
NP_442322.1_4 Reverse -376 -393 -0.453507 0.219
NP_442322.1_4 Reverse -382 -399 -10.1882 0.298
NP_441347.1_5 Forward -334 -320 9.73373 0.269
NP_441106.1_1 Forward -51 -42 2.26134 0.293
NP_439903.1_6 Reverse -291 -310 2.26028 0.231
NP_442306.1_10 Reverse -40 -59 -21.4367 0.27
NP_442072.1_9 Forward -340 -322 -22.4986 0.241
NP_442401.1_2 Reverse -375 -394 6.88182 0.282
NP_441431.1_2 Reverse -42 -56 5.89884 0.284
NP_441993.1_1 Forward -332 -313 1.06957 0.285
NP_441993.1_1 Forward -344 -325 0.777198 0.292
NP_440467.1_8 Reverse -178 -197 15.5357 0.126
NP_442698.1_10 Forward -389 -370 3.44104 0.279
NP_440287.1_5 Reverse -379 -398 7.96345 0.286
NP_440293.1_3 Forward -335 -316 -6.09707 0.286
NP_441237.1_6 Forward -62 -45 3.97208 0.262
NP_441311.1_4 Reverse -294 -311 16.3618 0.163
NP_440457.1_1 Forward -398 -386 4.16888 0.171
NP_442940.1_2 Reverse -166 -185 -0.787193 0.296
NP_440801.1_9 Forward -335 -321 12.8353 0.286
NP_440942.1_6 Forward -325 -306 7.57013 0.257
NP_440142.1_7 Forward -393 -374 6.4893 0.259
NP_441332.1_6 Reverse -384 -394 12.3244 0.234
NP_440524.1_3 Forward -114 -95 9.43923 0.278
NP_440478.1_10 Reverse -39 -53 7.37441 0.262
NP_440649.2_8 Forward -397 -383 11.7993 0.252
NP_441756.1_5 Reverse -43 -62 3.53937 0.199
NP_441173.1_9 Forward -293 -285 11.8187 0.222
NP_441173.1_9 Reverse -171 -179 9.75379 0.284
NP_443000.1_3 Forward -393 -374 11.2316 0.255
NP_440275.1_3 Forward -141 -131 4.89658 0.169
NP_440679.1_10 Forward -209 -190 -14.7502 0.245
NP_440175.1_6 Reverse -305 -324 7.66927 0.286
NP_440149.1_1 Reverse -198 -217 14.8474 0.0335
NP_440149.1_2 Reverse -117 -136 19.9606 0.0395
NP_440149.1_4 Reverse -228 -247 11.1109 0.141
NP_440149.1_5 Reverse -138 -157 24.1889 0.00312
NP_440172.1_1 Forward -166 -156 2.63497 0.274
NP_442371.1_1 Forward -367 -357 12.2709 0.258
NP_442379.1_10 Reverse -157 -174 -1.53445 0.223
NP_440244.1_1 Forward -395 -376 -8.752 0.287
NP_440416.1_9 Forward -334 -315 -19.9617 0.281
NP_440416.1_9 Reverse -174 -193 -21.3384 0.294
NP_443052.1_9 Reverse -378 -397 -4.13045 0.254
NP_443052.1_9 Reverse -43 -62 -5.99873 0.276
NP_440072.1_5 Forward -396 -378 -0.570838 0.244
NP_442154.1_1 Forward -193 -175 -12.4689 0.217
NP_442154.1_1 Forward -201 -183 -17.7788 0.267
NP_442154.1_1 Forward -340 -322 -17.9754 0.273
NP_440988.1_10 Forward -249 -235 3.25301 0.298
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

AAGTCGGGGGGAGGGGGAGGACGCAGAATAAAGCTGGTAGAATTTGGCGTTAAGTGGGCTGGGTTGTTGCCTGGGGCTTCCTCGGGACACCAGCAAACGGGATAGTTTTTTACAAATCGCAATTATCTAAGGAATTAAATCATGGCCTTAAATCGTGGTGACAAAGTTAGAATCAAACGCACTGAGTCCTACTGGTACGGTGATGTTGGCACGGTTGCTAGTGTGGAGAAAAGCGGCATTCTCTATCCGGTGATTGTGCGCTTCGACCGGGTGAACTACAACGGTTTCAGCGGTAGTGCTTCCGGGGTAAACACCAACAACTTTGCCGAAAATGAATTGGAATTGGTGCAAGCGGCGGCAAAATAGTCTTGACTGTGGACTAAATTTGCATTGTTGAACT

CDS

GTGCCAGAACTACCAGAAGTTGAAACAGTATGCCGGGGGCTCAATCGTTTGACCCTGGAGCAGACCATCGGGGGAGGGGAAGTGTTGCTTGATCGCAGTCTTGCCTACCCCGTTTCTGTTGAGGATTTTCAGAAGCAAATTACCGGTTGTCGTTTGGTGGGCTGGCAACGGCGGGGAAAGTATTTGCTGGGGGAACTTAGAAGCAATCAAGCCCCAGGGCCGGCGGGATGGTTGGGATGCCATTTACGTATGACAGGGCAGTTACTCTGGACAGAACGGGATCAGCAGAGACCACGACACACTAGGGTGGTGCTCCACTTTGAGGGCGGGTGGGAGTTACGTTTTGTGGATACCCGCACCTTTGGCAAAGTCTGGCTCCTACCAGGCGATCGCCCTTGGGCTGAAGTAATGACGGGGCTGGGACAGTTGGGGCCAGAACCCTTTGGGGCGGATTTTACGGCGGAATATCTCTACGAAAAGCTGAAATCCAGTCGCCGCCCTTTAAAAAATGCCCTGCTGGATCAACGGTTGGTGGCAGGCTTGGGTAATATTTATGCCGATGAAGTCTTATTTTTTTGCGGCTTCCATCCCACCATGGCGAGTAATCAGGTGAGTTTGCAGGACTGTGAACTGATACATCAACAAATTCAAGCCACTTTAACAGCGGCCATTGAGGCTGGAGGCACTAGTTTCAGCGATTATCGCCAGGTGACTGGTATCAATGGTAATTATGGCGGTATGGCCCAGGTCTATGGTCGGGAAGGAGAACCCTGTCGTCATTGTGGTACAGTGATCGCCAAAATTAAATTGGGAGGGCGATCGGCCCACTTTTGTCCCCAGTGTCAGCCAAAATTAGAGCGGTGA

Protein

MPELPEVETVCRGLNRLTLEQTIGGGEVLLDRSLAYPVSVEDFQKQITGCRLVGWQRRGKYLLGELRSNQAPGPAGWLGCHLRMTGQLLWTERDQQRPRHTRVVLHFEGGWELRFVDTRTFGKVWLLPGDRPWAEVMTGLGQLGPEPFGADFTAEYLYEKLKSSRRPLKNALLDQRLVAGLGNIYADEVLFFCGFHPTMASNQVSLQDCELIHQQIQATLTAAIEAGGTSFSDYRQVTGINGNYGGMAQVYGREGEPCRHCGTVIAKIKLGGRSAHFCPQCQPKLER