Your browser is old and dusty. Try Google Chrome!

Details for slr1543

ORF slr1543
Accession NP_440787.1
Symbol
Category DNA-damage-inducible protein F
Definition DNA replication, restriction, modification, recombination, and repair
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_441453.1_4 Forward -372 -364 12.7041 0.0314
NP_441453.1_4 Reverse -384 -392 3.85433 0.284
NP_441960.1_3 Forward -139 -120 14.8467 0.237
NP_440226.1_1 Forward -372 -353 2.16274 0.276
NP_441630.1_3 Forward -187 -168 5.70265 0.136
NP_440996.1_5 Reverse -353 -362 14.7878 0.259
NP_442287.1_1 Reverse -313 -323 17.4824 0.085
NP_442752.1_4 Reverse -384 -391 5.25066 0.256
NP_443027.1_4 Reverse -382 -392 6.27322 0.286
NP_441250.1_3 Forward -234 -215 8.45592 0.199
NP_440061.1_3 Forward -394 -375 7.47261 0.293
NP_442405.1_3 Forward -242 -230 16.263 0.288
NP_440110.1_4 Forward -383 -364 6.88262 0.148
NP_439979.1_7 Reverse -150 -167 17.2468 0.215
NP_442062.1_8 Reverse -384 -394 12.4681 0.0316
NP_442062.1_8 Forward -151 -141 8.63316 0.0733
NP_442972.1_2 Forward -119 -105 13.2736 0.21
NP_442762.1_10 Reverse -245 -264 -11.0136 0.272
NP_441208.1_1 Forward -163 -144 -5.40875 0.281
NP_441208.1_9 Forward -375 -361 12.291 0.141
NP_441208.1_9 Forward -50 -36 7.47274 0.221
NP_441925.1_4 Reverse -364 -383 -15.0459 0.263
NP_441083.1_5 Reverse -363 -373 6.96153 0.0717
NP_441083.1_5 Forward -372 -362 0.275027 0.237
NP_442827.1_8 Reverse -355 -374 3.24359 0.149
NP_441149.1_9 Reverse -270 -289 -2.36125 0.3
NP_441434.1_1 Forward -241 -227 14.7174 0.233
NP_441434.1_3 Reverse -360 -379 5.211 0.194
NP_441434.1_6 Forward -246 -236 14.828 0.277
NP_441434.1_8 Reverse -222 -241 14.0745 0.149
NP_441571.1_8 Reverse -353 -372 -2.36049 0.255
NP_441558.1_5 Forward -374 -355 8.45592 0.15
NP_441955.1_8 Reverse -378 -395 11.5436 0.207
NP_441713.1_1 Reverse -135 -154 -9.44032 0.175
NP_441770.1_10 Reverse -369 -388 18.584 0.112
NP_442111.1_4 Forward -373 -359 6.3911 0.127
NP_441163.1_1 Reverse -134 -151 8.5929 0.229
NP_440747.1_10 Forward -396 -384 -12.2524 0.254
NP_441014.1_8 Reverse -371 -390 -8.06369 0.282
NP_441014.1_8 Reverse -372 -391 -9.44032 0.295
NP_441316.1_7 Forward -374 -359 2.04485 0.156
NP_441634.1_8 Forward -204 -190 -4.4253 0.295
NP_440376.1_1 Forward -372 -363 7.76787 0.0688
NP_440376.1_1 Reverse -363 -372 5.89959 0.116
NP_440376.1_1 Forward -323 -314 2.06468 0.236
NP_443065.1_6 Forward -397 -378 2.94938 0.221
NP_440266.1_6 Reverse -46 -65 10.815 0.27
NP_442687.1_7 Forward -373 -363 5.68323 0.189
NP_442687.1_7 Forward -111 -101 5.38824 0.206
NP_442687.1_7 Reverse -383 -393 4.20827 0.262
NP_441846.1_10 Forward -173 -154 -15.6352 0.254
NP_441846.1_10 Forward -391 -372 -22.42 0.259
NP_442530.1_2 Reverse -349 -359 15.5163 0.203
NP_442658.1_1 Reverse -140 -150 12.0743 0.0643
NP_442658.1_1 Forward -395 -385 11.091 0.0944
NP_440141.1_4 Forward -390 -371 -11.9969 0.298
NP_442782.1_2 Forward -141 -127 4.22782 0.256
NP_442782.1_2 Reverse -350 -364 1.67122 0.281
NP_442782.1_2 Forward -183 -169 0.786239 0.284
NP_442782.1_2 Forward -156 -142 0.0979218 0.296
NP_442205.1_9 Forward -157 -141 -3.8747 0.297
NP_441958.1_5 Reverse -362 -372 9.12481 0.025
NP_441958.1_5 Forward -373 -363 0.963343 0.12
NP_440203.1_5 Reverse -144 -154 9.12434 0.271
NP_440984.1_7 Forward -398 -384 6.09611 0.227
NP_442690.1_1 Reverse -223 -242 0.786102 0.118
NP_442690.1_1 Forward -244 -225 -16.1268 0.283
NP_442911.1_2 Reverse -353 -372 -6.29373 0.18
NP_441580.1_6 Reverse -373 -392 -8.752 0.271
NP_440153.1_8 Forward -193 -180 -3.4223 0.295
NP_443055.1_3 Reverse -133 -152 10.6451 0.284
NP_443055.1_6 Reverse -170 -188 0.510066 0.242
NP_443055.1_6 Reverse -122 -140 -2.24319 0.291
NP_440138.1_6 Forward -269 -250 3.63691 0.241
NP_442853.1_4 Forward -257 -238 14.2574 0.298
NP_441294.1_7 Forward -376 -362 11.3624 0.147
NP_441424.1_2 Forward -37 -18 19.1457 0.0522
NP_442885.1_4 Forward -357 -344 16.5079 0.217
NP_442771.1_1 Reverse -361 -379 -4.99573 0.166
NP_442771.1_1 Forward -158 -140 -6.76569 0.169
NP_441674.1_10 Reverse -370 -388 -0.472507 0.29
NP_440147.1_4 Reverse -361 -374 10.049 0.0355
NP_440147.1_4 Reverse -382 -395 2.2809 0.209
NP_441550.1_8 Forward -374 -364 9.12434 0.106
NP_441550.1_8 Reverse -361 -371 6.56775 0.201
NP_441916.1_7 Forward -393 -383 6.56821 0.0919
NP_441916.1_7 Forward -372 -362 6.27322 0.102
NP_440206.1_4 Forward -263 -244 0.981987 0.289
NP_440465.1_10 Forward -154 -135 3.93269 0.238
NP_441041.1_4 Reverse -52 -71 -10.6203 0.235
NP_441725.1_5 Reverse -364 -374 -0.609952 0.265
NP_439966.1_7 Reverse -382 -392 4.60114 0.265
NP_440736.1_3 Reverse -361 -380 7.17762 0.206
NP_442281.1_1 Forward -398 -384 13.077 0.031
NP_442281.1_1 Reverse -379 -393 3.04726 0.246
NP_441334.1_7 Reverse -361 -380 -13.8652 0.235
NP_440647.1_9 Forward -374 -356 2.37909 0.295
NP_442049.1_10 Reverse -376 -395 1.47442 0.289
NP_441556.1_7 Reverse -131 -150 -1.08295 0.3
NP_441196.1_2 Forward -258 -239 14.2574 0.0416
NP_441644.1_6 Forward -372 -362 9.51767 0.0747
NP_440929.1_8 Forward -372 -363 6.78456 0.082
NP_442933.1_1 Forward -226 -207 7.01823 0.257
NP_442933.1_10 Forward -393 -384 4.42462 0.246
NP_441751.2_8 Forward -371 -357 -6.78525 0.283
NP_442554.1_8 Reverse -364 -374 5.38824 0.15
NP_442554.1_8 Forward -392 -382 3.22496 0.235
NP_441762.1_7 Forward -394 -382 -5.66422 0.228
NP_442142.1_4 Reverse -381 -394 4.93527 0.206
NP_442142.1_4 Forward -256 -243 2.67367 0.281
NP_442476.1_1 Reverse -211 -230 13.4162 0.225
NP_442476.1_6 Reverse -385 -399 1.17956 0.228
NP_440421.1_1 Forward -210 -196 17.9942 0.122
NP_443009.1_5 Forward -152 -141 7.72798 0.122
NP_443009.1_5 Reverse -383 -394 6.74468 0.15
NP_442408.2_1 Reverse -315 -334 -2.95047 0.241
NP_441198.1_8 Forward -153 -143 11.5134 0.202
NP_441468.1_1 Forward -392 -385 3.97235 0.277
NP_441015.1_8 Forward -259 -240 4.81767 0.258
NP_441015.1_10 Forward -392 -373 -3.24547 0.186
NP_441673.1_1 Forward -372 -363 1.27803 0.155
NP_441673.1_1 Reverse -363 -372 1.27803 0.155
NP_441876.1_9 Reverse -151 -161 11.3859 0.275
NP_441826.1_2 Reverse -378 -392 5.21113 0.0978
NP_441826.1_5 Forward -392 -373 0.884433 0.298
NP_442745.1_5 Reverse -102 -121 12.1925 0.288
NP_441637.1_9 Reverse -268 -286 -2.14413 0.292
NP_441764.1_8 Forward -246 -236 11.0236 0.287
NP_442719.1_2 Reverse -226 -244 1.19838 0.162
NP_442719.1_2 Reverse -227 -245 -5.29143 0.218
NP_442719.1_2 Forward -229 -211 -9.81463 0.267
NP_442808.1_1 Forward -373 -363 7.74772 0.0697
NP_442808.1_1 Reverse -383 -393 3.51951 0.238
NP_442808.1_1 Reverse -313 -323 2.63453 0.26
NP_442739.1_2 Reverse -227 -246 12.2875 0.246
NP_440558.1_2 Forward -154 -135 3.73603 0.153
NP_440558.1_2 Reverse -138 -157 -5.9004 0.267
NP_440274.1_4 Forward -172 -154 2.37909 0.227
NP_442792.1_5 Reverse -221 -238 8.29864 0.296
NP_441878.1_6 Forward -373 -363 2.24165 0.0462
NP_441557.1_5 Forward -372 -363 0.393051 0.166
NP_441557.1_5 Reverse -363 -372 0.393051 0.166
NP_441557.1_5 Reverse -384 -393 -0.885252 0.26
NP_441445.1_7 Reverse -159 -178 9.73422 0.189
NP_440101.1_3 Forward -398 -379 7.7676 0.17
NP_441564.1_2 Reverse -62 -81 1.76941 0.188
NP_442135.1_3 Reverse -372 -391 5.99764 0.26
NP_442347.1_2 Forward -392 -383 4.62128 0.274
NP_442347.1_2 Forward -269 -260 3.83464 0.284
NP_442317.1_6 Reverse -358 -377 4.12936 0.247
NP_442590.1_10 Forward -393 -374 10.4225 0.181
NP_442998.1_5 Reverse -231 -241 8.4365 0.263
NP_442998.1_10 Forward -370 -363 12.5271 0.0457
NP_440899.1_8 Reverse -226 -245 -10.227 0.277
NP_441799.1_1 Forward -376 -362 3.73557 0.284
NP_441799.1_4 Forward -201 -182 -0.787193 0.203
NP_440256.1_1 Reverse -171 -190 -2.95047 0.125
NP_440256.1_1 Reverse -381 -400 -9.53865 0.281
NP_440256.1_1 Forward -396 -377 -10.0303 0.293
NP_440456.1_7 Reverse -164 -178 11.111 0.285
NP_441559.1_8 Forward -397 -383 -5.21195 0.254
NP_441559.1_8 Reverse -137 -151 -5.90027 0.271
NP_441559.1_8 Forward -398 -384 -6.39192 0.277
NP_441559.1_8 Reverse -96 -110 -7.76856 0.299
NP_440915.1_6 Reverse -359 -373 1.37622 0.141
NP_440915.1_6 Forward -397 -383 -2.45868 0.272
NP_441866.1_6 Forward -237 -218 7.96345 0.265
NP_440329.1_4 Forward -129 -115 15.2932 0.287
NP_440748.1_5 Forward -148 -129 8.06259 0.168
NP_440748.1_5 Reverse -124 -143 3.24438 0.21
NP_441464.1_8 Reverse -363 -377 6.6861 0.226
NP_440787.1_1 Forward -71 -52 27.7288 0.00227
NP_440787.1_2 Forward -176 -157 26.9421 0.00386
NP_440787.1_4 Forward -398 -384 25.4673 0.00885
NP_440787.1_5 Forward -242 -228 16.4209 0.185
NP_440787.1_7 Forward -362 -346 22.2813 0.109
NP_440695.1_6 Forward -244 -230 12.4475 0.26
NP_441494.1_6 Forward -156 -143 7.09911 0.267
NP_442993.1_1 Reverse -94 -110 -10.0696 0.206
NP_442993.1_1 Reverse -142 -158 -11.7412 0.257
NP_442386.1_9 Reverse -383 -392 12.684 0.0544
NP_442386.1_9 Forward -394 -385 11.8973 0.0799
NP_442386.1_9 Reverse -313 -322 9.5374 0.159
NP_442386.1_9 Reverse -141 -150 7.17747 0.219
NP_441750.1_1 Forward -301 -282 -12.9802 0.3
NP_441340.1_5 Reverse -364 -371 3.97235 0.274
NP_441340.1_9 Forward -246 -236 9.60492 0.236
NP_440586.1_1 Forward -61 -42 -5.70374 0.288
NP_440586.1_8 Forward -252 -245 7.02027 0.279
NP_442959.1_5 Forward -88 -69 5.11266 0.289
NP_440027.1_8 Forward -50 -31 4.03023 0.294
NP_443051.1_1 Reverse -362 -371 6.78456 0.071
NP_441232.1_10 Forward -383 -364 0.58944 0.296
NP_439937.1_8 Reverse -128 -147 -1.7705 0.249
NP_439937.1_9 Forward -152 -135 -11.2699 0.248
NP_440439.1_1 Reverse -381 -394 2.08423 0.138
NP_440439.1_1 Reverse -360 -373 0.117615 0.202
NP_440439.1_1 Forward -375 -362 -1.35735 0.263
NP_440378.1_6 Reverse -169 -188 17.699 0.168
NP_439977.1_5 Forward -78 -59 -2.95047 0.293
NP_442384.1_10 Forward -393 -380 8.57408 0.0641
NP_442384.1_10 Forward -110 -97 1.10092 0.268
NP_441877.1_5 Forward -244 -225 4.52268 0.211
NP_441877.1_5 Forward -60 -41 0.294447 0.276
NP_442262.1_10 Forward -371 -364 9.47889 0.187
NP_442165.1_3 Reverse -327 -341 15.9588 0.28
NP_440344.1_10 Forward -330 -313 -11.3676 0.212
NP_440531.1_6 Forward -331 -312 -1.7705 0.239
NP_441060.1_3 Forward -330 -311 13.0775 0.184
NP_442641.1_1 Forward -398 -379 -16.2252 0.217
NP_441965.1_10 Reverse -381 -397 12.7432 0.105
NP_442750.1_6 Reverse -254 -273 16.4207 0.285
NP_440297.1_9 Forward -71 -61 -0.314959 0.282
NP_442280.1_3 Forward -187 -168 18.0924 0.183
NP_442280.1_10 Reverse -150 -168 5.94143 0.28
NP_440888.1_2 Forward -151 -137 9.04542 0.139
NP_440888.1_2 Forward -393 -379 6.19383 0.243
NP_440888.1_2 Reverse -384 -398 5.70218 0.267
NP_440888.1_2 Forward -47 -33 5.60385 0.272
NP_440888.1_2 Reverse -371 -385 5.01387 0.298
NP_442845.1_2 Reverse -357 -371 5.30946 0.237
NP_442845.1_2 Forward -157 -143 5.1128 0.243
NP_441918.1_7 Forward -67 -48 -2.26216 0.297
NP_440982.1_1 Reverse -372 -391 7.07848 0.294
NP_441469.1_8 Reverse -141 -150 12.1928 0.123
NP_441469.1_8 Forward -394 -385 6.68623 0.227
NP_441469.1_8 Reverse -383 -392 5.50626 0.265
NP_440071.1_5 Forward -262 -243 7.27595 0.288
NP_440071.1_6 Forward -161 -147 14.6775 0.241
NP_441462.1_2 Reverse -363 -373 8.53483 0.0354
NP_441462.1_2 Forward -372 -362 0.668351 0.135
NP_441621.1_7 Forward -374 -360 0.786239 0.151
NP_443062.1_1 Forward -393 -375 16.7365 0.0296
NP_443062.1_1 Reverse -244 -262 10.5936 0.114
NP_441601.1_4 Reverse -376 -395 -3.44213 0.293
NP_442537.1_3 Reverse -150 -169 11.6025 0.28
NP_440516.1_8 Reverse -363 -372 7.07956 0.0867
NP_440516.1_8 Forward -372 -363 5.11294 0.118
NP_442428.1_5 Forward -392 -385 10.6589 0.0727
NP_442428.1_8 Reverse -380 -399 1.47442 0.228
NP_441443.1_1 Forward -376 -357 0.884433 0.22
NP_440673.1_7 Reverse -373 -392 4.42435 0.185
NP_442219.1_8 Reverse -47 -66 7.49067 0.267
NP_440436.1_4 Reverse -175 -184 7.76745 0.124
NP_440436.1_4 Forward -392 -383 5.70251 0.186
NP_440436.1_4 Reverse -385 -394 4.22755 0.277
NP_440314.1_9 Forward -371 -352 -4.52377 0.209
NP_441034.1_4 Forward -156 -137 15.2294 0.235
NP_440129.1_9 Forward -168 -149 11.9958 0.124
NP_441115.1_4 Forward -394 -376 8.17984 0.257
NP_440328.1_4 Reverse -378 -397 5.40766 0.148
NP_441851.1_9 Reverse -54 -73 10.3242 0.239
NP_441851.1_10 Reverse -383 -393 6.07655 0.187
NP_441851.1_10 Forward -318 -308 5.5849 0.207
NP_441851.1_10 Reverse -141 -151 4.10993 0.287
NP_440682.1_2 Forward -144 -125 -7.08038 0.103
NP_442515.1_1 Forward -373 -359 5.21113 0.107
NP_440463.1_7 Reverse -167 -181 14.5526 0.296
NP_441046.1_2 Forward -234 -215 -1.08219 0.288
NP_442689.1_8 Reverse -227 -244 8.98696 0.138
NP_441349.1_10 Reverse -357 -376 -3.24547 0.136
NP_442843.1_1 Forward -392 -373 -7.86702 0.252
NP_440474.1_8 Reverse -287 -301 4.71887 0.268
NP_441124.1_5 Reverse -231 -241 13.5811 0.215
NP_442006.1_3 Forward -387 -369 -4.30741 0.29
NP_440483.1_1 Forward -169 -150 -8.16202 0.282
NP_441078.1_4 Reverse -363 -372 8.35786 0.0338
NP_441078.1_4 Forward -372 -363 7.27622 0.0764
NP_441078.1_4 Forward -393 -384 5.11294 0.118
NP_440526.1_3 Reverse -148 -159 9.20294 0.0958
NP_441432.1_8 Reverse -362 -371 12.7828 0.0354
NP_441432.1_8 Forward -151 -142 2.65466 0.292
NP_442320.1_9 Forward -356 -342 21.2391 0.0889
NP_440503.1_8 Forward -324 -305 22.4189 0.0646
NP_442003.1_4 Forward -392 -373 16.6174 0.19
NP_440760.1_1 Forward -372 -353 -22.6167 0.263
NP_441057.1_3 Forward -139 -120 -13.0786 0.269
NP_442489.1_7 Forward -372 -363 1.27803 0.0935
NP_442489.1_7 Reverse -363 -372 0.589713 0.17
NP_442489.1_7 Forward -393 -384 -1.6719 0.235
NP_440559.1_1 Reverse -364 -373 4.91628 0.175
NP_442763.1_1 Forward -380 -361 8.35759 0.295
NP_441659.2_8 Forward -372 -362 8.04317 0.0508
NP_441659.2_8 Reverse -363 -373 0.275027 0.27
NP_441022.1_1 Reverse -352 -361 12.8891 0.222
NP_441022.1_1 Reverse -223 -232 12.8891 0.222
NP_441092.1_3 Forward -370 -351 1.96607 0.192
NP_441040.1_2 Forward -388 -369 -11.3086 0.255
NP_442346.1_10 Reverse -361 -380 -2.75381 0.294
NP_440545.1_3 Forward -376 -359 7.02034 0.0522
NP_441856.1_6 Reverse -383 -397 16.7159 0.226
NP_441923.1_6 Forward -98 -84 8.65272 0.278
NP_440004.1_8 Forward -150 -131 17.8948 0.115
NP_442551.1_4 Forward -375 -360 3.02816 0.245
NP_442875.1_8 Forward -241 -222 10.9142 0.258
NP_441585.1_5 Reverse -41 -60 0.392004 0.291
NP_441888.1_7 Reverse -379 -393 9.73436 0.137
NP_441948.1_4 Forward -400 -382 -3.02911 0.181
NP_442045.1_5 Reverse -375 -394 -2.0655 0.292
NP_441915.1_4 Reverse -370 -389 7.66846 0.293
NP_442140.1_3 Forward -392 -382 3.42162 0.297
NP_441609.1_1 Forward -241 -222 2.75272 0.189
NP_440875.1_9 Forward -391 -381 12.6548 0.106
NP_440875.1_9 Reverse -246 -256 8.5667 0.233
NP_441813.1_5 Reverse -382 -392 -0.118297 0.234
NP_440590.1_4 Forward -392 -379 2.18257 0.0972
NP_440567.1_1 Reverse -364 -378 -0.492064 0.287
NP_442497.1_10 Reverse -364 -373 0.29472 0.199
NP_440821.1_4 Forward -374 -364 -0.0199663 0.217
NP_441239.1_9 Reverse -382 -394 9.38042 0.108
NP_441239.1_9 Forward -395 -383 4.8572 0.239
NP_441239.1_9 Forward -374 -362 4.26721 0.256
NP_441239.1_9 Reverse -88 -100 3.67722 0.279
NP_441239.1_9 Forward -153 -141 3.57889 0.283
NP_441009.1_4 Forward -72 -53 16.7157 0.15
NP_440156.1_4 Forward -242 -232 15.5158 0.176
NP_440665.1_1 Reverse -169 -188 -15.6352 0.275
NP_442044.1_1 Forward -156 -137 -5.21209 0.187
NP_442105.1_9 Reverse -340 -354 13.8664 0.294
NP_441769.1_3 Forward -241 -222 -4.62285 0.245
NP_441617.1_6 Reverse -225 -244 -2.45882 0.258
NP_440546.1_4 Reverse -363 -373 10.6277 0.109
NP_440546.1_4 Reverse -384 -394 8.59164 0.181
NP_440546.1_4 Forward -372 -362 8.10685 0.203
NP_441656.1_6 Reverse -51 -70 11.7008 0.193
NP_440462.1_6 Reverse -382 -392 5.68323 0.145
NP_442899.1_4 Forward -243 -227 9.7926 0.232
NP_440374.1_1 Reverse -213 -232 9.53756 0.292
NP_442479.1_9 Forward -243 -224 0.786102 0.191
NP_442479.1_9 Reverse -224 -243 -7.17871 0.266
NP_442258.1_2 Forward -391 -372 4.52268 0.0976
NP_442258.1_2 Forward -384 -365 -2.85214 0.198
NP_441084.1_6 Forward -255 -241 10.7015 0.231
NP_440843.1_3 Forward -334 -315 11.4058 0.211
NP_440160.1_2 Forward -111 -92 -1.27885 0.235
NP_442053.1_1 Forward -372 -363 6.8829 0.111
NP_440505.1_3 Reverse -382 -392 5.78156 0.211
NP_440505.1_3 Reverse -361 -371 4.50326 0.284
NP_440520.1_1 Forward -173 -154 2.16274 0.208
NP_442532.1_4 Reverse -225 -243 7.77101 0.29
NP_440914.1_1 Reverse -286 -296 6.17532 0.293
NP_441011.1_8 Forward -392 -383 9.83282 0.117
NP_441011.1_8 Reverse -364 -373 8.06287 0.16
NP_442533.1_6 Forward -393 -384 5.80125 0.128
NP_442533.1_6 Reverse -384 -393 5.70292 0.132
NP_442533.1_6 Forward -372 -363 5.11294 0.155
NP_442533.1_6 Reverse -142 -151 4.91628 0.165
NP_442541.1_10 Reverse -371 -385 1.47397 0.286
NP_439944.1_9 Reverse -364 -374 5.38824 0.254
NP_441028.1_6 Reverse -239 -249 6.76441 0.23
NP_441680.1_4 Forward -395 -376 5.01433 0.198
NP_441680.1_4 Reverse -379 -398 3.34271 0.216
NP_441602.1_3 Reverse -358 -377 -5.9004 0.3
NP_441106.1_1 Forward -394 -385 4.32629 0.227
NP_439903.1_7 Reverse -375 -394 7.17762 0.281
NP_441286.1_1 Reverse -362 -374 -4.48425 0.161
NP_440670.1_8 Reverse -363 -372 8.25953 0.0703
NP_440670.1_8 Forward -372 -363 6.29291 0.124
NP_440886.1_7 Reverse -314 -324 9.02601 0.0805
NP_440886.1_7 Reverse -373 -383 4.89613 0.213
NP_440886.1_7 Forward -142 -132 3.91283 0.26
NP_442072.1_9 Forward -373 -355 -3.42244 0.0355
NP_441753.1_10 Forward -381 -362 3.53937 0.214
NP_440907.2_8 Forward -371 -361 7.64939 0.117
NP_440907.2_8 Reverse -364 -374 6.66608 0.157
NP_440907.2_8 Forward -75 -65 5.38779 0.203
NP_441463.1_6 Forward -153 -139 5.25632 0.297
NP_442365.1_5 Reverse -364 -383 13.0775 0.121
NP_440130.1_1 Forward -153 -134 17.109 0.123
NP_440387.1_1 Forward -372 -356 4.87675 0.0377
NP_440387.1_1 Reverse -184 -200 0.55019 0.124
NP_440387.1_1 Reverse -363 -379 -1.71142 0.143
NP_441431.1_2 Forward -375 -361 8.75042 0.207
NP_441431.1_2 Reverse -374 -388 6.0955 0.28
NP_441488.1_7 Reverse -357 -376 4.71934 0.181
NP_441174.1_2 Forward -154 -140 16.6175 0.0675
NP_440814.1_8 Forward -288 -269 -0.885524 0.291
NP_440114.1_10 Reverse -363 -377 10.816 0.134
NP_441425.1_4 Forward -247 -233 15.3392 0.282
NP_442323.1_7 Forward -364 -345 1.17865 0.289
NP_440287.1_6 Forward -56 -37 0.982764 0.286
NP_440293.1_3 Forward -389 -370 -5.50708 0.279
NP_440766.1_5 Forward -289 -277 6.70087 0.294
NP_439988.1_3 Forward -385 -371 7.37441 0.277
NP_439988.1_3 Reverse -156 -170 3.44117 0.299
NP_441237.1_9 Reverse -364 -374 12.5664 0.112
NP_440457.1_1 Forward -376 -364 0.23564 0.25
NP_440457.1_1 Reverse -59 -71 0.0389777 0.25
NP_440798.1_6 Reverse -364 -377 8.18076 0.128
NP_441984.1_1 Reverse -270 -288 5.32902 0.292
NP_441984.1_3 Reverse -367 -385 5.42735 0.286
NP_441436.1_8 Forward -381 -362 8.16093 0.283
NP_440734.1_8 Reverse -361 -380 13.3725 0.261
NP_440554.1_4 Reverse -385 -395 6.07655 0.128
NP_440554.1_4 Forward -371 -361 2.7333 0.254
NP_442862.1_3 Forward -240 -223 7.217 0.258
NP_441885.1_5 Reverse -363 -373 7.84651 0.0419
NP_441614.1_6 Forward -258 -239 15.0432 0.275
NP_442341.1_7 Forward -373 -359 2.35953 0.259
NP_442341.1_9 Reverse -375 -389 8.16044 0.178
NP_442369.1_6 Forward -123 -113 16.5414 0.127
NP_441756.1_5 Forward -397 -378 -2.0655 0.267
NP_441173.1_9 Forward -238 -230 12.1137 0.21
NP_440275.1_3 Reverse -361 -371 6.27322 0.118
NP_440275.1_3 Reverse -375 -385 2.14332 0.271
NP_443010.1_10 Reverse -360 -377 3.9304 0.246
NP_439962.1_4 Forward -172 -153 -8.35868 0.293
NP_441105.1_3 Reverse -373 -392 -1.37718 0.148
NP_440216.1_1 Forward -393 -379 -11.2101 0.169
NP_440216.1_1 Reverse -363 -377 -11.7018 0.212
NP_440216.1_1 Reverse -384 -398 -11.9968 0.236
NP_440172.1_1 Forward -372 -362 5.28991 0.146
NP_440172.1_1 Reverse -142 -152 4.60159 0.178
NP_440167.1_3 Forward -382 -363 14.6508 0.157
NP_441226.1_7 Reverse -315 -322 8.29857 0.205
NP_440244.1_8 Forward -234 -215 2.65439 0.27
NP_441766.1_2 Forward -372 -363 4.22796 0.193
NP_440416.1_9 Reverse -377 -396 -2.85214 0.0719
NP_440416.1_9 Forward -400 -381 -16.1268 0.208
NP_443052.1_9 Reverse -149 -168 -6.58872 0.285
NP_442116.1_6 Forward -242 -225 11.1292 0.21
NP_440591.1_9 Reverse -377 -395 7.39397 0.206
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

CCCTCCCAGCGATGCCCGGTGGCAGGGGGCCGATAGCCTCAAACTTTTGGCTCAGGTGCATCAATTAATCCTTGAACGGGGTTGGCGAATCAATAATCTGGATAATGTGATTGTGGCAGAACAACCCAAACTTAAACCCCACATCCAGGCCATGAAGGAAAATTTAGCCAAAGTTTTGACTATTGATCCAGATTTAATTGGCATTAAAGCTACCACCAACGAGCGTTTGGGCCCCACGGGAAGGGAGGAAGGCATTGCCGCCTACAGCGTGGCTTTGTTAATCAAAGAAGGGTAAACACCGGACCATGGGATAGAAGATTCTTGTCCTATCCATGCCACTGGTAAAGGTTGTTACGGTTTGCCTGTTGCAAAATGTGAGAAGAGCAGTCTAATCTGCCCT

CDS

GTGAATTTTGACCGCATTTTTGCTTGGCCGCTGACCAGTTTAGAAGTCTTTATGAATCTTGCCCTGCCTAGCCAGTATCAATTCTTACCCCGTTTTTTTCGCCTAGCCACCATTGCTGTCCTTTCCAATATGATGGTGCCCTTAGCTGGGTTAGTGGACACCGCTTTTTTGGGCCATCTAGAAGACATTGATTATTTAGCAGGGGTGATCCTCGGCTCGATTTTGTTTGATTACCTCTACCGGGTCCTAAAATTTTTACGCACCAGCACCACCGCTCTCACGGCCCAAGCTGTGGGGGAAGAAGACCAGGCGGAGGTATGGGTGGCGGGACTAAGAAGTGCCTTGGTAGCCCTATTGTTGGGTTTGGGCATTTTAGCCTTGCAATATCCCTTGCAAAAATTCGGTTTTGCCCTGTTAACTGGGGCTCCAGGGGTGGAGCAGTCGGGTATGGACTATTTTTACGGCCGGATTTGGGGGGCTCCGGCGGTGCTGCTCAATTTTGTCATCTTGGGCTGGCTATTGGGACAAGAACGCAATGGTTTAGTTTTGCTCATTTCCCTGGTGGCTAATTTTTCCAACGTTGGTCTGGACTATTTGATGATTAACCGTTGGGGGTGGGCTAGTGCGGGGGCCGGTTGGGCCACTGCCAGTAGTCAGTATTTAGCTCTGGCCCTAGGTTTGATCTCCATTGTGGTTCTAGCCCAAGGGGAAAAAGAGAAGGGAGAGTTTAAAGCGGCGATCGCCAAATTATCGGACTGGGGAGCGTTGCGGGCCACCATTGCTCTGAAAGGGAACATCTTGATCCGTTTTGTGATTTTAATCACCACCTATTCTTTGTTTACTAATATCAGTTCCAGCTTTGGCACGGAAGTCTTGGCCCAAAACGGTCTGCTGTTACAAATTGCCCTGCTTAGCCAATTCACCATCCAAGGGGTGGGCATGACCAGCCAAACCCTGACTGGTAATTTCAAGAGTAAAGGGGAATATCAATTGTTATTGCCGGTTTTACTCACCGCCATCGTCACCACCCTATTAATGGCCCTGGGCTTTGCCGCTGTGGCGATCGCCTTCCCCGAAACCCTATTCGGACTGTTAACCAACCATGCAGAAATCAACGACAGCGTCCGTCAATACACCATCTGGCTGATTCCCCTGTTGGAGAGCACCGCCCTGGCCTTTATGCTGGAAGCCTATTTCATCGGGCTTAAAGCGTCCCAACCCCTTAGGAACGGAGTGCTGTTTGCCTTCTTCGGGATCTATTTACCCTGCCTTGGGCTAGCCATCTGGCAACAGAGCAATAATCTGCTGTGGTTCTCCCTGGTCTCCTACATGTTGGGCCTAGTGGTTTATCTGGGCTGGCAATTACTTACCCGATTTTCACCGCAAACTCTAGCTCTGGAAAGCAAACAACCTAGCTAG

Protein

MNFDRIFAWPLTSLEVFMNLALPSQYQFLPRFFRLATIAVLSNMMVPLAGLVDTAFLGHLEDIDYLAGVILGSILFDYLYRVLKFLRTSTTALTAQAVGEEDQAEVWVAGLRSALVALLLGLGILALQYPLQKFGFALLTGAPGVEQSGMDYFYGRIWGAPAVLLNFVILGWLLGQERNGLVLLISLVANFSNVGLDYLMINRWGWASAGAGWATASSQYLALALGLISIVVLAQGEKEKGEFKAAIAKLSDWGALRATIALKGNILIRFVILITTYSLFTNISSSFGTEVLAQNGLLLQIALLSQFTIQGVGMTSQTLTGNFKSKGEYQLLLPVLLTAIVTTLLMALGFAAVAIAFPETLFGLLTNHAEINDSVRQYTIWLIPLLESTALAFMLEAYFIGLKASQPLRNGVLFAFFGIYLPCLGLAIWQQSNNLLWFSLVSYMLGLVVYLGWQLLTRFSPQTLALESKQPS