Your browser is old and dusty. Try Google Chrome!

Details for slr1540

ORF slr1540
Accession NP_440784.1
Symbol
Category Nucleoproteins
Definition mRNA-binding protein
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_442711.1_1 Reverse -236 -250 13.3726 0.175
NP_441061.1_2 Reverse -237 -251 2.35953 0.177
NP_441061.1_2 Reverse -162 -176 2.2612 0.178
NP_440795.1_7 Forward -169 -162 14.6904 0.0123
NP_440795.1_7 Reverse -162 -169 14.6904 0.0123
NP_440795.1_7 Forward -113 -106 7.51227 0.24
NP_441418.1_6 Reverse -236 -255 -29.3032 0.221
NP_441418.1_6 Forward -261 -242 -29.7948 0.238
NP_440815.1_5 Forward -170 -151 5.30933 0.286
NP_442291.1_5 Forward -171 -155 8.02334 0.0582
NP_442291.1_5 Reverse -235 -251 5.6634 0.0756
NP_442291.1_5 Reverse -160 -176 -1.51476 0.199
NP_440897.1_6 Forward -114 -95 15.7316 0.028
NP_440897.1_6 Reverse -161 -180 4.62021 0.134
NP_440897.1_6 Forward -245 -226 0.0970122 0.18
NP_441453.1_1 Reverse -288 -306 7.19654 0.216
NP_441453.1_4 Reverse -161 -169 16.539 0.00633
NP_441453.1_4 Forward -170 -162 16.539 0.00633
NP_441453.1_4 Forward -245 -237 7.09925 0.0962
NP_441453.1_4 Reverse -236 -244 6.80426 0.121
NP_441453.1_4 Forward -261 -253 4.34598 0.257
NP_441453.1_4 Reverse -123 -131 4.34598 0.257
NP_441453.1_4 Forward -132 -124 4.24765 0.259
NP_441453.1_7 Forward -285 -278 12.9205 0.23
NP_441623.1_1 Reverse -16 -34 -3.12744 0.256
NP_441623.1_1 Reverse -40 -58 -3.52077 0.262
NP_442151.1_6 Reverse -161 -175 14.6509 0.0321
NP_442151.1_6 Forward -170 -156 10.0294 0.133
NP_441818.1_1 Reverse -162 -173 18.446 0.0046
NP_441818.1_1 Forward -169 -158 9.79292 0.232
NP_441818.1_9 Reverse -322 -341 -10.0303 0.292
NP_440226.1_1 Reverse -161 -180 13.6675 0.0352
NP_440226.1_1 Forward -170 -151 5.211 0.163
NP_441465.1_8 Reverse -150 -168 15.8504 0.102
NP_441465.1_8 Reverse -225 -243 14.8671 0.139
NP_441630.1_3 Reverse -153 -172 8.55425 0.111
NP_440150.1_2 Forward -360 -341 5.70185 0.267
NP_442744.1_8 Reverse -236 -255 -5.11376 0.297
NP_442287.1_1 Reverse -104 -114 13.0576 0.288
NP_442173.1_1 Forward -169 -161 15.4574 0.00633
NP_442173.1_1 Reverse -162 -170 15.4574 0.00633
NP_442173.1_1 Reverse -237 -245 5.82095 0.2
NP_442173.1_1 Forward -244 -236 5.72262 0.203
NP_442752.1_4 Reverse -236 -243 13.8055 0.0199
NP_442752.1_4 Forward -170 -163 13.8055 0.0199
NP_442752.1_4 Reverse -161 -168 13.8055 0.0199
NP_442752.1_4 Forward -59 -52 6.52896 0.154
NP_442752.1_4 Reverse -365 -372 5.54565 0.194
NP_443027.1_4 Forward -172 -162 14.0414 0.0452
NP_443027.1_4 Reverse -234 -244 10.9931 0.109
NP_443027.1_4 Forward -263 -253 7.25653 0.24
NP_443027.1_4 Forward -134 -124 5.78156 0.298
NP_441812.1_3 Reverse -160 -174 9.83269 0.228
NP_441812.1_3 Reverse -166 -180 6.6861 0.298
NP_442975.1_10 Forward -174 -160 3.93223 0.249
NP_442975.1_10 Reverse -157 -171 1.76896 0.291
NP_441225.1_4 Reverse -297 -316 -5.01543 0.27
NP_440784.1_7 Forward -169 -162 15.9687 0.0123
NP_440784.1_7 Reverse -162 -169 15.9687 0.0123
NP_440784.1_7 Reverse -237 -244 6.23397 0.241
NP_440784.1_7 Forward -244 -237 6.13563 0.241
NP_442909.1_7 Reverse -162 -176 5.99717 0.258
NP_440061.1_9 Reverse -159 -173 12.9786 0.0878
NP_440061.1_9 Forward -172 -158 12.6836 0.0927
NP_440110.1_4 Reverse -150 -169 3.24438 0.23
NP_441054.1_4 Forward -180 -162 7.4923 0.0945
NP_442074.1_3 Forward -332 -319 20.6681 0.178
NP_442062.1_8 Forward -170 -160 17.3846 0.00193
NP_442062.1_8 Reverse -161 -171 17.3846 0.00193
NP_442062.1_8 Reverse -236 -246 16.9913 0.00317
NP_442062.1_8 Forward -245 -235 9.61647 0.0587
NP_442062.1_8 Forward -132 -122 6.56821 0.123
NP_440304.1_4 Forward -172 -162 10.8948 0.051
NP_440304.1_4 Reverse -159 -169 1.84832 0.299
NP_442242.1_4 Forward -169 -162 14.3954 0.0124
NP_442242.1_4 Reverse -162 -169 14.3954 0.0124
NP_442242.1_4 Forward -244 -237 10.8555 0.127
NP_441781.1_7 Forward -381 -362 5.80098 0.186
NP_441781.1_7 Reverse -245 -264 -0.295539 0.257
NP_441208.1_9 Reverse -158 -172 6.48943 0.244
NP_442110.1_7 Reverse -246 -260 7.27608 0.121
NP_442110.1_7 Reverse -161 -175 0.0979218 0.267
NP_442110.1_7 Forward -170 -156 -0.197071 0.276
NP_441083.1_5 Forward -170 -160 20.3345 0.00053
NP_441083.1_5 Reverse -161 -171 20.3345 0.00053
NP_441083.1_5 Forward -245 -235 2.04498 0.195
NP_441083.1_5 Reverse -236 -246 1.84832 0.198
NP_442827.1_8 Forward -161 -142 0.195343 0.214
NP_442827.1_8 Reverse -153 -172 -2.06626 0.267
NP_441434.1_3 Reverse -364 -383 -0.000545616 0.226
NP_441738.1_2 Forward -243 -236 15.28 0.0102
NP_441738.1_2 Forward -168 -161 15.28 0.0102
NP_441738.1_2 Reverse -163 -170 15.28 0.0102
NP_441558.1_5 Forward -263 -244 15.4374 0.0418
NP_441558.1_5 Forward -172 -153 12.5858 0.0675
NP_441558.1_5 Forward -134 -115 12.4875 0.0677
NP_440209.1_1 Reverse -161 -169 18.1123 0.00295
NP_440209.1_1 Forward -170 -162 18.1123 0.00295
NP_440209.1_1 Forward -245 -237 14.8674 0.012
NP_440209.1_1 Reverse -236 -244 8.57422 0.0425
NP_442889.1_8 Forward -173 -159 4.22722 0.27
NP_442889.1_8 Forward -248 -234 3.04726 0.291
NP_441713.1_1 Forward -176 -157 5.01433 0.0568
NP_441713.1_8 Forward -367 -349 10.0489 0.268
NP_440178.1_7 Forward -171 -152 -4.32711 0.0548
NP_440178.1_7 Reverse -160 -179 -12.6852 0.123
NP_440178.1_7 Reverse -245 -264 -13.4719 0.136
NP_441716.1_1 Reverse -161 -175 16.6175 0.0348
NP_441716.1_1 Forward -170 -156 7.07942 0.181
NP_442111.1_4 Forward -171 -157 8.06273 0.081
NP_442111.1_4 Reverse -235 -249 2.5562 0.271
NP_441624.1_7 Reverse -40 -54 9.5377 0.218
NP_440906.1_5 Forward -169 -162 15.8704 0.0124
NP_440906.1_5 Reverse -162 -169 15.8704 0.0124
NP_440906.1_5 Reverse -237 -244 6.23397 0.234
NP_440906.1_5 Forward -244 -237 6.13563 0.241
NP_440747.1_10 Reverse -158 -170 14.9853 0.00221
NP_440747.1_10 Forward -173 -161 7.51213 0.00286
NP_440747.1_10 Forward -248 -236 -2.51763 0.0509
NP_440747.1_10 Forward -258 -246 -11.3674 0.118
NP_440747.1_10 Reverse -233 -245 -11.7607 0.142
NP_441130.1_10 Reverse -234 -248 11.3077 0.107
NP_441130.1_10 Forward -172 -158 8.45605 0.135
NP_441486.1_1 Forward -173 -159 23.4024 0.00162
NP_441486.1_1 Reverse -158 -172 21.2391 0.00239
NP_441486.1_1 Reverse -233 -247 2.2612 0.0868
NP_441486.1_1 Forward -248 -234 0.491246 0.134
NP_440403.1_4 Forward -254 -235 1.86774 0.131
NP_440403.1_4 Reverse -237 -256 -9.34199 0.274
NP_440842.1_10 Forward -352 -338 3.63784 0.255
NP_441014.1_10 Reverse -104 -123 0.490334 0.243
NP_441014.1_10 Reverse -49 -68 -0.591301 0.252
NP_442848.1_1 Forward -176 -162 -1.18038 0.263
NP_442848.1_1 Reverse -155 -169 -2.45868 0.263
NP_442848.1_4 Reverse -338 -352 11.701 0.267
NP_442848.1_9 Forward -260 -241 2.85105 0.248
NP_443018.1_3 Forward -169 -162 14.8871 0.0123
NP_443018.1_3 Reverse -162 -169 14.8871 0.0123
NP_443018.1_3 Reverse -237 -244 12.6255 0.0471
NP_443018.1_3 Forward -260 -253 12.5271 0.0523
NP_443018.1_3 Forward -131 -124 12.5271 0.0523
NP_443018.1_3 Reverse -253 -260 12.5271 0.0523
NP_443018.1_3 Reverse -124 -131 12.5271 0.0523
NP_443018.1_3 Forward -244 -237 5.25066 0.214
NP_441634.1_8 Forward -172 -158 2.94952 0.158
NP_441634.1_8 Reverse -234 -248 -0.393733 0.255
NP_441634.1_8 Forward -134 -120 -3.54032 0.295
NP_441634.1_8 Reverse -159 -173 -3.93365 0.295
NP_441634.1_8 Forward -263 -249 -4.03198 0.295
NP_441634.1_8 Forward -247 -233 -4.62196 0.295
NP_440376.1_1 Forward -170 -161 19.4693 0.000692
NP_440376.1_1 Reverse -161 -170 19.4693 0.000692
NP_440376.1_1 Reverse -236 -245 9.83282 0.0339
NP_440376.1_1 Forward -245 -236 9.63616 0.0385
NP_440376.1_1 Reverse -246 -255 5.70292 0.12
NP_440376.1_1 Forward -114 -105 3.93297 0.188
NP_440376.1_1 Reverse -365 -374 1.57302 0.246
NP_441857.1_5 Reverse -116 -134 2.37909 0.268
NP_441588.1_4 Forward -168 -158 8.92815 0.14
NP_441588.1_4 Forward -243 -233 6.96153 0.178
NP_441588.1_4 Forward -130 -120 6.37155 0.2
NP_442687.1_7 Reverse -309 -319 10.8948 0.0994
NP_442687.1_7 Forward -171 -161 8.92815 0.0994
NP_442687.1_7 Reverse -160 -170 8.92815 0.0994
NP_442687.1_7 Reverse -235 -245 6.76487 0.154
NP_442687.1_7 Forward -246 -236 5.97822 0.179
NP_442485.1_3 Reverse -241 -260 -0.787193 0.253
NP_440642.1_10 Reverse -29 -43 1.67063 0.29
NP_441013.1_2 Reverse -354 -372 -3.6191 0.29
NP_442296.1_5 Reverse -152 -171 14.0608 0.136
NP_442658.1_1 Forward -247 -237 7.45273 0.214
NP_442658.1_1 Reverse -159 -169 6.76441 0.214
NP_442658.1_1 Forward -172 -162 6.76441 0.214
NP_442658.1_1 Reverse -234 -244 6.17443 0.235
NP_442658.1_1 Reverse -121 -131 4.7978 0.297
NP_440141.1_8 Forward -49 -30 22.3206 0.048
NP_440141.1_8 Forward -129 -110 5.30933 0.276
NP_441414.1_9 Forward -170 -151 16.3224 0.00987
NP_441414.1_9 Reverse -161 -180 14.3558 0.0127
NP_441414.1_9 Forward -245 -226 2.3594 0.0674
NP_441414.1_9 Forward -304 -285 -1.67217 0.103
NP_440720.1_6 Reverse -261 -279 14.9655 0.291
NP_441487.1_6 Reverse -153 -172 -0.688862 0.279
NP_442937.1_5 Forward -119 -100 6.88262 0.268
NP_441958.1_5 Forward -171 -161 12.2714 0.00183
NP_441958.1_5 Reverse -160 -170 12.2714 0.00183
NP_441958.1_5 Reverse -235 -245 2.83163 0.0372
NP_441958.1_5 Forward -246 -236 2.43831 0.0422
NP_441958.1_5 Forward -133 -123 0.373358 0.154
NP_442836.1_5 Forward -251 -232 3.04771 0.248
NP_442836.1_5 Reverse -148 -167 1.57275 0.28
NP_442836.1_5 Forward -176 -157 1.17943 0.287
NP_440373.1_2 Forward -81 -62 16.1877 0.152
NP_440203.1_5 Reverse -164 -174 12.4676 0.147
NP_440203.1_5 Reverse -147 -157 9.81266 0.245
NP_440203.1_5 Forward -167 -157 9.71433 0.245
NP_439905.1_1 Reverse -162 -175 9.95071 0.216
NP_439905.1_1 Forward -260 -247 9.2624 0.221
NP_439905.1_1 Reverse -124 -137 6.60746 0.283
NP_440984.1_7 Reverse -156 -170 11.701 0.122
NP_439990.1_5 Reverse -331 -344 14.8673 0.0736
NP_439990.1_5 Forward -175 -162 8.9674 0.155
NP_442911.1_2 Forward -180 -161 17.699 0.00717
NP_442911.1_2 Reverse -151 -170 8.25926 0.0215
NP_442911.1_2 Reverse -285 -304 -5.50708 0.16
NP_442911.1_2 Reverse -226 -245 -9.63698 0.26
NP_440153.1_5 Forward -169 -155 3.93283 0.199
NP_442064.1_1 Forward -175 -156 -9.63698 0.259
NP_440496.1_1 Forward -129 -110 1.67108 0.276
NP_440602.1_8 Forward -245 -231 18.3875 0.0898
NP_441348.1_3 Reverse -221 -240 7.57094 0.256
NP_441099.1_5 Forward -124 -105 -4.22878 0.144
NP_442002.1_9 Reverse -235 -242 10.7572 0.185
NP_440809.1_9 Forward -179 -161 -7.94566 0.225
NP_441294.1_7 Reverse -157 -171 20.5773 0.00181
NP_441646.1_1 Reverse -154 -173 11.1109 0.105
NP_442438.1_10 Reverse -156 -170 11.3077 0.0463
NP_442438.1_10 Reverse -231 -245 10.9143 0.0478
NP_442438.1_10 Forward -260 -246 4.03116 0.152
NP_442438.1_10 Forward -175 -161 1.37622 0.197
NP_441000.1_6 Reverse -235 -249 4.91614 0.0933
NP_441000.1_6 Forward -246 -232 4.03116 0.0995
NP_441000.1_6 Forward -171 -157 -5.01529 0.257
NP_440147.1_4 Reverse -159 -172 11.3273 0.0326
NP_440147.1_4 Reverse -121 -134 5.62415 0.119
NP_440147.1_4 Forward -172 -159 2.18257 0.209
NP_440147.1_4 Reverse -234 -247 0.412608 0.255
NP_441175.1_7 Forward -170 -151 6.98095 0.241
NP_441550.1_8 Reverse -159 -169 14.6309 0.0132
NP_441550.1_8 Forward -172 -162 12.3692 0.0336
NP_441916.1_7 Forward -245 -235 15.2213 0.00956
NP_441916.1_7 Forward -170 -160 10.3048 0.0261
NP_441916.1_7 Reverse -161 -171 10.3048 0.0261
NP_441916.1_7 Reverse -236 -246 8.73149 0.042
NP_441916.1_7 Reverse -123 -133 7.05986 0.0779
NP_441916.1_7 Forward -132 -122 3.81494 0.202
NP_441041.1_4 Forward -132 -113 -4.52377 0.138
NP_441041.1_4 Forward -245 -226 -9.44032 0.216
NP_441041.1_4 Reverse -161 -180 -10.7186 0.236
NP_441041.1_4 Forward -170 -151 -11.4069 0.246
NP_441041.1_4 Reverse -246 -265 -11.6036 0.25
NP_441041.1_7 Forward -248 -236 8.19502 0.143
NP_442396.1_5 Reverse -157 -170 10.7374 0.106
NP_442396.1_5 Forward -174 -161 9.16406 0.13
NP_442004.1_6 Reverse -161 -175 10.226 0.14
NP_442004.1_6 Forward -170 -156 8.35772 0.142
NP_441725.1_4 Forward -250 -236 4.91554 0.278
NP_441725.1_5 Reverse -162 -172 11.2881 0.0247
NP_441725.1_5 Forward -169 -159 2.04498 0.115
NP_441725.1_5 Forward -244 -234 1.455 0.135
NP_439966.1_7 Forward -172 -162 15.8108 0.0124
NP_439966.1_7 Forward -247 -237 15.7125 0.0138
NP_439966.1_7 Reverse -234 -244 8.73102 0.13
NP_439966.1_7 Reverse -159 -169 7.25606 0.15
NP_439966.1_9 Reverse -234 -243 0.983037 0.253
NP_442941.1_3 Reverse -162 -172 19.9412 0.00262
NP_442941.1_3 Forward -169 -159 11.0914 0.0116
NP_442941.1_3 Forward -113 -103 5.38824 0.115
NP_442941.1_3 Forward -244 -234 1.65166 0.147
NP_442941.1_3 Reverse -237 -247 1.06167 0.153
NP_442941.1_3 Reverse -124 -134 -0.314959 0.256
NP_440289.1_2 Reverse -233 -246 4.93583 0.0636
NP_440289.1_2 Forward -248 -235 4.14919 0.0706
NP_440289.1_2 Forward -173 -160 3.85419 0.0735
NP_440289.1_2 Reverse -158 -171 -4.89726 0.294
NP_442281.1_1 Forward -250 -236 10.5204 0.0576
NP_442281.1_1 Reverse -231 -245 7.47213 0.0993
NP_442281.1_1 Reverse -118 -132 6.78381 0.115
NP_442256.1_2 Forward -172 -154 3.46073 0.107
NP_442256.1_2 Reverse -159 -177 -8.14232 0.217
NP_440437.1_1 Reverse -155 -174 0.0977854 0.172
NP_440437.1_1 Forward -251 -232 -2.26216 0.215
NP_440437.1_1 Reverse -230 -249 -3.24547 0.234
NP_441556.1_4 Forward -52 -33 10.2943 0.284
NP_441556.1_10 Reverse -155 -169 9.92981 0.281
NP_441556.1_10 Reverse -156 -170 9.44312 0.298
NP_440498.1_1 Reverse -152 -170 -1.55415 0.225
NP_440375.1_8 Forward -169 -150 15.9291 0.0983
NP_440375.1_8 Forward -244 -225 9.63589 0.138
NP_441644.1_6 Forward -170 -160 17.3841 0.00127
NP_441644.1_6 Reverse -161 -171 17.3841 0.00127
NP_441644.1_6 Reverse -123 -133 13.2542 0.0212
NP_441644.1_6 Forward -159 -149 7.94438 0.113
NP_441644.1_6 Reverse -252 -262 3.51951 0.277
NP_442215.1_2 Forward -172 -156 5.07341 0.0805
NP_442215.1_2 Reverse -159 -175 2.51681 0.114
NP_442215.1_2 Forward -254 -238 -0.334789 0.166
NP_442215.1_2 Forward -247 -231 -4.66135 0.237
NP_440929.1_8 Forward -170 -161 19.2726 0.000701
NP_440929.1_8 Reverse -161 -170 19.2726 0.000701
NP_440929.1_8 Forward -245 -236 9.63616 0.0262
NP_440929.1_8 Reverse -236 -245 9.53783 0.0296
NP_440929.1_8 Reverse -229 -238 2.16301 0.262
NP_442933.1_10 Forward -170 -161 17.601 0.00325
NP_442933.1_10 Reverse -161 -170 17.601 0.00325
NP_442933.1_10 Forward -245 -236 15.1427 0.00958
NP_442933.1_10 Reverse -236 -245 7.96454 0.0937
NP_442933.1_10 Reverse -123 -132 4.42462 0.246
NP_442933.1_10 Forward -132 -123 4.42462 0.246
NP_441751.2_8 Reverse -162 -176 4.03116 0.0563
NP_441751.2_8 Reverse -237 -251 -3.83532 0.156
NP_441751.2_8 Forward -244 -230 -4.03198 0.158
NP_442554.1_8 Reverse -162 -172 15.9097 0.00747
NP_442554.1_8 Forward -169 -159 15.3197 0.00882
NP_442554.1_8 Reverse -124 -134 15.123 0.00944
NP_442554.1_8 Reverse -253 -263 5.48657 0.146
NP_442554.1_8 Reverse -237 -247 4.69992 0.176
NP_442554.1_8 Forward -244 -234 4.0116 0.2
NP_441762.1_7 Reverse -235 -247 2.39892 0.0676
NP_441762.1_7 Forward -246 -234 2.20226 0.0676
NP_441762.1_7 Forward -171 -159 0.432302 0.0747
NP_441762.1_7 Forward -262 -250 -5.46756 0.212
NP_441762.1_7 Reverse -160 -172 -6.84419 0.284
NP_442142.1_4 Reverse -233 -246 14.375 0.0311
NP_442142.1_4 Forward -248 -235 7.88518 0.127
NP_442142.1_4 Forward -173 -160 6.31189 0.169
NP_442142.1_4 Reverse -249 -262 4.93527 0.206
NP_442142.1_4 Reverse -120 -133 4.83694 0.209
NP_442142.1_4 Forward -264 -251 3.85363 0.243
NP_442142.1_4 Forward -135 -122 3.16532 0.265
NP_442142.1_4 Reverse -158 -171 3.06699 0.268
NP_442292.1_1 Forward -169 -160 18.486 0.00229
NP_442292.1_1 Reverse -162 -171 18.486 0.00229
NP_442292.1_1 Reverse -124 -133 4.81794 0.17
NP_442292.1_1 Reverse -237 -246 -0.0986038 0.239
NP_442292.1_1 Forward -244 -235 -0.196935 0.239
NP_441024.1_7 Reverse -149 -167 10.3431 0.275
NP_442476.1_6 Reverse -162 -176 5.89945 0.131
NP_442476.1_6 Forward -169 -155 3.34284 0.158
NP_442381.1_8 Reverse -233 -252 -14.2585 0.28
NP_441711.1_4 Reverse -152 -171 4.03102 0.224
NP_443009.1_5 Reverse -160 -171 8.90795 0.0965
NP_443009.1_5 Forward -171 -160 8.90795 0.0965
NP_443009.1_5 Forward -133 -122 6.94134 0.144
NP_441715.1_4 Reverse -162 -172 14.828 0.0268
NP_441715.1_4 Reverse -237 -247 9.12481 0.103
NP_441715.1_4 Forward -169 -159 7.94484 0.107
NP_441715.1_4 Forward -244 -234 6.46988 0.143
NP_440015.1_9 Reverse -161 -179 -0.0791831 0.255
NP_440183.1_9 Forward -259 -240 -10.3253 0.227
NP_440464.1_10 Reverse -106 -116 15.4909 0.169
NP_440464.1_10 Forward -169 -159 13.0082 0.169
NP_441468.1_1 Forward -169 -162 15.8704 0.0124
NP_441468.1_1 Reverse -162 -169 15.8704 0.0124
NP_441468.1_1 Reverse -237 -244 6.13563 0.209
NP_441468.1_1 Forward -244 -237 6.0373 0.223
NP_441468.1_1 Reverse -253 -260 3.97235 0.277
NP_441468.1_1 Reverse -124 -131 3.97235 0.277
NP_441468.1_1 Forward -260 -253 3.97235 0.277
NP_441468.1_1 Forward -131 -124 3.97235 0.277
NP_441020.2_6 Reverse -234 -251 6.92201 0.249
NP_441015.1_10 Forward -175 -156 1.67108 0.158
NP_441673.1_1 Forward -170 -161 20.8459 0.000698
NP_441673.1_1 Reverse -161 -170 20.8459 0.000698
NP_441673.1_1 Reverse -236 -245 11.1111 0.0121
NP_441673.1_1 Forward -245 -236 11.0128 0.018
NP_441673.1_1 Forward -255 -246 -7.76842 0.168
NP_441673.1_1 Reverse -246 -255 -8.06341 0.254
NP_440265.1_4 Reverse -241 -260 16.7602 0.287
NP_441876.1_9 Reverse -36 -46 10.8943 0.284
NP_441826.1_2 Reverse -155 -169 3.8345 0.105
NP_441826.1_2 Reverse -230 -244 2.35953 0.129
NP_441826.1_2 Forward -251 -237 1.67122 0.144
NP_441330.1_1 Forward -266 -247 -5.80207 0.131
NP_441764.1_8 Forward -297 -287 12.842 0.284
NP_442868.1_6 Forward -172 -162 9.91146 0.038
NP_442868.1_6 Reverse -159 -169 9.81313 0.038
NP_442868.1_6 Forward -247 -237 0.471689 0.226
NP_442719.1_2 Forward -281 -263 -9.42131 0.264
NP_441612.1_2 Forward -114 -104 13.4867 0.21
NP_441612.1_2 Reverse -161 -171 8.54929 0.21
NP_441612.1_2 Forward -170 -160 8.54929 0.21
NP_442361.1_3 Reverse -230 -243 9.75405 0.272
NP_442427.1_8 Forward -179 -160 5.89931 0.25
NP_442808.1_1 Forward -246 -236 17.1874 0.00769
NP_442808.1_1 Reverse -235 -245 8.73102 0.0481
NP_442808.1_1 Reverse -160 -170 8.63269 0.0481
NP_442808.1_1 Forward -171 -161 8.63269 0.0481
NP_440145.1_3 Forward -124 -105 -5.99873 0.286
NP_441906.1_2 Reverse -103 -122 5.70185 0.286
NP_442820.1_3 Forward -382 -372 14.7292 0.277
NP_442542.1_2 Forward -34 -21 5.82081 0.247
NP_442542.1_9 Forward -252 -238 6.48882 0.235
NP_442050.1_5 Forward -172 -162 16.4991 0.00812
NP_442050.1_5 Reverse -159 -169 7.64939 0.243
NP_440334.1_2 Forward -39 -26 17.1289 0.203
NP_440558.1_2 Reverse -96 -115 -6.78538 0.28
NP_441878.1_6 Forward -171 -161 10.4031 0.0176
NP_441878.1_6 Reverse -160 -170 10.4031 0.0176
NP_441878.1_6 Reverse -235 -245 0.668351 0.139
NP_441878.1_6 Forward -133 -123 0.668351 0.139
NP_441878.1_6 Reverse -122 -132 0.668351 0.139
NP_441878.1_6 Forward -246 -236 0.57002 0.14
NP_441036.1_8 Reverse -235 -245 16.6963 0.00366
NP_441036.1_8 Forward -246 -236 8.4365 0.174
NP_441036.1_8 Forward -171 -161 8.33817 0.174
NP_441036.1_8 Reverse -160 -170 8.33817 0.174
NP_442503.1_9 Reverse -301 -320 6.29264 0.272
NP_441534.1_9 Forward -287 -274 20.0782 0.0744
NP_441557.1_2 Forward -380 -362 19.7837 0.178
NP_441557.1_5 Forward -170 -161 19.9609 0.000699
NP_441557.1_5 Reverse -161 -170 19.9609 0.000699
NP_441557.1_5 Reverse -236 -245 10.2261 0.0144
NP_441557.1_5 Forward -245 -236 10.1278 0.0188
NP_441557.1_5 Forward -132 -123 -0.885252 0.26
NP_441520.1_7 Forward -259 -240 6.88262 0.245
NP_441445.1_1 Forward -179 -160 10.6192 0.0942
NP_441445.1_1 Reverse -152 -171 5.30933 0.172
NP_441590.1_4 Forward -136 -117 4.81688 0.279
NP_441590.1_4 Forward -265 -246 3.04693 0.29
NP_442795.1_2 Forward -146 -127 8.94757 0.241
NP_442777.1_10 Forward -139 -120 14.0608 0.252
NP_440738.1_5 Forward -104 -85 0.0977854 0.297
NP_442183.1_1 Reverse -236 -250 8.55439 0.113
NP_442183.1_1 Reverse -161 -175 8.55439 0.113
NP_442397.1_9 Reverse -154 -173 8.65258 0.246
NP_440440.1_1 Forward -72 -53 9.83173 0.192
NP_441574.1_1 Reverse -240 -259 3.04771 0.151
NP_440058.1_5 Reverse -328 -347 16.2241 0.131
NP_441549.1_9 Forward -174 -156 11.8189 0.0358
NP_442347.1_2 Forward -169 -160 12.4878 0.056
NP_442347.1_2 Reverse -162 -171 12.4878 0.056
NP_442347.1_2 Forward -244 -235 10.9145 0.0571
NP_442347.1_2 Reverse -106 -115 8.1612 0.108
NP_442645.1_2 Forward -140 -121 4.32602 0.0238
NP_442645.1_2 Reverse -153 -172 -12.2919 0.144
NP_442645.1_2 Forward -178 -159 -14.1602 0.171
NP_442888.1_6 Forward -272 -253 3.04771 0.244
NP_442888.1_6 Reverse -112 -131 2.16274 0.266
NP_441037.1_4 Reverse -159 -169 7.9999 0.237
NP_441633.1_3 Forward -247 -234 3.16588 0.0738
NP_441633.1_3 Reverse -159 -172 1.10092 0.109
NP_441633.1_3 Forward -172 -159 -5.97891 0.236
NP_441633.1_3 Reverse -234 -247 -6.07724 0.236
NP_440136.1_2 Forward -169 -162 15.9687 0.0123
NP_440136.1_2 Reverse -162 -169 15.9687 0.0123
NP_440136.1_2 Reverse -237 -244 6.23397 0.171
NP_440136.1_2 Forward -244 -237 6.13563 0.193
NP_442998.1_10 Forward -243 -236 15.5754 0.0102
NP_442998.1_10 Forward -168 -161 15.5754 0.0102
NP_442998.1_10 Reverse -163 -170 15.5754 0.0102
NP_442998.1_10 Reverse -238 -245 5.84064 0.235
NP_440299.1_1 Reverse -157 -170 16.2433 0.0109
NP_440299.1_1 Forward -174 -161 10.2451 0.058
NP_440299.1_1 Reverse -232 -245 4.34528 0.209
NP_441799.1_1 Reverse -157 -171 18.5835 0.00832
NP_441799.1_1 Forward -174 -160 16.0269 0.0153
NP_441799.1_1 Forward -136 -122 5.99717 0.187
NP_441799.1_1 Reverse -248 -262 5.80051 0.194
NP_441799.1_1 Reverse -119 -133 5.1122 0.223
NP_441799.1_1 Forward -265 -251 4.71887 0.238
NP_441007.1_10 Forward -175 -162 1.69091 0.203
NP_441007.1_10 Reverse -156 -169 -0.570702 0.287
NP_442334.1_2 Forward -255 -238 -13.4325 0.297
NP_442201.1_10 Reverse -150 -169 -5.21209 0.156
NP_442201.1_10 Forward -256 -237 -13.0786 0.27
NP_440256.1_1 Forward -248 -229 7.07928 0.0275
NP_440256.1_1 Reverse -120 -139 -7.86702 0.247
NP_440256.1_1 Forward -173 -154 -9.53865 0.281
NP_440087.1_1 Forward -254 -235 -8.94866 0.287
NP_440521.1_6 Forward -191 -172 14.7491 0.251
NP_441559.1_8 Reverse -241 -255 1.57289 0.155
NP_441559.1_8 Forward -250 -236 -6.29359 0.276
NP_441559.1_8 Forward -175 -161 -6.78525 0.279
NP_440915.1_6 Forward -249 -235 3.34284 0.103
NP_440915.1_6 Reverse -361 -375 -3.24533 0.292
NP_442158.1_4 Forward -289 -279 11.4848 0.271
NP_442785.1_7 Forward -172 -158 10.7177 0.228
NP_441866.1_3 Reverse -80 -93 14.1789 0.177
NP_441704.1_8 Forward -181 -162 8.16011 0.211
NP_442967.1_9 Forward -261 -247 16.3225 0.153
NP_442993.1_1 Reverse -236 -252 -6.62797 0.146
NP_442993.1_1 Reverse -161 -177 -9.67623 0.19
NP_442993.1_1 Forward -132 -116 -10.3645 0.217
NP_442386.1_9 Reverse -251 -260 14.1589 0.0289
NP_442386.1_9 Reverse -160 -169 13.8639 0.0289
NP_442386.1_9 Forward -171 -162 13.8639 0.0289
NP_442386.1_9 Reverse -122 -131 13.1756 0.0406
NP_442386.1_9 Forward -246 -237 5.9975 0.23
NP_442386.1_9 Reverse -235 -244 5.9975 0.23
NP_441750.1_1 Forward -168 -149 -12.6852 0.3
NP_441340.1_5 Forward -169 -162 15.6737 0.0124
NP_441340.1_5 Reverse -162 -169 15.6737 0.0124
NP_441340.1_5 Reverse -237 -244 6.23397 0.132
NP_441340.1_5 Forward -244 -237 5.84064 0.208
NP_441340.1_5 Reverse -253 -260 4.07068 0.239
NP_441340.1_5 Reverse -124 -131 4.07068 0.239
NP_441340.1_5 Forward -260 -253 4.07068 0.239
NP_441340.1_5 Forward -131 -124 4.07068 0.239
NP_442791.1_5 Reverse -228 -247 -10.1286 0.279
NP_442950.1_1 Reverse -83 -102 -5.50708 0.265
NP_441160.1_10 Forward -338 -320 13.1955 0.101
NP_440586.1_8 Reverse -237 -244 14.69 0.026
NP_440586.1_8 Forward -169 -162 13.2151 0.026
NP_440586.1_8 Reverse -162 -169 13.2151 0.026
NP_440586.1_8 Reverse -168 -175 10.7568 0.128
NP_440586.1_8 Forward -260 -253 7.61025 0.227
NP_440586.1_8 Forward -131 -124 7.61025 0.227
NP_440586.1_8 Reverse -253 -260 7.61025 0.227
NP_440586.1_8 Reverse -124 -131 7.61025 0.227
NP_440586.1_9 Forward -259 -240 9.53756 0.261
NP_442251.1_6 Forward -169 -162 15.2804 0.0124
NP_442251.1_6 Reverse -162 -169 15.2804 0.0124
NP_442251.1_6 Forward -244 -237 12.0355 0.0627
NP_442959.1_7 Reverse -15 -34 -5.60541 0.299
NP_441262.1_3 Reverse -236 -243 14.7888 0.0223
NP_441262.1_3 Reverse -161 -168 14.7888 0.0223
NP_441262.1_3 Forward -170 -163 14.7888 0.0223
NP_440027.1_3 Forward -169 -151 2.47668 0.289
NP_440027.1_3 Forward -142 -124 1.98502 0.295
NP_440027.1_3 Forward -265 -247 1.88669 0.295
NP_443051.1_1 Reverse -160 -169 10.4228 0.00754
NP_443051.1_1 Forward -171 -162 10.4228 0.00754
NP_443051.1_1 Reverse -235 -244 0.884706 0.125
NP_443051.1_1 Forward -246 -237 0.589713 0.143
NP_443051.1_1 Forward -133 -124 -0.000272808 0.245
NP_439937.1_9 Reverse -4 -21 -9.89323 0.215
NP_439937.1_9 Reverse -160 -177 -14.5148 0.287
NP_441595.1_2 Forward -300 -287 8.75154 0.28
NP_440408.1_7 Forward -55 -36 7.27595 0.29
NP_440439.1_1 Forward -173 -160 2.37923 0.135
NP_440439.1_1 Forward -248 -235 0.707601 0.179
NP_440439.1_1 Reverse -233 -246 -1.06236 0.249
NP_440439.1_1 Reverse -362 -375 -1.35735 0.263
NP_441522.1_1 Forward -42 -24 18.0129 0.243
NP_440372.1_2 Forward -169 -162 16.3621 0.0124
NP_440372.1_2 Reverse -162 -169 16.3621 0.0124
NP_440372.1_2 Reverse -237 -244 6.82395 0.0854
NP_440372.1_2 Forward -244 -237 6.52896 0.188
NP_440316.1_10 Forward -262 -252 6.37155 0.263
NP_440316.1_10 Forward -133 -123 6.27322 0.264
NP_441803.1_2 Forward -260 -241 6.39097 0.154
NP_440139.1_1 Reverse -230 -249 6.68515 0.139
NP_440139.1_1 Forward -251 -232 2.06362 0.24
NP_441572.1_7 Forward -176 -157 -4.03212 0.224
NP_441572.1_7 Forward -251 -232 -4.42544 0.235
NP_440267.1_2 Reverse -231 -245 5.89884 0.254
NP_442384.1_10 Forward -170 -157 18.0139 0.00545
NP_442384.1_10 Reverse -161 -174 17.1289 0.00642
NP_442384.1_10 Reverse -123 -136 7.09911 0.0875
NP_442384.1_10 Forward -114 -101 3.65753 0.183
NP_442384.1_10 Reverse -236 -249 2.08423 0.237
NP_442384.1_10 Forward -255 -242 1.29759 0.263
NP_441877.1_9 Reverse -261 -278 1.8088 0.297
NP_441018.1_7 Reverse -95 -114 8.55425 0.242
NP_442790.1_4 Forward -254 -235 3.24438 0.0729
NP_442262.1_10 Forward -169 -162 14.1988 0.0123
NP_442262.1_10 Reverse -162 -169 14.1988 0.0123
NP_442262.1_10 Reverse -237 -244 12.9205 0.0422
NP_442262.1_10 Forward -260 -253 10.4622 0.145
NP_442262.1_10 Forward -131 -124 10.4622 0.145
NP_442262.1_10 Reverse -253 -260 10.4622 0.145
NP_442262.1_10 Reverse -124 -131 10.4622 0.145
NP_441689.1_5 Forward -172 -162 15.3192 0.0403
NP_441689.1_5 Reverse -159 -169 5.78111 0.197
NP_440163.1_10 Reverse -233 -243 15.2213 0.0762
NP_440344.1_10 Reverse -229 -246 -0.0594896 0.0381
NP_440344.1_10 Forward -177 -160 -6.746 0.114
NP_440344.1_10 Forward -252 -235 -8.51595 0.129
NP_440282.1_10 Reverse -242 -261 -4.72043 0.25
NP_440531.1_6 Forward -178 -159 5.89931 0.112
NP_440531.1_6 Reverse -153 -172 -2.26216 0.247
NP_442123.1_3 Forward -245 -226 11.8975 0.22
NP_440189.1_10 Reverse -150 -169 4.52268 0.279
NP_440562.1_10 Reverse -22 -40 10.6389 0.259
NP_441965.1_3 Reverse -151 -170 12.8808 0.0883
NP_441965.1_3 Forward -180 -161 -1.18052 0.28
NP_441965.1_10 Forward -173 -157 8.41667 0.125
NP_441965.1_10 Reverse -158 -174 7.33503 0.15
NP_441965.1_10 Forward -135 -119 6.45005 0.174
NP_440297.1_9 Reverse -162 -172 9.32148 0.0917
NP_440297.1_9 Forward -169 -159 -0.118297 0.282
NP_440297.1_9 Reverse -124 -134 -0.216628 0.282
NP_440297.1_9 Forward -244 -234 -0.511621 0.289
NP_442280.1_10 Forward -142 -124 7.98684 0.268
NP_442280.1_10 Reverse -95 -113 5.94143 0.28
NP_441896.1_5 Reverse -257 -264 12.2322 0.273
NP_440894.1_10 Reverse -241 -260 9.83255 0.155
NP_440894.1_10 Reverse -29 -48 3.14605 0.278
NP_440894.1_10 Forward -250 -231 2.0644 0.298
NP_440999.1_9 Reverse -242 -256 4.22782 0.116
NP_440999.1_9 Forward -249 -235 2.06454 0.154
NP_440999.1_9 Forward -174 -160 -0.688726 0.214
NP_440999.1_9 Reverse -119 -133 -3.24533 0.289
NP_440888.1_2 Reverse -161 -175 15.1419 0.0122
NP_440888.1_2 Forward -170 -156 11.897 0.0562
NP_440888.1_2 Reverse -246 -260 10.422 0.0946
NP_440888.1_2 Forward -245 -231 9.53707 0.123
NP_440888.1_2 Reverse -236 -250 6.78381 0.22
NP_440888.1_2 Reverse -295 -309 5.50552 0.276
NP_442454.1_5 Reverse -58 -77 14.9449 0.139
NP_440600.1_4 Reverse -153 -171 -2.83245 0.209
NP_440491.1_1 Forward -173 -154 8.37887 0.243
NP_442277.1_4 Forward -64 -45 2.16195 0.254
NP_441543.1_2 Forward -169 -160 16.9127 0.00359
NP_441543.1_2 Reverse -162 -171 16.9127 0.00359
NP_441543.1_2 Reverse -237 -246 16.6177 0.00485
NP_441543.1_2 Forward -244 -235 8.65285 0.0968
NP_441543.1_2 Reverse -124 -133 4.12963 0.279
NP_442845.1_2 Forward -176 -162 14.6509 0.0775
NP_442845.1_2 Reverse -246 -260 7.47274 0.195
NP_442845.1_2 Reverse -155 -169 7.17775 0.198
NP_442845.1_2 Forward -170 -156 4.81781 0.251
NP_442845.1_2 Reverse -99 -113 4.71948 0.254
NP_441551.1_5 Reverse -248 -264 10.2842 0.193
NP_440982.1_1 Forward -374 -355 11.2084 0.209
NP_441469.1_8 Reverse -251 -260 12.9794 0.087
NP_441469.1_8 Forward -171 -162 6.48957 0.227
NP_441469.1_8 Reverse -160 -169 6.48957 0.227
NP_441469.1_8 Reverse -235 -244 6.39124 0.227
NP_441469.1_8 Forward -246 -237 6.29291 0.227
NP_441469.1_8 Reverse -122 -131 5.60459 0.258
NP_443064.1_6 Forward -170 -160 12.5669 0.0796
NP_443064.1_6 Reverse -161 -171 12.5669 0.0796
NP_443064.1_6 Forward -56 -46 9.56122 0.211
NP_441306.1_10 Reverse -152 -166 15.2402 0.247
NP_442578.1_7 Reverse -237 -244 14.6904 0.026
NP_442578.1_7 Forward -169 -162 14.5921 0.026
NP_442578.1_7 Reverse -162 -169 14.5921 0.026
NP_440710.1_1 Forward -140 -122 0.412472 0.163
NP_440710.1_1 Reverse -153 -171 -0.0791831 0.163
NP_441462.1_2 Forward -170 -160 11.5831 0.00406
NP_441462.1_2 Reverse -161 -171 11.5831 0.00406
NP_441462.1_2 Reverse -236 -246 2.24165 0.0801
NP_441462.1_2 Forward -245 -235 1.74999 0.0811
NP_441462.1_5 Forward -45 -26 2.0644 0.291
NP_443062.1_1 Forward -245 -227 17.7116 0.0246
NP_443062.1_1 Forward -132 -114 8.44842 0.153
NP_443062.1_1 Forward -374 -356 8.2534 0.157
NP_443062.1_1 Forward -170 -152 6.30325 0.204
NP_443062.1_1 Reverse -252 -270 5.13317 0.238
NP_443062.1_1 Reverse -161 -179 4.93815 0.244
NP_443062.1_6 Forward -178 -159 1.17943 0.278
NP_442204.1_1 Forward -249 -238 0.157002 0.283
NP_442204.1_5 Reverse -236 -255 4.52268 0.167
NP_442204.1_5 Reverse -226 -245 -0.688862 0.296
NP_440516.1_2 Forward -176 -158 5.82068 0.122
NP_440516.1_2 Forward -251 -233 2.18243 0.18
NP_440516.1_8 Forward -170 -161 16.9127 0.00442
NP_440516.1_8 Reverse -161 -170 16.9127 0.00442
NP_440516.1_8 Reverse -236 -245 8.45619 0.0364
NP_440516.1_8 Forward -245 -236 7.37455 0.0648
NP_440516.1_8 Reverse -365 -374 -0.491928 0.262
NP_442428.1_4 Reverse -245 -264 3.04771 0.247
NP_442428.1_5 Forward -169 -162 15.8704 0.0124
NP_442428.1_5 Reverse -162 -169 15.8704 0.0124
NP_442428.1_5 Reverse -237 -244 6.13563 0.209
NP_442428.1_5 Forward -244 -237 6.0373 0.212
NP_442428.1_5 Forward -260 -253 4.36568 0.271
NP_442428.1_5 Reverse -253 -260 4.36568 0.271
NP_442428.1_5 Forward -131 -124 4.36568 0.271
NP_442428.1_5 Reverse -124 -131 4.36568 0.271
NP_441867.1_2 Forward -50 -31 -13.9635 0.277
NP_440673.1_3 Forward -243 -236 12.4288 0.0426
NP_440673.1_3 Forward -168 -161 12.4288 0.0426
NP_440673.1_3 Reverse -163 -170 12.4288 0.0426
NP_440673.1_7 Reverse -150 -169 4.71934 0.185
NP_441714.1_3 Reverse -154 -172 16.5379 0.119
NP_441052.1_2 Forward -170 -160 19.9412 0.00106
NP_441052.1_2 Reverse -161 -171 19.9412 0.00106
NP_441052.1_2 Reverse -105 -115 12.7631 0.0285
NP_441052.1_2 Reverse -236 -246 7.15819 0.0797
NP_441052.1_2 Forward -114 -104 4.3066 0.161
NP_441052.1_2 Forward -245 -235 0.668351 0.256
NP_440992.1_2 Forward -137 -118 10.6192 0.273
NP_442219.1_8 Forward -174 -155 8.84354 0.241
NP_442219.1_9 Forward -169 -160 17.7976 0.00718
NP_442219.1_9 Reverse -162 -171 17.7976 0.00718
NP_442219.1_9 Reverse -247 -256 2.06468 0.289
NP_442219.1_9 Reverse -106 -115 1.76968 0.298
NP_440436.1_4 Forward -169 -160 17.2072 0.00233
NP_440436.1_4 Reverse -162 -171 17.2072 0.00233
NP_440436.1_4 Reverse -237 -246 8.65242 0.0997
NP_440436.1_4 Forward -244 -235 8.55409 0.0997
NP_440436.1_4 Forward -131 -122 4.42421 0.265
NP_441884.1_9 Reverse -240 -259 -13.2752 0.138
NP_441884.1_9 Forward -173 -154 -22.0267 0.275
NP_441719.1_4 Forward -169 -162 16.3621 0.0124
NP_441719.1_4 Reverse -162 -169 16.3621 0.0124
NP_441719.1_4 Reverse -237 -244 13.5105 0.026
NP_441719.1_4 Forward -244 -237 6.52896 0.188
NP_441733.1_10 Reverse -233 -246 7.39411 0.153
NP_441004.1_2 Forward -335 -316 -2.0655 0.263
NP_441004.1_4 Reverse -307 -317 7.55152 0.298
NP_442366.1_3 Forward -246 -228 3.75572 0.105
NP_442366.1_3 Reverse -235 -253 1.88744 0.139
NP_442366.1_3 Reverse -153 -171 -4.40575 0.271
NP_442366.1_5 Reverse -158 -168 17.2858 0.0141
NP_440129.1_10 Reverse -229 -243 3.73617 0.189
NP_441115.1_4 Forward -246 -228 14.0797 0.0628
NP_441115.1_4 Forward -133 -115 9.55647 0.21
NP_442854.1_4 Reverse -156 -175 11.3067 0.265
NP_442854.1_6 Reverse -123 -142 1.67108 0.279
NP_441228.1_7 Forward -399 -381 18.1636 0.296
NP_443054.1_2 Reverse -234 -248 3.14618 0.24
NP_443054.1_2 Forward -247 -233 1.57289 0.245
NP_443054.1_2 Forward -172 -158 1.47456 0.245
NP_443054.1_2 Forward -134 -120 0.392915 0.267
NP_441851.1_9 Reverse -298 -317 22.5172 0.0337
NP_441851.1_10 Forward -171 -161 15.8113 0.00552
NP_441851.1_10 Reverse -160 -170 15.8113 0.00552
NP_441851.1_10 Reverse -235 -245 12.0747 0.0568
NP_441851.1_10 Forward -246 -236 6.17489 0.182
NP_441545.1_3 Forward -167 -148 18.584 0.0596
NP_442011.1_1 Reverse -235 -254 -1.86883 0.271
NP_441668.1_4 Forward -359 -340 -2.26216 0.288
NP_442515.1_1 Reverse -160 -174 17.7975 0.0223
NP_442515.1_1 Forward -171 -157 2.06454 0.143
NP_440165.1_5 Reverse -235 -254 11.7992 0.0454
NP_441046.1_2 Forward -181 -162 2.0644 0.244
NP_441349.1_10 Reverse -151 -170 13.7658 0.0175
NP_441349.1_10 Forward -180 -161 1.17943 0.0845
NP_441349.1_10 Reverse -226 -245 -0.688862 0.0958
NP_441349.1_10 Forward -255 -236 -1.37718 0.103
NP_441409.1_6 Forward -176 -157 1.17943 0.062
NP_442843.1_1 Forward -260 -241 -11.2103 0.286
NP_440474.1_8 Forward -244 -230 13.077 0.0759
NP_440396.1_1 Reverse -35 -54 -5.50708 0.272
NP_441124.1_5 Forward -276 -266 13.9631 0.215
NP_441124.1_5 Reverse -261 -271 12.9127 0.215
NP_442450.1_5 Forward -172 -162 9.32148 0.115
NP_442450.1_5 Reverse -159 -169 7.55152 0.13
NP_442450.1_5 Reverse -234 -244 6.07655 0.204
NP_442168.1_5 Forward -59 -40 2.85105 0.232
NP_440588.1_2 Forward -179 -160 4.52268 0.0801
NP_442006.1_2 Forward -49 -32 -16.1858 0.243
NP_441570.1_1 Forward -170 -152 10.6389 0.0086
NP_441570.1_1 Forward -245 -227 0.609134 0.0379
NP_441570.1_1 Reverse -246 -264 -1.55415 0.0578
NP_441570.1_1 Reverse -161 -179 -13.9439 0.225
NP_441078.1_4 Forward -170 -161 19.6659 0.0007
NP_441078.1_4 Reverse -161 -170 19.6659 0.0007
NP_441078.1_4 Reverse -236 -245 9.93116 0.0203
NP_441078.1_4 Forward -245 -236 9.83282 0.0226
NP_441078.1_4 Reverse -123 -132 -1.6719 0.266
NP_441078.1_4 Forward -132 -123 -1.77023 0.266
NP_441078.1_4 Forward -114 -105 -1.86856 0.272
NP_441078.1_4 Reverse -105 -114 -2.06522 0.295
NP_442729.1_8 Forward -174 -161 9.75405 0.125
NP_441528.1_2 Reverse -292 -311 6.98015 0.297
NP_442443.1_1 Forward -365 -346 5.50599 0.157
NP_440526.1_3 Forward -169 -158 0.943182 0.267
NP_440526.1_3 Reverse -162 -173 0.844851 0.267
NP_441432.1_8 Reverse -160 -169 16.8143 0.00595
NP_441432.1_8 Forward -171 -162 16.8143 0.00595
NP_441432.1_8 Forward -133 -124 6.19458 0.118
NP_441432.1_8 Forward -305 -296 5.60459 0.147
NP_441432.1_9 Reverse -182 -195 10.2466 0.254
NP_442320.1_8 Forward -176 -162 -2.85201 0.1
NP_442320.1_8 Forward -251 -237 -4.52363 0.171
NP_442320.1_8 Reverse -230 -244 -5.01529 0.2
NP_442344.1_7 Forward -244 -225 -9.44032 0.251
NP_441732.1_2 Reverse -157 -173 1.92682 0.0254
NP_441732.1_2 Forward -174 -158 1.92682 0.0254
NP_441030.1_6 Reverse -121 -140 14.103 0.195
NP_440313.1_5 Reverse -277 -295 11.7197 0.261
NP_442003.1_4 Forward -169 -150 10.6192 0.288
NP_440760.1_1 Reverse -161 -180 -4.13045 0.0392
NP_440760.1_1 Forward -170 -151 -21.4367 0.237
NP_440760.1_1 Reverse -246 -265 -21.9284 0.246
NP_442797.1_7 Reverse -154 -172 2.96908 0.236
NP_440199.1_10 Forward -173 -163 15.5163 0.0861
NP_440199.1_10 Reverse -233 -243 14.533 0.0861
NP_442353.1_4 Reverse -155 -174 12.6833 0.0776
NP_441072.1_2 Reverse -150 -169 13.7658 0.159
NP_441072.1_2 Forward -174 -155 9.73422 0.216
NP_441072.1_2 Reverse -354 -373 5.99764 0.295
NP_440713.1_4 Forward -180 -161 4.22769 0.231
NP_442489.1_2 Reverse -241 -260 15.7324 0.126
NP_442489.1_2 Reverse -112 -131 9.3409 0.168
NP_442489.1_7 Forward -170 -161 20.1576 0.000695
NP_442489.1_7 Reverse -161 -170 20.1576 0.000695
NP_442489.1_7 Forward -245 -236 17.306 0.00302
NP_442489.1_7 Reverse -236 -245 10.4228 0.0151
NP_442489.1_7 Forward -114 -105 -1.57357 0.213
NP_442489.1_7 Reverse -123 -132 -1.6719 0.235
NP_442489.1_7 Forward -132 -123 -1.77023 0.247
NP_440559.1_1 Forward -169 -160 17.4043 0.00658
NP_440559.1_1 Reverse -162 -171 17.4043 0.00658
NP_440559.1_1 Reverse -237 -246 5.70292 0.137
NP_441659.2_8 Forward -170 -160 18.1713 0.00133
NP_441659.2_8 Reverse -161 -171 18.1713 0.00133
NP_441659.2_8 Reverse -123 -133 6.8632 0.0663
NP_441659.2_8 Reverse -236 -246 2.43831 0.2
NP_441659.2_8 Forward -245 -235 2.33998 0.205
NP_442913.1_10 Reverse -152 -171 18.6823 0.0136
NP_442913.1_10 Forward -179 -160 -0.197208 0.157
NP_441185.1_2 Reverse -250 -269 4.71934 0.26
NP_442346.1_5 Forward -171 -161 16.6963 0.00248
NP_442346.1_5 Reverse -160 -170 16.6963 0.00248
NP_442346.1_5 Forward -133 -123 13.8447 0.0194
NP_442346.1_5 Reverse -122 -132 4.89658 0.269
NP_442346.1_10 Forward -321 -302 -0.295539 0.265
NP_440352.1_3 Forward -175 -156 17.9226 0.291
NP_440545.1_3 Reverse -157 -174 12.8219 0.0194
NP_440545.1_3 Forward -59 -42 -6.64766 0.285
NP_441856.1_3 Reverse -158 -177 0.0977854 0.216
NP_441856.1_3 Forward -173 -154 -3.73712 0.299
NP_440025.1_1 Forward -249 -230 6.4893 0.263
NP_441629.1_1 Reverse -115 -134 6.78429 0.253
NP_440486.1_6 Forward -363 -344 5.30933 0.298
NP_440459.1_2 Reverse -152 -169 12.7235 0.137
NP_440010.1_4 Forward -265 -246 5.01354 0.211
NP_440010.1_10 Reverse -328 -347 5.40766 0.232
NP_442603.1_7 Reverse -161 -175 18.6818 0.0125
NP_442603.1_9 Reverse -121 -139 4.6407 0.293
NP_441585.1_5 Forward -302 -283 3.73524 0.255
NP_441888.1_7 Forward -250 -236 11.996 0.0743
NP_441948.1_4 Reverse -229 -247 13.8838 0.0344
NP_441833.1_4 Forward -169 -162 15.9687 0.0124
NP_441833.1_4 Reverse -162 -169 15.9687 0.0124
NP_441833.1_4 Forward -244 -237 6.52896 0.0924
NP_441833.1_4 Reverse -237 -244 6.23397 0.163
NP_441895.1_10 Forward -47 -28 -27.6315 0.282
NP_442162.1_9 Forward -169 -162 16.2637 0.0124
NP_442162.1_9 Reverse -162 -169 16.2637 0.0124
NP_442162.1_9 Reverse -237 -244 6.62729 0.142
NP_442162.1_9 Forward -244 -237 6.52896 0.178
NP_442199.1_5 Forward -269 -250 10.2259 0.0576
NP_442199.1_5 Forward -140 -121 -6.78538 0.281
NP_442140.1_3 Forward -260 -250 13.1564 0.0624
NP_442140.1_3 Forward -169 -159 12.2714 0.0632
NP_442140.1_3 Forward -131 -121 11.0914 0.0836
NP_442140.1_3 Reverse -237 -247 4.99491 0.232
NP_442140.1_3 Reverse -162 -172 4.40493 0.243
NP_440875.1_9 Reverse -238 -248 12.5575 0.113
NP_440875.1_9 Reverse -254 -264 9.05339 0.233
NP_440875.1_9 Forward -243 -233 8.37203 0.233
NP_442547.1_7 Reverse -242 -261 10.8063 0.275
NP_441813.1_5 Forward -172 -162 15.9097 0.01
NP_441813.1_5 Forward -247 -237 9.81313 0.0214
NP_441813.1_5 Reverse -159 -169 8.63316 0.0367
NP_441813.1_5 Reverse -234 -244 7.45319 0.0746
NP_442089.1_6 Reverse -246 -265 4.12936 0.262
NP_440590.1_4 Forward -169 -156 9.65572 0.0341
NP_440590.1_4 Reverse -237 -250 5.72248 0.0585
NP_440590.1_4 Reverse -162 -175 4.93583 0.0585
NP_440567.1_1 Forward -169 -155 17.4042 0.0153
NP_440567.1_1 Forward -244 -230 13.7659 0.0203
NP_440567.1_1 Reverse -162 -176 7.76774 0.0654
NP_442497.1_10 Forward -169 -160 10.4228 0.0087
NP_442497.1_10 Reverse -162 -171 10.4228 0.0087
NP_442497.1_10 Reverse -237 -246 0.688044 0.141
NP_442497.1_10 Forward -244 -235 0.589713 0.153
NP_440821.1_4 Forward -172 -162 18.2696 0.00448
NP_440821.1_4 Reverse -159 -169 9.41981 0.0286
NP_440821.1_4 Reverse -234 -244 9.32148 0.03
NP_440821.1_4 Forward -247 -237 0.373358 0.18
NP_441239.1_9 Forward -134 -122 11.5437 0.0589
NP_441239.1_9 Reverse -121 -133 10.8554 0.0714
NP_441239.1_9 Reverse -250 -262 8.00379 0.145
NP_441239.1_9 Forward -247 -235 7.4138 0.161
NP_441239.1_9 Reverse -234 -246 6.1355 0.2
NP_441239.1_9 Forward -312 -300 4.5622 0.251
NP_441239.1_9 Forward -263 -251 4.5622 0.251
NP_441239.1_9 Forward -172 -160 4.36554 0.253
NP_441239.1_9 Reverse -159 -171 3.38223 0.285
NP_441009.1_10 Forward -169 -150 15.3382 0.24
NP_441892.1_1 Reverse -227 -244 -3.20608 0.235
NP_441892.1_1 Reverse -152 -169 -4.77938 0.268
NP_441892.1_1 Reverse -243 -260 -4.87771 0.269
NP_440604.1_6 Forward -245 -226 -3.24547 0.225
NP_440604.1_6 Forward -170 -151 -3.83545 0.235
NP_442193.1_8 Forward -173 -154 10.0284 0.286
NP_440354.1_7 Reverse -324 -342 7.39397 0.267
NP_442138.1_10 Reverse -236 -255 5.80098 0.0865
NP_440546.1_4 Reverse -123 -133 12.0821 0.0679
NP_440546.1_4 Forward -261 -251 11.5973 0.0774
NP_440546.1_4 Forward -132 -122 11.3065 0.0872
NP_440546.1_4 Reverse -252 -262 10.2399 0.109
NP_440546.1_4 Forward -170 -160 10.046 0.109
NP_440546.1_4 Reverse -161 -171 10.046 0.109
NP_440546.1_4 Reverse -365 -375 9.56122 0.131
NP_440462.1_6 Reverse -234 -244 12.1731 0.0371
NP_440462.1_6 Forward -172 -162 7.74818 0.0699
NP_440462.1_6 Forward -247 -237 7.64985 0.0705
NP_440462.1_6 Reverse -159 -169 1.35667 0.294
NP_440868.1_4 Forward -174 -162 17.7386 0.0124
NP_440868.1_4 Reverse -157 -169 15.7719 0.0164
NP_440868.1_4 Reverse -248 -260 2.0056 0.167
NP_440868.1_4 Forward -249 -237 2.0056 0.167
NP_440868.1_4 Reverse -232 -244 -0.74767 0.282
NP_442479.1_5 Forward -272 -253 8.53829 0.222
NP_442479.1_9 Reverse -284 -303 -4.42544 0.252
NP_442479.1_9 Forward -293 -274 -13.1769 0.288
NP_441868.1_4 Reverse -98 -112 18.0925 0.178
NP_441084.1_6 Forward -134 -120 15.3555 0.0931
NP_441084.1_6 Forward -263 -249 14.095 0.11
NP_439942.1_7 Forward -57 -38 1.47442 0.198
NP_440696.1_6 Forward -137 -118 6.78429 0.266
NP_442358.1_1 Forward -178 -160 14.6705 0.234
NP_442039.1_4 Forward -169 -162 15.1821 0.0124
NP_442039.1_4 Reverse -162 -169 15.1821 0.0124
NP_442039.1_7 Forward -308 -298 15.3197 0.211
NP_442039.1_7 Forward -259 -249 13.2547 0.211
NP_441811.1_8 Forward -176 -162 6.88276 0.259
NP_440753.1_5 Reverse -23 -42 10.6192 0.208
NP_440825.1_6 Forward -295 -276 6.88262 0.295
NP_440825.1_7 Forward -169 -159 12.9096 0.152
NP_442837.1_3 Forward -169 -162 15.7721 0.0124
NP_442837.1_3 Reverse -162 -169 15.7721 0.0124
NP_442837.1_3 Forward -244 -237 12.1338 0.0702
NP_442837.1_3 Reverse -237 -244 6.0373 0.25
NP_440160.1_2 Forward -351 -332 -5.80207 0.277
NP_439994.1_3 Reverse -160 -179 8.73121 0.28
NP_442053.1_1 Forward -170 -161 18.3876 0.0007
NP_442053.1_1 Reverse -161 -170 18.3876 0.0007
NP_442053.1_1 Forward -245 -236 16.3227 0.00389
NP_442053.1_1 Reverse -236 -245 8.65285 0.0741
NP_440505.1_3 Forward -172 -162 16.303 0.00696
NP_440505.1_3 Reverse -363 -373 13.353 0.0331
NP_440505.1_3 Reverse -159 -169 9.22315 0.122
NP_440505.1_3 Forward -247 -237 6.07655 0.197
NP_440505.1_3 Forward -306 -296 5.68323 0.217
NP_440505.1_3 Reverse -234 -244 4.99491 0.252
NP_441701.1_3 Forward -58 -41 6.62702 0.278
NP_441408.2_7 Forward -140 -121 -2.55715 0.272
NP_440914.1_1 Forward -170 -160 17.5935 0.000537
NP_440914.1_1 Reverse -161 -171 17.5935 0.000537
NP_440914.1_1 Forward -114 -104 10.3717 0.142
NP_441011.1_8 Forward -169 -160 8.25953 0.144
NP_441011.1_8 Reverse -162 -171 8.25953 0.144
NP_441011.1_8 Reverse -237 -246 7.27622 0.179
NP_441011.1_8 Forward -244 -235 7.07956 0.179
NP_441011.1_8 Forward -131 -122 5.01461 0.289
NP_442101.1_10 Reverse -153 -172 -7.08038 0.209
NP_442533.1_6 Forward -170 -161 17.2076 0.00137
NP_442533.1_6 Reverse -161 -170 17.2076 0.00137
NP_442533.1_6 Forward -132 -123 14.4544 0.013
NP_442533.1_6 Forward -245 -236 7.57121 0.0898
NP_442533.1_6 Reverse -236 -245 7.47288 0.0898
NP_442533.1_6 Reverse -105 -114 6.98123 0.0992
NP_442533.1_6 Reverse -123 -132 6.78456 0.103
NP_442533.1_6 Reverse -252 -261 4.62128 0.179
NP_442533.1_6 Forward -114 -105 3.93297 0.197
NP_442533.1_6 Forward -255 -246 2.75299 0.241
NP_442533.1_6 Reverse -46 -55 2.16301 0.27
NP_442232.1_3 Reverse -43 -62 -15.8318 0.296
NP_442322.1_3 Reverse -364 -378 16.5192 0.282
NP_442229.1_1 Forward -134 -120 6.88214 0.202
NP_441482.1_7 Forward -138 -124 -5.31028 0.179
NP_441482.1_7 Forward -261 -247 -9.04686 0.193
NP_441482.1_7 Forward -251 -237 -11.8001 0.284
NP_439944.1_9 Reverse -162 -172 19.0562 0.00329
NP_439944.1_9 Forward -169 -159 10.5014 0.0887
NP_441028.1_6 Reverse -36 -46 5.48612 0.255
NP_441028.1_6 Reverse -289 -299 5.19112 0.265
NP_440116.1_8 Forward -169 -150 -7.86702 0.24
NP_440115.1_6 Forward -173 -163 8.4365 0.13
NP_440115.1_6 Reverse -158 -168 8.33817 0.13
NP_439965.1_1 Reverse -227 -246 -9.24366 0.284
NP_441680.1_4 Forward -348 -329 -1.08219 0.256
NP_441680.1_4 Forward -168 -149 -3.63879 0.3
NP_441170.1_4 Reverse -152 -170 5.72234 0.22
NP_441972.1_5 Forward -169 -150 -7.27704 0.247
NP_441106.1_1 Forward -171 -162 9.63616 0.0311
NP_441106.1_1 Reverse -160 -169 9.63616 0.0311
NP_441106.1_1 Forward -246 -237 8.55452 0.0538
NP_441106.1_1 Reverse -235 -244 8.45619 0.0548
NP_441106.1_1 Forward -133 -124 5.50626 0.145
NP_441106.1_1 Forward -262 -253 4.62128 0.213
NP_441106.1_1 Reverse -122 -131 4.32629 0.227
NP_440429.1_2 Forward -260 -241 7.27595 0.289
NP_442992.1_5 Reverse -352 -371 19.5673 0.246
NP_441869.1_2 Forward -268 -249 14.2574 0.183
NP_439903.1_6 Forward -264 -245 -0.591301 0.283
NP_442928.1_6 Reverse -246 -259 17.1289 0.275
NP_441286.1_1 Reverse -160 -172 21.3768 0.00196
NP_441286.1_1 Forward -171 -159 12.9203 0.00815
NP_441286.1_1 Forward -246 -234 -4.87757 0.18
NP_440670.1_8 Forward -170 -161 18.3876 0.000699
NP_440670.1_8 Reverse -161 -170 18.3876 0.000699
NP_440670.1_8 Reverse -236 -245 9.53783 0.0559
NP_440670.1_8 Forward -245 -236 9.14451 0.0583
NP_440670.1_8 Forward -238 -229 3.93297 0.212
NP_440886.1_7 Forward -246 -236 8.43603 0.0805
NP_440886.1_7 Reverse -235 -245 8.14104 0.0805
NP_440886.1_7 Forward -171 -161 7.94438 0.0805
NP_440886.1_7 Reverse -160 -170 7.94438 0.0805
NP_440886.1_7 Forward -343 -333 4.60114 0.227
NP_440886.1_7 Forward -375 -365 3.51951 0.279
NP_442614.1_2 Reverse -161 -175 16.4209 0.0675
NP_442614.1_2 Forward -170 -156 13.4709 0.124
NP_439995.1_5 Reverse -226 -245 9.14423 0.235
NP_442072.1_9 Forward -171 -153 -20.532 0.204
NP_442072.1_9 Forward -246 -228 -22.2037 0.225
NP_442072.1_9 Reverse -235 -253 -23.187 0.284
NP_441753.1_10 Reverse -152 -171 6.09597 0.186
NP_441808.1_8 Reverse -347 -366 5.89931 0.294
NP_440907.2_8 Forward -169 -159 7.64939 0.117
NP_440907.2_8 Reverse -237 -247 4.69947 0.25
NP_442264.1_2 Forward -174 -157 10.6586 0.187
NP_439967.1_7 Forward -171 -153 18.702 0.104
NP_441021.1_8 Forward -250 -232 3.3624 0.229
NP_441021.1_8 Reverse -238 -256 2.18243 0.251
NP_441021.1_8 Reverse -156 -174 0.904127 0.291
NP_441463.1_3 Reverse -226 -245 5.50599 0.074
NP_441463.1_6 Forward -172 -158 8.34861 0.25
NP_441626.1_2 Forward -169 -162 15.7721 0.0124
NP_441626.1_2 Reverse -162 -169 15.7721 0.0124
NP_441626.1_2 Reverse -237 -244 6.13563 0.177
NP_441626.1_2 Forward -244 -237 5.93897 0.231
NP_442365.1_7 Forward -174 -155 13.3725 0.0723
NP_442794.1_1 Reverse -13 -25 12.6253 0.0721
NP_442794.1_1 Reverse -157 -169 2.69391 0.286
NP_440387.1_1 Forward -170 -154 13.6282 0.00825
NP_440387.1_1 Reverse -236 -252 8.22001 0.0282
NP_440387.1_1 Reverse -161 -177 3.79511 0.0519
NP_441431.1_2 Forward -264 -250 13.372 0.0918
NP_441993.1_1 Reverse -330 -349 6.13735 0.186
NP_441993.1_1 Reverse -246 -265 3.70092 0.23
NP_440114.1_10 Reverse -123 -137 11.3077 0.118
NP_440114.1_10 Forward -261 -247 7.66941 0.229
NP_440114.1_10 Forward -170 -156 6.6861 0.26
NP_440114.1_10 Reverse -161 -175 6.09611 0.285
NP_440114.1_10 Forward -132 -118 5.80112 0.292
NP_440492.1_10 Reverse -204 -218 18.6336 0.232
NP_440293.1_3 Reverse -334 -353 -7.08038 0.299
NP_440766.1_4 Forward -249 -235 6.48943 0.101
NP_440766.1_4 Reverse -232 -246 1.37622 0.236
NP_439988.1_7 Reverse -245 -259 14.8469 0.292
NP_441237.1_9 Forward -169 -159 14.828 0.0242
NP_440643.1_6 Forward -143 -124 2.45773 0.26
NP_439910.1_2 Reverse -115 -132 -3.5994 0.0611
NP_439910.1_2 Forward -178 -161 -12.7442 0.0944
NP_442867.1_8 Reverse -325 -344 3.73603 0.297
NP_440457.1_1 Reverse -232 -244 9.28209 0.0929
NP_440457.1_1 Reverse -157 -169 2.69391 0.205
NP_440457.1_1 Forward -174 -162 1.80894 0.223
NP_440798.1_6 Forward -169 -156 15.3589 0.0423
NP_440798.1_6 Reverse -230 -243 3.16588 0.152
NP_441436.1_6 Reverse -236 -255 9.24257 0.26
NP_441436.1_9 Forward -400 -390 17.1874 0.27
NP_440473.1_9 Forward -256 -237 2.45773 0.0985
NP_442509.1_9 Forward -170 -160 8.14104 0.192
NP_442509.1_9 Reverse -161 -171 8.14104 0.192
NP_442509.1_9 Forward -245 -235 7.55106 0.214
NP_442509.1_9 Reverse -236 -246 6.66608 0.259
NP_442509.1_9 Reverse -229 -239 6.27276 0.279
NP_442509.1_9 Forward -304 -294 6.27276 0.279
NP_441489.1_3 Forward -129 -115 7.3645 0.272
NP_440081.1_4 Reverse -258 -277 21.8024 0.0741
NP_440554.1_4 Reverse -253 -263 7.35486 0.103
NP_440554.1_4 Reverse -162 -172 7.05986 0.106
NP_440554.1_4 Reverse -237 -247 6.76487 0.114
NP_440554.1_4 Reverse -124 -134 5.28991 0.153
NP_440554.1_4 Forward -244 -234 4.99491 0.167
NP_441885.1_5 Forward -170 -160 20.9245 0.000538
NP_441885.1_5 Reverse -161 -171 20.9245 0.000538
NP_441885.1_5 Reverse -236 -246 2.04498 0.0868
NP_441885.1_5 Forward -245 -235 1.65166 0.106
NP_441885.1_5 Reverse -105 -115 -0.41329 0.197
NP_440478.1_10 Reverse -250 -264 11.701 0.181
NP_440478.1_10 Reverse -121 -135 11.6026 0.185
NP_442341.1_7 Reverse -160 -174 13.9626 0.0326
NP_442341.1_7 Forward -246 -232 11.701 0.052
NP_442341.1_7 Forward -171 -157 7.9644 0.0956
NP_442341.1_7 Reverse -235 -249 3.24451 0.23
NP_442341.1_9 Reverse -159 -173 7.3738 0.2
NP_442341.1_9 Forward -172 -158 5.99717 0.247
NP_443000.1_7 Forward -172 -162 17.0896 0.00865
NP_443000.1_7 Reverse -159 -169 10.3048 0.0345
NP_443000.1_7 Forward -247 -237 1.74999 0.229
NP_443000.1_7 Forward -134 -124 0.766681 0.29
NP_440076.1_5 Forward -262 -243 11.6017 0.294
NP_440552.1_8 Forward -278 -261 11.9886 0.235
NP_441842.1_1 Forward -168 -155 16.1449 0.0484
NP_441842.1_1 Reverse -163 -176 12.1134 0.226
NP_441842.1_10 Reverse -229 -243 17.6008 0.0215
NP_441842.1_10 Reverse -154 -168 8.65272 0.213
NP_440275.1_3 Forward -172 -162 8.1415 0.0602
NP_440275.1_3 Reverse -159 -169 8.04317 0.0602
NP_440275.1_3 Forward -247 -237 5.78156 0.131
NP_440091.1_1 Reverse -232 -244 10.4621 0.0487
NP_440091.1_1 Reverse -157 -169 8.29878 0.0653
NP_440091.1_1 Forward -174 -162 6.43049 0.095
NP_440679.1_10 Reverse -245 -264 -12.4886 0.198
NP_443010.1_10 Reverse -158 -175 3.06069 0.265
NP_441359.1_5 Reverse -233 -252 5.89931 0.188
NP_439962.1_4 Reverse -51 -70 -9.14533 0.299
NP_442495.1_4 Reverse -364 -374 11.6814 0.264
NP_440149.1_6 Reverse -241 -260 5.89931 0.294
NP_440149.1_8 Forward -170 -151 -1.7705 0.162
NP_440149.1_8 Reverse -161 -180 -7.67036 0.29
NP_440149.1_8 Reverse -144 -163 -8.16202 0.3
NP_441105.1_3 Forward -272 -253 0.687771 0.122
NP_441105.1_3 Reverse -156 -175 -5.80207 0.224
NP_440216.1_1 Forward -170 -156 9.63603 0.00589
NP_440216.1_1 Forward -245 -231 7.86607 0.00793
NP_440216.1_1 Reverse -236 -250 -1.47537 0.0328
NP_440216.1_1 Reverse -161 -175 -9.34185 0.145
NP_440216.1_6 Reverse -229 -245 12.2516 0.0694
NP_440216.1_9 Reverse -279 -288 5.99792 0.289
NP_440172.1_1 Forward -170 -160 15.0247 0.00945
NP_440172.1_1 Reverse -161 -171 15.0247 0.00945
NP_442015.1_10 Reverse -157 -170 10.5407 0.0391
NP_442015.1_10 Forward -174 -161 9.45906 0.0486
NP_442015.1_10 Forward -259 -246 4.05085 0.178
NP_442015.1_10 Forward -249 -236 3.26421 0.184
NP_441226.1_7 Forward -169 -162 14.4934 0.0123
NP_441226.1_7 Reverse -162 -169 14.4934 0.0123
NP_441226.1_7 Reverse -230 -237 6.82361 0.246
NP_441226.1_7 Forward -163 -156 6.52862 0.253
NP_441111.1_7 Forward -169 -161 18.7023 0.00294
NP_441111.1_7 Reverse -162 -170 18.7023 0.00294
NP_441111.1_7 Reverse -237 -245 8.96754 0.0463
NP_441111.1_7 Forward -244 -236 8.86921 0.0589
NP_442379.1_10 Reverse -154 -171 8.59364 0.102
NP_441766.1_2 Forward -170 -161 17.5026 0.00297
NP_441766.1_2 Reverse -161 -170 17.5026 0.00297
NP_441766.1_2 Reverse -236 -245 7.76787 0.0714
NP_441766.1_2 Forward -245 -236 7.76787 0.0714
NP_442417.1_5 Reverse -236 -250 9.63603 0.128
NP_442179.1_3 Forward -169 -150 15.9291 0.109
NP_440416.1_9 Reverse -229 -248 1.96607 0.0415
NP_440416.1_9 Reverse -154 -173 -9.14533 0.127
NP_440416.1_9 Reverse -39 -58 -18.5851 0.26
NP_440416.1_9 Reverse -143 -162 -21.4367 0.294
NP_443052.1_8 Reverse -151 -170 -9.047 0.183
NP_443052.1_8 Reverse -226 -245 -10.4236 0.208
NP_443052.1_8 Forward -255 -236 -13.7669 0.296
NP_441135.1_4 Reverse -239 -258 4.62101 0.284
NP_440591.1_9 Forward -252 -234 7.68896 0.196
NP_440261.1_5 Reverse -162 -175 4.93583 0.0478
NP_440261.1_5 Forward -169 -156 -2.63565 0.0924
NP_440988.1_10 Forward -172 -158 17.6781 0.099
NP_440988.1_10 Forward -241 -227 7.31914 0.216
NP_440988.1_10 Reverse -142 -156 5.38289 0.243
NP_440988.1_10 Reverse -103 -117 4.31795 0.266
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

CTGCCCAAGCTGTACAAGCAGGTTTACCCTATCCCCTGGTACAGGAACTTGGCCAAGCACCCACCACGGAAGCAGGGTTAAAGCTATTACGCCACTGGCAAACGGAGCAAAATTGTCCTTGGGTTAGCAAAATTTACCAAGCCATGGCGGACACCGTCGATCGCCGTTCGGAGGAATATGTTTATAAAGTCAGTCAACATCAATTAAAAGTGGGCAGTTTACTATTTGATGGCGATCGCCAACCGGTGGCAATTAGTACTCAAGGTCAGGCCATGGCTGATAAATTGGGGATGACCATACCAGAAACTTAGCTTCCTGCTTAAAGAAAACCCCACAATTCCGGGGAGGCACAGCCTAGGGGATAATGGGAAAGTTGCCATTTGGAGGGAGACAGTAGACC

CDS

ATGCGCATTTTAATTATGGGAGGAACCCGTTTTATCGGTATCCATCTCTGCCGGGTGCTGGTGGCCCAAGGTCATGAAGTGGTCCTATTCAATCGGGGAAATCGTCCTGACCCCGTCAATGGCGTGGCCCAAATCCATGGCGATCGCCGGGTCGCTGAACAGTTGCGCGAAAAACTAGAAAAGGAAGAATTTGACGTAATTTTTGACAACAACGGTCGGGAGTTGAGCGATACCCAGCCCCTGGTGGACTTGTACAATGGCCGAGTACAGCAATTCGTTTACATGAGTTCCGCTGGGGTTTACCAAGCATCATCCCAAATGCCCCACCGGGAGACCGATGCGGTGGATCCCCAGAGTCGCCACAAAGGCAAATTTGAAACGGAACGCTATCTAGCCCAGAGCGGCATTCCCTGGACTGCCATCCGCCCCACCTATATTTACGGTCCCCACAATTACAATGCCCTCGAATCCTGGTTTTTTGACCGTTTAGTGAGGGGTCGAGCCATTCCCATCCCCGGTAATGGTCAATACATCACCCAACTGGGCCATGTGGAAGATTTGGCGATCGCCATGGCCAAAACCATTGTTACCCCAGCAGCGATCGGGCAGATTTATAACATCTCCGGCGATCGATACGTCACCATGAATGGTCTAGCTCAAGCCTGTGCCACCGCGGCGGGTCTTGATCCCCAGGGCGTTAAATTAGTCCACTATGACCCCAAGGATTTTGACTTTGGTAAACGCAAAGCTTTTCCCCTGCGTCAACAACACTTTTTTGCCGATATTCAAAAAGCCCAAGACCATTTAGATTGGCATCCCAATTATGGTTTAGTAGAAGGCTTAAAAAATAGCTTTCAACTGGATTATCTGCCGTCCGGTAAAGGGGAGGAAAAAGGAGATTTTGACCTAGACGAGCAAATCCTGGCATTCAGTTAA

Protein

MRILIMGGTRFIGIHLCRVLVAQGHEVVLFNRGNRPDPVNGVAQIHGDRRVAEQLREKLEKEEFDVIFDNNGRELSDTQPLVDLYNGRVQQFVYMSSAGVYQASSQMPHRETDAVDPQSRHKGKFETERYLAQSGIPWTAIRPTYIYGPHNYNALESWFFDRLVRGRAIPIPGNGQYITQLGHVEDLAIAMAKTIVTPAAIGQIYNISGDRYVTMNGLAQACATAAGLDPQGVKLVHYDPKDFDFGKRKAFPLRQQHFFADIQKAQDHLDWHPNYGLVEGLKNSFQLDYLPSGKGEEKGDFDLDEQILAFS