Your browser is old and dusty. Try Google Chrome!

Details for slr1434

ORF slr1434
Accession NP_440860.1
Symbol pntB
Category Nicotinate and nicotinamide
Definition pyridine nucleotide transhydrogenase beta subunit
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_440795.1_7 Forward -99 -92 11.7405 0.0778
NP_440259.1_4 Reverse -316 -330 10.4676 0.262
NP_442752.1_4 Forward -208 -201 5.44732 0.202
NP_442752.1_4 Reverse -71 -78 5.34899 0.221
NP_443027.1_4 Forward -102 -92 6.96153 0.253
NP_441812.1_3 Reverse -18 -32 6.6861 0.298
NP_442909.1_7 Forward -79 -65 6.98048 0.233
NP_440061.1_9 Reverse -106 -120 7.3738 0.209
NP_440061.1_9 Forward -162 -148 5.01387 0.298
NP_442062.1_8 Forward -167 -157 11.9764 0.0377
NP_442972.1_2 Forward -337 -323 15.2402 0.136
NP_440304.1_4 Reverse -117 -127 4.50326 0.261
NP_440044.1_8 Reverse -92 -111 3.53937 0.128
NP_439918.1_2 Reverse -38 -57 -1.86883 0.24
NP_439918.1_3 Reverse -375 -394 2.94938 0.271
NP_441083.1_5 Forward -80 -70 6.96153 0.0717
NP_442827.1_8 Reverse -63 -82 -0.689632 0.234
NP_441434.1_7 Forward -165 -151 1.67122 0.299
NP_440109.1_4 Forward -345 -326 17.2074 0.225
NP_441738.1_2 Reverse -201 -208 10.2652 0.101
NP_442889.1_10 Reverse -279 -298 18.1054 0.147
NP_440447.1_1 Reverse -185 -203 6.60732 0.194
NP_442445.1_1 Forward -122 -103 12.8808 0.24
NP_441163.1_1 Forward -193 -176 10.8545 0.203
NP_440906.1_5 Reverse -92 -99 9.47889 0.116
NP_441486.1_1 Reverse -155 -169 3.63784 0.0563
NP_440842.1_10 Forward -189 -175 2.65453 0.274
NP_442848.1_5 Forward -153 -135 -2.14413 0.278
NP_441634.1_9 Forward -122 -103 8.65176 0.294
NP_440376.1_1 Forward -167 -158 4.42462 0.159
NP_440376.1_1 Reverse -71 -80 3.44131 0.203
NP_440376.1_1 Forward -208 -199 -0.0986038 0.285
NP_441857.1_6 Reverse -37 -47 15.6147 0.215
NP_442730.1_8 Forward -153 -134 3.73524 0.275
NP_442687.1_7 Reverse -157 -167 12.3697 0.0768
NP_441846.1_10 Forward -218 -199 -22.6167 0.264
NP_442530.1_2 Forward -180 -170 13.1564 0.263
NP_440642.1_10 Reverse -99 -113 2.5556 0.277
NP_440642.1_10 Reverse -100 -114 2.35894 0.277
NP_440571.1_4 Reverse -150 -169 16.7149 0.182
NP_442658.1_1 Reverse -156 -166 11.1893 0.0915
NP_441487.1_9 Forward -168 -149 -0.688862 0.262
NP_442937.1_5 Forward -389 -370 5.89931 0.295
NP_441127.1_1 Forward -188 -174 10.3243 0.251
NP_439905.1_2 Reverse -103 -117 9.34103 0.233
NP_443055.1_6 Forward -160 -142 1.98502 0.222
NP_441000.1_5 Forward -39 -20 4.03023 0.286
NP_441041.1_7 Forward -83 -71 5.47405 0.255
NP_442004.1_6 Reverse -345 -359 4.81781 0.202
NP_440289.1_2 Reverse -189 -202 -5.19226 0.3
NP_441678.1_9 Forward -219 -200 4.71934 0.197
NP_442281.1_1 Reverse -153 -167 3.24392 0.238
NP_442281.1_1 Reverse -194 -208 2.8506 0.253
NP_441556.1_7 Reverse -108 -127 -0.0996487 0.3
NP_441644.1_6 Forward -80 -70 3.51951 0.277
NP_441346.1_7 Forward -163 -144 11.0125 0.238
NP_440891.1_8 Reverse -206 -225 14.3634 0.265
NP_441762.1_7 Forward -168 -156 1.7106 0.0735
NP_441762.1_7 Reverse -133 -145 -3.50094 0.11
NP_441762.1_7 Reverse -157 -169 -7.33585 0.287
NP_442301.1_2 Forward -90 -71 4.12856 0.284
NP_440379.1_5 Forward -161 -142 -8.752 0.254
NP_440464.1_10 Reverse -212 -222 11.6713 0.287
NP_441876.1_9 Forward -155 -145 13.1559 0.267
NP_441637.1_9 Forward -167 -149 -0.374176 0.292
NP_442719.1_2 Forward -167 -149 8.96649 0.0946
NP_442719.1_2 Forward -166 -148 -11.3879 0.291
NP_442227.1_2 Reverse -201 -220 2.94938 0.223
NP_441114.1_3 Forward -184 -175 7.37455 0.239
NP_441114.1_3 Reverse -200 -209 7.27622 0.247
NP_441534.1_5 Reverse -280 -299 0.687771 0.293
NP_441557.1_5 Reverse -158 -167 -0.491928 0.193
NP_442962.1_1 Reverse -323 -342 8.45592 0.239
NP_442166.1_7 Forward -353 -339 7.9644 0.26
NP_441549.1_9 Reverse -67 -85 -0.177514 0.135
NP_442347.1_2 Reverse -200 -209 3.83464 0.284
NP_442347.1_2 Forward -79 -70 3.7363 0.284
NP_442645.1_2 Reverse -150 -169 -13.2752 0.148
NP_442645.1_2 Reverse -168 -187 -17.1101 0.248
NP_441633.1_3 Forward -386 -373 -4.11062 0.181
NP_440640.1_7 Reverse -151 -170 19.469 0.0594
NP_441559.1_8 Reverse -114 -128 0.88457 0.16
NP_441559.1_8 Forward -190 -176 -4.91696 0.241
NP_441395.1_8 Forward -333 -314 10.1275 0.181
NP_442158.1_4 Reverse -323 -333 16.4013 0.129
NP_440677.1_1 Forward -194 -175 5.99764 0.285
NP_442386.1_5 Forward -332 -313 14.3549 0.1
NP_442386.1_9 Reverse -157 -166 9.93072 0.144
NP_442386.1_10 Reverse -141 -154 4.54251 0.262
NP_442714.1_5 Reverse -153 -172 5.89931 0.238
NP_441134.1_5 Forward -348 -331 14.1985 0.0517
NP_439996.1_6 Reverse -81 -100 6.55281 0.296
NP_439937.1_9 Reverse -175 -192 -13.2365 0.283
NP_440408.1_7 Reverse -136 -155 7.96426 0.284
NP_440439.1_1 Forward -211 -198 -1.16069 0.255
NP_440439.1_1 Reverse -68 -81 -1.75067 0.281
NP_439943.1_7 Forward -133 -114 7.17762 0.208
NP_441138.1_5 Reverse -323 -336 3.3085 0.297
NP_439977.1_7 Reverse -165 -184 13.0766 0.262
NP_441155.1_10 Reverse -307 -326 17.6982 0.299
NP_442384.1_10 Forward -80 -67 2.87088 0.21
NP_440693.1_8 Forward -219 -200 11.9958 0.283
NP_442114.1_8 Forward -337 -323 4.91554 0.246
NP_441689.1_5 Reverse -69 -79 7.64939 0.197
NP_440531.1_6 Forward -151 -132 -0.39387 0.211
NP_441060.1_3 Reverse -145 -164 10.0292 0.218
NP_441335.1_8 Reverse -147 -166 6.29264 0.287
NP_442832.1_3 Forward -167 -148 12.2908 0.288
NP_442750.1_6 Reverse -11 -30 14.2574 0.295
NP_442065.1_3 Reverse -161 -179 12.0155 0.295
NP_442280.1_10 Reverse -104 -122 9.35044 0.233
NP_440888.1_2 Forward -80 -66 8.25877 0.167
NP_440888.1_2 Reverse -176 -190 6.98048 0.212
NP_442845.1_2 Forward -214 -200 5.1128 0.243
NP_442845.1_2 Forward -360 -346 3.93283 0.272
NP_441319.1_5 Forward -166 -147 13.6675 0.236
NP_441469.1_8 Forward -186 -177 10.3245 0.223
NP_443064.1_6 Forward -80 -70 8.39772 0.292
NP_440148.1_1 Reverse -1 -20 -5.01543 0.231
NP_441462.1_2 Reverse -71 -81 -1.00328 0.274
NP_441560.1_5 Forward -245 -226 14.2574 0.239
NP_440454.1_2 Reverse -237 -251 12.903 0.227
NP_442428.1_5 Reverse -92 -99 3.77569 0.277
NP_440603.1_9 Forward -166 -147 5.01433 0.278
NP_440436.1_4 Forward -166 -157 5.60418 0.188
NP_441884.1_9 Forward -83 -64 -24.0916 0.284
NP_441336.1_4 Reverse -214 -233 16.9124 0.18
NP_440041.1_6 Forward -167 -148 8.94676 0.285
NP_442813.1_4 Forward -290 -271 -8.65367 0.299
NP_440094.1_8 Reverse -168 -187 9.83255 0.0898
NP_443054.1_2 Forward -89 -75 4.81781 0.24
NP_443054.1_2 Reverse -69 -83 0.88457 0.252
NP_441851.1_10 Reverse -157 -167 4.89658 0.24
NP_441851.1_10 Forward -209 -199 4.40493 0.271
NP_442622.1_1 Forward -204 -185 -13.0786 0.282
NP_441982.1_6 Reverse -216 -225 12.7718 0.274
NP_441409.1_6 Reverse -130 -149 -14.6519 0.263
NP_442843.1_1 Reverse -63 -82 -11.8986 0.295
NP_439960.1_6 Forward -152 -133 18.6823 0.0955
NP_441477.1_10 Forward -81 -63 2.47742 0.239
NP_441078.1_4 Forward -80 -71 -2.06522 0.295
NP_442348.1_2 Forward -208 -199 15.3394 0.146
NP_441432.1_8 Reverse -70 -79 5.3096 0.17
NP_441432.1_8 Forward -118 -109 2.85133 0.281
NP_441432.1_8 Forward -101 -92 2.75299 0.287
NP_442344.1_7 Forward -166 -147 9.3409 0.0407
NP_441057.1_4 Forward -161 -143 6.90232 0.18
NP_442489.1_7 Forward -167 -158 -1.6719 0.235
NP_442489.1_7 Forward -80 -71 -1.86856 0.259
NP_440426.1_7 Reverse -180 -199 1.76941 0.221
NP_440860.1_6 Forward -383 -364 12.1925 0.293
NP_442913.1_10 Reverse -142 -161 -4.6221 0.242
NP_442346.1_5 Forward -101 -91 5.78156 0.229
NP_441786.1_3 Forward -122 -103 6.39097 0.29
NP_441502.1_5 Reverse -213 -232 12.4875 0.221
NP_441502.1_8 Reverse -140 -159 11.2092 0.221
NP_441329.1_6 Forward -330 -311 2.33913 0.227
NP_441973.1_1 Reverse -106 -121 -7.88658 0.293
NP_441915.1_4 Forward -153 -134 5.2102 0.3
NP_442199.1_7 Reverse -239 -258 11.405 0.118
NP_442199.1_7 Reverse -271 -290 7.86512 0.155
NP_442199.1_7 Reverse -215 -234 0.293673 0.286
NP_442089.1_1 Reverse -131 -150 -2.0655 0.288
NP_441951.1_9 Reverse -184 -203 -0.885524 0.283
NP_442568.1_8 Forward -327 -313 7.76774 0.296
NP_442270.1_9 Forward -280 -261 -9.73531 0.242
NP_440219.1_1 Reverse -17 -36 12.7459 0.259
NP_441617.1_6 Reverse -44 -63 1.0811 0.213
NP_440462.1_4 Reverse -84 -98 5.50613 0.29
NP_442465.1_9 Reverse -153 -167 9.04604 0.298
NP_442340.1_3 Reverse -178 -197 -1.67217 0.188
NP_441582.1_5 Reverse -174 -193 13.47 0.126
NP_442402.1_4 Reverse -203 -222 -8.26108 0.278
NP_442402.1_10 Forward -156 -146 14.5325 0.18
NP_440505.1_3 Reverse -69 -79 12.2714 0.0543
NP_440505.1_3 Forward -210 -200 10.8948 0.0924
NP_442532.1_1 Reverse -26 -40 11.6685 0.215
NP_440914.1_1 Reverse -199 -209 11.8356 0.0767
NP_441011.1_8 Reverse -92 -101 5.50626 0.256
NP_441011.1_8 Reverse -159 -168 5.11294 0.283
NP_442533.1_6 Forward -80 -71 4.32629 0.184
NP_443016.1_1 Forward -166 -147 -3.73712 0.225
NP_441028.1_6 Reverse -105 -115 3.42118 0.296
NP_441527.1_4 Forward -326 -307 -11.7937 0.284
NP_439903.1_6 Forward -83 -64 5.01354 0.187
NP_441705.1_3 Reverse -134 -153 8.55425 0.167
NP_441930.1_2 Forward -186 -176 12.3697 0.262
NP_442614.1_2 Forward -188 -174 8.16106 0.255
NP_440404.1_9 Forward -315 -296 9.40553 0.236
NP_442072.1_9 Reverse -70 -88 -22.6953 0.253
NP_441021.1_8 Reverse -336 -354 2.28076 0.25
NP_440841.1_4 Forward -119 -100 -10.0303 0.27
NP_442365.1_7 Reverse -201 -220 -2.75381 0.204
NP_442365.1_7 Reverse -67 -86 -4.81876 0.25
NP_442615.1_1 Reverse -149 -167 -7.35568 0.287
NP_440114.1_10 Reverse -71 -85 14.2576 0.0429
NP_440114.1_10 Forward -354 -340 7.57108 0.231
NP_441720.1_2 Reverse -72 -91 10.3234 0.213
NP_441720.1_2 Forward -84 -65 6.48849 0.217
NP_439988.1_3 Reverse -138 -152 10.9143 0.219
NP_439910.1_2 Forward -175 -158 -22.3806 0.232
NP_442582.1_3 Reverse -279 -293 12.8075 0.284
NP_443037.1_7 Forward -172 -153 -5.21209 0.276
NP_442514.1_5 Forward -200 -181 -9.14605 0.294
NP_441885.1_5 Forward -80 -70 -1.00328 0.248
NP_441466.1_4 Reverse -165 -184 6.29264 0.295
NP_442341.1_7 Reverse -175 -189 4.42448 0.191
NP_441173.1_9 Forward -155 -147 12.0154 0.214
NP_441173.1_9 Forward -338 -330 11.7204 0.226
NP_441173.1_9 Reverse -182 -190 10.2454 0.261
NP_440423.1_10 Reverse -64 -83 10.1275 0.259
NP_443000.1_7 Forward -102 -92 4.10993 0.219
NP_441842.1_10 Reverse -272 -286 6.48943 0.286
NP_441902.1_3 Reverse -146 -156 12.6902 0.236
NP_443010.1_10 Forward -83 -66 4.2203 0.237
NP_442451.1_2 Reverse -63 -82 -9.83364 0.26
NP_442638.1_3 Reverse -274 -293 10.4559 0.298
NP_439962.1_8 Forward -190 -171 7.96426 0.21
NP_441105.1_3 Reverse -97 -116 -8.752 0.278
NP_440216.1_9 Forward -121 -112 9.83282 0.286
NP_440172.1_1 Reverse -119 -129 9.12481 0.0586
NP_442015.1_10 Reverse -383 -396 1.59258 0.204
NP_441111.1_7 Forward -166 -158 -0.668896 0.274
NP_440415.1_9 Reverse -86 -105 15.0441 0.281
NP_440244.1_1 Forward -120 -101 4.62101 0.186
NP_442226.1_1 Forward -119 -100 10.3242 0.281
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

TCTTGATCATCAAACTGGTAGTCACCGTATTTGGTACTCCTATGATAAGCATCGCTTGTCCGTTCAACCAACAAAAAATGGTCAAGCAAAAGCTTATCAAGTTAAGCAATTTCTCAATCTTCTTCAGGAGTGATTATGACTGTTAGTAATATTTTTGATGGTTACACAATCAATCTTTTTCAGGATGAAGATGGGGATTGGTTAGCTTGCTTGGCGGAAATGCCCAATGTTTCAGCGTTTGCCGATTCTCCCCAAGCCGCTCTTGCTGAATTAGAAATTGCCTGGCAAGGGGTAAAGGAAAGCTATCACAAACACGGAGAGCCGATTCCCATCATTGAAAGGGTTTATGCAAAACCCTAATCCTTTACTTAAATTGATAACCAATTACCACTAAATTCTT

CDS

ATGTCTAACAGTTTACAAACCGTGGCCTATGTGGCCGCCAGCATATTATTTATCTTCAGCCTGGGGGGCCTGGCCAATCAGGAAACTGCCCGGCGGGGAAATGTTTATGGCATTGCCGGCATGGCGATCGCCTTTTTAGCCACTGCTTTAGGGGGCGACTTTACTGGTTACACCACTCTGCTGGGGGCAATTTTACCTGCGGTGGTTATCGGCTCCCTGTTAGCCTCCCGAGTAGCCATGACTTCCATGCCGGAACTAGTGGCGATTTTGCACAGTTTTGTGGGTTTAGCGGCGGTTTTGGTAGGTATTGCCAATTACCTAGCCCCGGAAAATGGTTTAGCGGGTTCCGAAGCTTTTATCCATCAAATTGAAATTTATGTAGGCGTATTCATTGGGGCTGTTACCTTCACCGGCTCCATCGTGGCCTTTGGCAAATTGCGGGCCATTATCAGCAGTAAACCACTCATGCTCCCGGCTCGGCACTTCTTGAACATTTCCCTGCTGGTGGCTACGGTGATTTTCGGGGTGCAGTTTATGCAATTGAATAGCCCCGCTGGCTTGACCCCCCTGTTAATCATGACCGCCATTGCCGGGGTGTTGGGTCTGCATCTCGTAGCGGCGATCGGGGGGGCAGATATGCCGGTGGTCATTTCCATGCTCAACAGCTATTCTGGCTGGGCGGCGGCGGCGGCGGGCTTTATGCTCTCCAATGATCTACTGATCATCACTGGGGCGTTGGTGGGAAGCAGTGGCGCAATTTTGAGCTACATCATGTGTAAGGCCATGAACCGTTCTTTTATCAGCGTTATCCTGGGTGGTTTTGGCGAAGGTTCTAGTGCTGCTTCCAAAGGGCCAGCCCAGGAGGTAATTGGTACAGTCACTAAAACTAGTGCGGAAGAAGTCGCGGAGGAATTGCTCGATGCCCAGAGCGTGATCATTACCCCCGGTTACGGTATGGCGGTGGCCCAAGCTCAACATCCCGTGGCAGAAATTACCAAATTACTCAAGGAAAAGGGTGTTAAGGTCAGGTTTGGCATTCATCCTGTCGCTGGTCGTTTGCCTGGCCACATGAACGTTCTGTTAGCGGAAGCCAATGTGCCCTACGACGTAGTGCTGGAAATGGACGAAATTAATGAAGATTTCCCCGAAACCGATGTGGTGCTAGTGATTGGCGCCAATGACACGGTGAACCCCAGTGCTTTGGAAGATCCCACCAGTGCGATCGCCGGAATGCCGGTGTTGGAAGTGTGGAAAGCCAAACAGGTGGTGGTGATGAAACGGAGCATGGCTTCCGGTTATGCTGGGGTAGAAAATCCTTTGTTTTATAAGGAAAATACCCAAATGCTGTTCGGCGATGCCAAGAAAAATGTCGATGCCATTTTGACCCAAATGCGGGCTAAGGATGAGGTGGGCAGTGGCGATAAGGTTCTAGTTTCCGTTTAG

Protein

MSNSLQTVAYVAASILFIFSLGGLANQETARRGNVYGIAGMAIAFLATALGGDFTGYTTLLGAILPAVVIGSLLASRVAMTSMPELVAILHSFVGLAAVLVGIANYLAPENGLAGSEAFIHQIEIYVGVFIGAVTFTGSIVAFGKLRAIISSKPLMLPARHFLNISLLVATVIFGVQFMQLNSPAGLTPLLIMTAIAGVLGLHLVAAIGGADMPVVISMLNSYSGWAAAAAGFMLSNDLLIITGALVGSSGAILSYIMCKAMNRSFISVILGGFGEGSSAASKGPAQEVIGTVTKTSAEEVAEELLDAQSVIITPGYGMAVAQAQHPVAEITKLLKEKGVKVRFGIHPVAGRLPGHMNVLLAEANVPYDVVLEMDEINEDFPETDVVLVIGANDTVNPSALEDPTSAIAGMPVLEVWKAKQVVVMKRSMASGYAGVENPLFYKENTQMLFGDAKKNVDAILTQMRAKDEVGSGDKVLVSV