Your browser is old and dusty. Try Google Chrome!

Details for slr0929

ORF slr0929
Accession NP_442781.1
Symbol
Category chromosome partitioning protein, ParA family
Definition DNA replication, restriction, modification, recombination, and repair
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_441061.1_7 Forward -326 -307 13.0775 0.282
NP_441623.1_1 Forward -145 -127 -3.81576 0.269
NP_441818.1_9 Forward -347 -328 -9.14533 0.287
NP_441818.1_9 Reverse -178 -197 -10.522 0.295
NP_442752.1_4 Reverse -190 -197 9.47889 0.109
NP_442752.1_4 Forward -332 -325 5.25066 0.256
NP_442181.1_1 Reverse -129 -148 18.3873 0.0849
NP_441161.1_1 Reverse -352 -371 13.3716 0.272
NP_441935.1_1 Forward -331 -312 8.75091 0.225
NP_441619.1_7 Forward -192 -173 27.4338 0.000649
NP_441109.1_4 Forward -152 -133 18.0924 0.123
NP_440856.1_7 Forward -215 -196 2.3594 0.157
NP_441083.1_3 Forward -12 -2 16.3025 0.104
NP_441083.1_5 Reverse -323 -333 -0.904945 0.283
NP_439957.1_9 Forward -99 -80 3.77151 0.3
NP_442889.1_1 Reverse -124 -143 -14.8485 0.283
NP_442570.1_3 Forward -325 -306 -7.96535 0.279
NP_440343.1_9 Forward -291 -272 9.63589 0.248
NP_441209.1_8 Forward -119 -101 6.35567 0.296
NP_440403.1_10 Reverse -203 -222 1.17943 0.291
NP_441014.1_10 Forward -369 -350 7.27514 0.152
NP_441634.1_8 Reverse -187 -201 -0.983719 0.274
NP_441857.1_8 Forward -386 -367 12.4875 0.288
NP_442687.1_7 Reverse -307 -317 3.61828 0.299
NP_440642.1_10 Forward -20 -6 4.71887 0.25
NP_441013.1_3 Forward -334 -315 12.9791 0.201
NP_440656.1_2 Forward -175 -156 4.12936 0.221
NP_440450.1_7 Forward -194 -180 17.8952 0.132
NP_442836.1_5 Forward -278 -259 6.98095 0.171
NP_440203.1_5 Forward -184 -174 11.8776 0.171
NP_439905.1_2 Forward -16 -2 7.9644 0.289
NP_440984.1_7 Reverse -201 -215 10.3243 0.126
NP_439990.1_5 Forward -337 -324 7.6891 0.186
NP_443055.1_6 Reverse -315 -333 9.55647 0.133
NP_440993.1_4 Reverse -308 -325 12.7235 0.171
NP_441294.1_7 Reverse -319 -333 12.6102 0.0916
NP_441674.1_5 Forward -188 -169 -1.7705 0.18
NP_442396.1_5 Reverse -186 -199 10.2457 0.119
NP_441568.1_6 Forward -99 -81 16.9041 0.18
NP_442004.1_6 Forward -203 -189 3.24451 0.244
NP_440289.1_2 Reverse -320 -333 -1.75067 0.246
NP_440177.1_1 Reverse -301 -319 4.24738 0.272
NP_442012.1_1 Reverse -184 -203 2.16274 0.204
NP_441556.1_2 Forward -227 -209 18.997 0.236
NP_441762.1_7 Reverse -193 -205 -4.58258 0.179
NP_440775.1_4 Reverse -224 -243 9.59647 0.266
NP_441096.1_5 Forward -24 -6 14.3747 0.297
NP_441251.1_8 Reverse -240 -253 13.0487 0.254
NP_441612.1_2 Forward -239 -229 9.51741 0.21
NP_442559.1_3 Forward -150 -131 9.14423 0.282
NP_442808.1_1 Reverse -322 -332 13.0576 0.0481
NP_442808.1_1 Reverse -205 -215 1.5529 0.282
NP_441493.2_4 Reverse -181 -200 11.8975 0.241
NP_442789.1_4 Forward -214 -195 -7.96535 0.299
NP_441518.1_3 Reverse -313 -332 -13.8652 0.264
NP_442419.1_2 Reverse -193 -212 -2.45882 0.247
NP_440676.1_7 Forward -209 -190 23.6972 0.00997
NP_441819.1_5 Reverse -105 -124 13.0342 0.224
NP_440899.1_8 Forward -27 -8 -10.3253 0.277
NP_440299.1_1 Forward -15 -2 7.59019 0.109
NP_440299.1_1 Reverse -380 -393 4.44361 0.207
NP_442528.1_6 Reverse -177 -196 9.83255 0.278
NP_442961.1_4 Forward -370 -351 3.34271 0.288
NP_442967.1_10 Reverse -14 -28 15.7065 0.237
NP_441464.1_10 Forward -342 -328 8.84938 0.267
NP_441113.1_3 Reverse -306 -320 16.3219 0.23
NP_442386.1_9 Reverse -205 -214 6.09583 0.23
NP_442186.1_9 Reverse -284 -303 6.09597 0.232
NP_440168.1_9 Forward -214 -195 -4.42544 0.296
NP_442240.1_2 Reverse -168 -187 -18.7818 0.295
NP_439996.1_9 Reverse -140 -159 7.86512 0.299
NP_439937.1_9 Forward -204 -187 -9.20492 0.183
NP_440439.1_1 Reverse -203 -216 -1.45568 0.269
NP_441138.1_5 Reverse -78 -91 5.88678 0.272
NP_441789.1_7 Forward -161 -142 4.52188 0.193
NP_442121.1_4 Forward -148 -129 -0.787193 0.226
NP_442713.1_5 Forward -68 -49 16.7157 0.0258
NP_440344.1_10 Reverse -316 -333 -13.4325 0.285
NP_440075.1_2 Reverse -280 -299 2.26107 0.292
NP_440826.1_5 Reverse -314 -332 13.4468 0.288
NP_441965.1_10 Forward -202 -186 8.71166 0.123
NP_442280.1_10 Forward -21 -3 5.94143 0.28
NP_442033.1_10 Reverse -321 -340 -10.227 0.23
NP_442033.1_10 Reverse -271 -290 -13.4719 0.287
NP_442845.1_2 Forward -221 -207 9.14437 0.18
NP_440722.1_3 Forward -127 -113 18.7808 0.0748
NP_443064.1_6 Forward -199 -189 8.88251 0.262
NP_440257.1_7 Reverse -172 -191 20.6781 0.0858
NP_440148.1_1 Reverse -119 -138 -6.39206 0.264
NP_441621.1_7 Reverse -192 -206 -3.24533 0.188
NP_443062.1_6 Forward -379 -360 1.27776 0.276
NP_441410.1_4 Forward -20 -1 8.4551 0.297
NP_440519.1_8 Reverse -178 -194 3.50012 0.244
NP_440504.1_6 Reverse -242 -260 3.55831 0.281
NP_441785.1_1 Reverse -101 -115 12.7383 0.244
NP_440673.1_7 Forward -210 -191 11.2092 0.111
NP_441884.1_9 Forward -215 -196 -25.0749 0.29
NP_440314.1_9 Reverse -324 -343 -4.52377 0.209
NP_442176.1_1 Forward -272 -253 3.73603 0.294
NP_441034.1_2 Reverse -365 -384 16.7589 0.215
NP_440094.1_1 Forward -187 -168 8.55425 0.0868
NP_441668.1_4 Reverse -180 -199 3.6377 0.187
NP_441668.1_4 Forward -50 -31 -2.55715 0.291
NP_442335.1_10 Reverse -174 -188 19.1741 0.291
NP_440943.1_6 Reverse -177 -196 17.404 0.202
NP_441570.1_1 Reverse -267 -285 -17.0904 0.264
NP_441078.1_4 Reverse -323 -332 4.81794 0.126
NP_441078.1_4 Forward -332 -323 -1.47524 0.266
NP_442729.1_8 Forward -203 -190 14.6706 0.125
NP_442729.1_8 Reverse -188 -201 5.91914 0.223
NP_441663.1_8 Forward -196 -177 -1.57384 0.243
NP_442443.1_1 Forward -289 -270 0.196116 0.219
NP_441432.1_5 Forward -200 -186 8.94771 0.271
NP_442400.1_1 Reverse -98 -117 -5.21209 0.295
NP_441659.2_8 Reverse -384 -394 0.668351 0.26
NP_441022.1_1 Reverse -117 -126 13.8484 0.188
NP_442346.1_10 Forward -334 -315 2.75272 0.195
NP_441943.1_8 Forward -149 -130 14.5524 0.0643
NP_441943.1_10 Forward -77 -63 18.3868 0.244
NP_440449.1_6 Reverse -197 -215 4.94889 0.287
NP_442436.1_4 Reverse -44 -58 11.7993 0.293
NP_440671.1_4 Forward -396 -382 5.99778 0.266
NP_441671.1_10 Reverse -187 -206 3.24438 0.232
NP_440590.1_4 Reverse -324 -337 -0.964025 0.206
NP_440400.1_1 Reverse -316 -335 -1.57461 0.285
NP_441698.1_2 Forward -122 -103 16.855 0.18
NP_440833.1_6 Reverse -29 -43 7.96378 0.277
NP_441119.1_1 Forward -382 -363 36.0869 0.00000473
NP_441119.1_2 Forward -256 -237 27.7288 0.000179
NP_441119.1_3 Forward -310 -291 32.842 0.0000321
NP_441119.1_7 Forward -202 -183 33.5303 0.0000259
NP_441119.1_8 Forward -276 -258 31.3867 0.000105
NP_441119.1_10 Forward -362 -343 25.1722 0.00218
NP_441843.2_4 Forward -393 -374 16.1604 0.299
NP_442679.1_1 Reverse -6 -25 4.12936 0.147
NP_442679.1_1 Reverse -360 -379 -2.75381 0.242
NP_440825.1_6 Forward -50 -31 7.57094 0.285
NP_440505.1_3 Forward -334 -324 5.19158 0.241
NP_441102.1_2 Forward -257 -238 9.93088 0.267
NP_441576.1_10 Forward -385 -366 13.1758 0.234
NP_440914.1_1 Reverse -323 -333 6.27291 0.288
NP_442533.1_6 Reverse -206 -215 2.06468 0.275
NP_441028.1_6 Forward -14 -4 5.19112 0.265
NP_441527.1_4 Forward -98 -79 -5.49121 0.202
NP_441527.1_4 Forward -96 -77 -5.5867 0.204
NP_441527.1_4 Forward -99 -80 -6.25514 0.215
NP_441527.1_4 Forward -97 -78 -11.0297 0.278
NP_440115.1_6 Reverse -191 -201 5.97822 0.206
NP_441680.1_4 Forward -191 -172 -0.688862 0.256
NP_442673.1_7 Reverse -74 -93 11.4109 0.292
NP_441106.1_1 Reverse -1 -10 2.458 0.283
NP_441106.1_7 Forward -73 -54 15.5349 0.205
NP_441420.1_1 Reverse -189 -208 -5.70374 0.295
NP_441439.1_9 Forward -373 -354 16.7157 0.219
NP_442674.1_1 Forward -100 -81 16.0949 0.159
NP_441463.1_2 Reverse -80 -98 2.96562 0.215
NP_440855.1_4 Forward -283 -264 15.0441 0.203
NP_441836.1_1 Forward -370 -351 11.6941 0.294
NP_442352.1_8 Forward -184 -170 18.5835 0.234
NP_441237.1_9 Reverse -359 -369 10.6981 0.22
NP_441489.1_3 Forward -94 -80 14.2399 0.198
NP_442439.1_8 Reverse -1 -20 11.9958 0.21
NP_442514.1_5 Reverse -129 -148 -8.55607 0.285
NP_440448.1_4 Forward -329 -310 7.57094 0.297
NP_441885.1_5 Reverse -323 -333 -0.806614 0.228
NP_440478.1_10 Reverse -261 -275 6.29277 0.292
NP_442128.1_2 Forward -21 -3 11.5239 0.163
NP_441173.1_9 Forward -121 -113 11.0321 0.228
NP_441173.1_9 Reverse -112 -120 11.0321 0.228
NP_441842.1_1 Forward -201 -188 13.8833 0.128
NP_441842.1_1 Reverse -258 -271 11.2284 0.262
NP_441207.1_7 Reverse -365 -379 7.7064 0.295
NP_440258.1_3 Forward -249 -230 -2.95047 0.225
NP_441730.1_3 Reverse -42 -60 18.1455 0.224
NP_440216.1_9 Forward -180 -171 11.0128 0.284
NP_442371.1_1 Forward -102 -92 14.4342 0.191
NP_443052.1_8 Forward -222 -203 -10.4236 0.208
NP_442154.1_1 Forward -331 -313 -18.5654 0.282
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

TCCAACAAACGGTGGCTGCACTTCTTCATGTTGTTCGTTCCCGTAACTGGTTTGTGGATGAGTTCTGTGGGTATCGTCGGTTTGGCGTTGAACCTACGGGCTTATGACTTCGTTTCCCAGGAACTGCGGGCTGCTGAAGATCCGGAATTTGAAACGTTTTATACGAAAAACATTTTGTTGAACGAAGGGATGCGCGCCTGGATGGCTCCCCAAGATCAACCCCATGAAAACTTTATCTTCCCTGAGGAAGTACTGCCCCGGGGTAATGCTCTCTAAAGGTTTTGCAAAACAGTTATCACTCGAAGAAATGACTAAAAAACAAAACTAATTGAGCAAAACATCATCAATTAGCTAAAGTTGGGAGAGTGTTACAGCTCTCCTTTTTCTTTTGCCCTAGCCG

CDS

ATGATTATTGCCATCACTGCCCTCAAAGGGGGCGTTGGGAAAACCACCACCGCTGTCCACCTGGCAGCCTATCTGCAACAAAAGGATCAAACATTGCTGATTGATGCGGACCGTAACCGTTCGGCATTAATCTGGGCGAGGGAAGAAAAATTACCCTTCTACGTTGCTTCCCAAGCGGGCTCCACCGCATTAATCCGTAAGTATCCCCACATTGTGGTGGACACTAGAGCCATGCCAGAGTTGGATGAATTTCGGGATTTGGCAGAGGGGAGCGATTTATTGATTATTCCCACCACTCCCAACCATTTGGATTTAGATGCCACTTTAAAGGCGGCGGAGCAATTGGCCTCCCTCAAGGTTAACTACAAAATTTTGTTAACCAAGGTAGATGCCCGTACCCGTAGTGGTCGCGAAGCAAGGCAATTATTACAGGCGGAAAATTTACCTCTGTTCACAACGGAAATTCCCCTATTGGTGGCCTTTGAGCGGGCTTCCCAGTCGGGGGTAATTATTCGAGATTACGTTGATCCCCGTTCCCATTTGGCCTGGGGGCGCTATAAGGCGGTGGGCCGGGAAATTTTACCCTAG

Protein

MIIAITALKGGVGKTTTAVHLAAYLQQKDQTLLIDADRNRSALIWAREEKLPFYVASQAGSTALIRKYPHIVVDTRAMPELDEFRDLAEGSDLLIIPTTPNHLDLDATLKAAEQLASLKVNYKILLTKVDARTRSGREARQLLQAENLPLFTTEIPLLVAFERASQSGVIIRDYVDPRSHLAWGRYKAVGREILP