Your browser is old and dusty. Try Google Chrome!

Details for slr0833

ORF slr0833
Accession NP_442446.1
Symbol dnaB
Category replicative DNA helicase [Contains: Ssp dnaB intein]
Definition DNA replication, restriction, modification, recombination, and repair
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_442711.1_1 Reverse -142 -156 17.5025 0.0786
NP_440795.1_7 Forward -150 -143 14.6904 0.0123
NP_440795.1_7 Reverse -143 -150 14.6904 0.0123
NP_440795.1_7 Reverse -243 -250 13.1171 0.0477
NP_441418.1_6 Reverse -142 -161 -28.6149 0.206
NP_441418.1_6 Forward -284 -265 -30.7781 0.296
NP_440815.1_5 Forward -151 -132 8.65258 0.237
NP_442291.1_5 Forward -152 -136 -0.138127 0.179
NP_440897.1_6 Reverse -142 -161 20.5498 0.0208
NP_441453.1_4 Reverse -142 -150 16.539 0.00633
NP_441453.1_4 Forward -151 -143 16.539 0.00633
NP_441453.1_4 Reverse -81 -89 4.14932 0.264
NP_441623.1_1 Reverse -266 -284 -2.83245 0.248
NP_442151.1_6 Reverse -242 -256 9.43936 0.148
NP_442151.1_6 Forward -151 -137 8.75105 0.164
NP_440226.1_1 Forward -151 -132 8.25926 0.0904
NP_441342.1_2 Reverse -138 -152 10.226 0.209
NP_440150.1_6 Forward -93 -74 3.44104 0.248
NP_440996.1_3 Reverse -129 -147 10.1472 0.263
NP_442287.1_3 Forward -310 -293 17.246 0.139
NP_442173.1_1 Forward -150 -142 15.4574 0.00633
NP_442173.1_1 Reverse -143 -151 15.4574 0.00633
NP_442752.1_4 Forward -151 -144 13.8055 0.0199
NP_442752.1_4 Reverse -142 -149 13.8055 0.0199
NP_443027.1_4 Forward -153 -143 11.8781 0.0872
NP_442975.1_10 Forward -155 -141 5.21053 0.228
NP_442975.1_10 Forward -132 -118 4.22722 0.245
NP_442975.1_10 Forward -29 -15 3.34225 0.259
NP_442975.1_10 Reverse -138 -152 1.47397 0.297
NP_440784.1_7 Forward -150 -143 15.9687 0.0123
NP_440784.1_7 Reverse -143 -150 15.9687 0.0123
NP_442909.1_7 Forward -250 -236 6.0955 0.258
NP_440061.1_9 Reverse -140 -154 11.602 0.107
NP_440061.1_9 Forward -153 -139 9.53707 0.143
NP_440061.1_9 Forward -92 -78 6.98048 0.223
NP_440878.1_9 Forward -161 -142 -3.24547 0.29
NP_442062.1_8 Reverse -142 -152 19.4496 0.000558
NP_442062.1_8 Forward -151 -141 17.3846 0.00193
NP_442062.1_8 Reverse -81 -91 4.69992 0.201
NP_440304.1_4 Reverse -333 -343 6.66654 0.149
NP_440304.1_4 Forward -153 -143 1.84832 0.299
NP_440304.1_4 Reverse -140 -150 1.84832 0.299
NP_442242.1_4 Forward -150 -143 14.3954 0.0124
NP_442242.1_4 Reverse -143 -150 14.3954 0.0124
NP_440044.1_8 Forward -150 -131 -2.55715 0.264
NP_439923.1_4 Reverse -5 -24 11.3075 0.233
NP_441208.1_9 Reverse -139 -153 5.70279 0.262
NP_441594.1_6 Reverse -332 -351 6.98095 0.181
NP_441594.1_6 Forward -260 -241 2.55606 0.248
NP_441109.1_4 Forward -90 -71 13.0775 0.29
NP_442110.1_7 Reverse -142 -156 3.34284 0.21
NP_441925.1_2 Forward -140 -121 2.85105 0.262
NP_441925.1_4 Reverse -181 -200 -15.4392 0.264
NP_440856.1_4 Forward -158 -139 8.06259 0.06
NP_441083.1_5 Forward -151 -141 20.3345 0.00053
NP_441083.1_5 Reverse -142 -152 11.3864 0.0159
NP_441083.1_5 Reverse -275 -285 -1.10161 0.295
NP_441738.1_2 Forward -149 -142 15.28 0.0102
NP_441738.1_2 Reverse -144 -151 15.28 0.0102
NP_441558.1_5 Forward -153 -134 5.40766 0.251
NP_441558.1_5 Forward -286 -267 5.30933 0.254
NP_441942.1_7 Reverse -77 -96 12.5858 0.277
NP_440209.1_1 Reverse -142 -150 18.1123 0.00295
NP_440209.1_1 Forward -151 -143 18.1123 0.00295
NP_442889.1_8 Forward -154 -140 14.8469 0.0473
NP_440447.1_1 Forward -156 -138 6.50899 0.194
NP_441713.1_1 Forward -157 -138 -15.9302 0.275
NP_441713.1_1 Forward -257 -238 -16.0285 0.275
NP_441713.1_8 Reverse -77 -95 14.8671 0.171
NP_440178.1_7 Forward -152 -133 -20.4534 0.192
NP_441716.1_1 Forward -100 -86 7.76774 0.16
NP_441327.1_4 Reverse -135 -149 15.8309 0.282
NP_442111.1_3 Reverse -153 -166 13.0487 0.267
NP_442111.1_4 Reverse -141 -155 21.9274 0.0011
NP_442111.1_4 Reverse -241 -255 8.35772 0.0758
NP_442111.1_4 Forward -95 -81 7.17775 0.103
NP_441215.1_1 Forward -165 -146 13.6675 0.1
NP_440851.1_6 Forward -258 -241 -0.0594896 0.288
NP_440906.1_5 Forward -150 -143 15.8704 0.0124
NP_440906.1_5 Reverse -143 -150 15.8704 0.0124
NP_440747.1_10 Forward -154 -142 17.0502 0.000794
NP_440747.1_10 Reverse -139 -151 14.887 0.00223
NP_440747.1_10 Forward -93 -81 -11.8591 0.161
NP_440747.1_10 Forward -287 -275 -12.0557 0.199
NP_440747.1_10 Forward -185 -173 -12.1541 0.227
NP_441486.1_1 Forward -154 -140 5.40779 0.037
NP_441486.1_1 Reverse -139 -153 4.62115 0.0425
NP_441265.1_3 Forward -157 -143 1.57289 0.2
NP_440057.1_6 Forward -142 -123 10.8873 0.289
NP_441014.1_8 Forward -97 -78 -2.16383 0.231
NP_441014.1_8 Forward -93 -74 -5.11376 0.263
NP_442848.1_1 Reverse -236 -250 3.04785 0.146
NP_442848.1_9 Reverse -72 -91 4.71934 0.204
NP_443018.1_3 Forward -150 -143 14.8871 0.0123
NP_443018.1_3 Reverse -143 -150 14.8871 0.0123
NP_443018.1_3 Forward -89 -82 4.26735 0.267
NP_443018.1_3 Reverse -82 -89 4.16902 0.278
NP_441634.1_8 Forward -286 -272 -2.95034 0.295
NP_441634.1_8 Reverse -140 -154 -3.04867 0.295
NP_440376.1_1 Forward -151 -142 19.4693 0.000692
NP_440376.1_1 Reverse -142 -151 19.4693 0.000692
NP_440376.1_1 Forward -90 -81 4.22796 0.166
NP_440376.1_1 Reverse -16 -25 3.04799 0.21
NP_441588.1_4 Forward -149 -139 15.9097 0.0369
NP_443065.1_1 Reverse -102 -121 12.7825 0.285
NP_442687.1_7 Forward -152 -142 15.8113 0.0125
NP_442687.1_7 Reverse -141 -151 8.92815 0.0994
NP_442687.1_7 Reverse -80 -90 6.56821 0.159
NP_441846.1_10 Reverse -227 -246 -21.3384 0.256
NP_440642.1_10 Forward -314 -300 2.75226 0.277
NP_441013.1_2 Forward -156 -138 -3.71743 0.29
NP_440691.1_10 Reverse -174 -193 13.9625 0.201
NP_440667.1_2 Reverse -92 -111 -4.22878 0.247
NP_441950.1_8 Forward -348 -334 12.3893 0.165
NP_442658.1_1 Forward -153 -143 17.0891 0.00615
NP_442658.1_1 Forward -102 -92 7.84605 0.205
NP_442658.1_1 Reverse -140 -150 6.76441 0.214
NP_442658.1_1 Forward -92 -82 4.7978 0.297
NP_442198.1_3 Forward -163 -144 8.06259 0.249
NP_442782.1_2 Reverse -142 -156 7.47274 0.202
NP_442782.1_7 Forward -159 -140 3.44104 0.193
NP_441414.1_9 Forward -151 -132 16.3224 0.00987
NP_441414.1_9 Reverse -142 -161 -5.31042 0.174
NP_441487.1_9 Forward -191 -172 -0.0988766 0.247
NP_439959.1_4 Forward -194 -175 17.3057 0.283
NP_442937.1_5 Reverse -137 -156 15.3391 0.0581
NP_441958.1_5 Forward -152 -142 12.2714 0.00183
NP_441958.1_5 Reverse -141 -151 12.2714 0.00183
NP_441958.1_5 Reverse -80 -90 -0.0199663 0.178
NP_441127.1_1 Reverse -335 -349 15.8309 0.11
NP_442836.1_5 Forward -350 -331 11.3075 0.0952
NP_441754.1_6 Reverse -63 -82 15.1424 0.129
NP_443001.1_7 Reverse -98 -117 4.22769 0.279
NP_440984.1_7 Forward -156 -142 9.93102 0.126
NP_440984.1_7 Reverse -137 -151 7.57108 0.166
NP_442376.1_2 Reverse -270 -289 -5.31042 0.283
NP_442690.1_1 Reverse -122 -141 -14.1602 0.269
NP_442911.1_2 Reverse -132 -151 -2.26216 0.096
NP_442911.1_2 Forward -161 -142 -3.24547 0.11
NP_442911.1_2 Reverse -265 -284 -9.83364 0.264
NP_440153.1_5 Reverse -143 -157 4.03116 0.199
NP_440153.1_8 Forward -90 -77 4.64084 0.196
NP_442064.1_1 Forward -349 -330 -7.57203 0.241
NP_442064.1_4 Forward -237 -218 7.27514 0.242
NP_442064.1_4 Forward -161 -142 5.40686 0.269
NP_443055.1_6 Reverse -134 -152 11.1298 0.114
NP_442236.1_7 Forward -339 -320 8.84924 0.253
NP_440993.1_3 Forward -161 -142 -0.886293 0.273
NP_442995.1_5 Reverse -137 -156 11.5042 0.211
NP_441348.1_3 Reverse -137 -156 9.14423 0.224
NP_441099.1_5 Reverse -132 -151 -1.7705 0.113
NP_441099.1_5 Forward -104 -85 -4.6221 0.147
NP_442002.1_9 Forward -152 -145 10.7572 0.185
NP_441294.1_7 Forward -155 -141 9.4426 0.244
NP_442438.1_10 Forward -156 -142 11.111 0.0463
NP_441292.1_2 Reverse -70 -89 7.7676 0.0818
NP_441752.1_6 Reverse -166 -185 3.24438 0.235
NP_441000.1_5 Forward -235 -216 5.40686 0.254
NP_441000.1_6 Reverse -141 -155 -2.45868 0.216
NP_441000.1_6 Forward -152 -138 -5.21195 0.266
NP_441000.1_6 Forward -95 -81 -5.40861 0.275
NP_440147.1_4 Reverse -140 -153 17.7189 0.00602
NP_440147.1_4 Forward -153 -140 10.049 0.0355
NP_440147.1_4 Reverse -79 -92 4.73917 0.149
NP_441550.1_8 Reverse -140 -150 14.6309 0.0132
NP_441550.1_8 Forward -153 -143 8.82935 0.112
NP_441550.1_8 Reverse -79 -89 5.68278 0.236
NP_441916.1_7 Reverse -142 -152 18.4663 0.00144
NP_441916.1_7 Forward -90 -80 13.353 0.0202
NP_441916.1_7 Forward -151 -141 10.3048 0.0261
NP_441916.1_10 Reverse -333 -352 5.70265 0.208
NP_440465.1_4 Reverse -141 -160 13.6675 0.184
NP_441041.1_4 Forward -151 -132 -0.983855 0.0994
NP_441041.1_7 Forward -154 -142 14.6087 0.0342
NP_441041.1_7 Forward -287 -275 9.36115 0.114
NP_442396.1_5 Reverse -138 -151 12.2123 0.0913
NP_442004.1_3 Reverse -77 -96 13.7658 0.293
NP_442004.1_6 Forward -245 -231 4.91614 0.202
NP_441725.1_4 Forward -156 -142 4.42388 0.278
NP_441725.1_5 Forward -150 -140 2.04498 0.115
NP_441725.1_5 Reverse -143 -153 2.04498 0.115
NP_441725.1_5 Reverse -276 -286 0.373358 0.182
NP_439966.1_4 Reverse -4 -23 8.94757 0.2
NP_439966.1_7 Forward -153 -143 17.9741 0.00631
NP_439966.1_7 Forward -102 -92 8.63269 0.132
NP_439966.1_7 Reverse -140 -150 7.25606 0.15
NP_439966.1_9 Reverse -273 -282 6.98123 0.253
NP_439966.1_9 Forward -153 -144 0.884706 0.253
NP_442941.1_3 Forward -150 -140 11.0914 0.0116
NP_442941.1_3 Reverse -143 -153 10.7964 0.0116
NP_440289.1_2 Forward -154 -141 11.1307 0.0212
NP_440260.1_8 Forward -191 -173 -2.63579 0.245
NP_442281.1_1 Forward -156 -142 19.3701 0.00282
NP_442281.1_1 Reverse -137 -151 9.93039 0.0648
NP_440177.1_9 Reverse -134 -153 12.1925 0.238
NP_442256.1_2 Forward -153 -135 -8.14232 0.217
NP_440437.1_1 Forward -157 -138 -1.86883 0.207
NP_442012.1_1 Forward -157 -138 2.45773 0.2
NP_440723.1_10 Forward -135 -116 16.8998 0.26
NP_441556.1_10 Forward -156 -142 12.0712 0.2
NP_440498.1_1 Reverse -133 -151 -2.43913 0.241
NP_440375.1_8 Forward -150 -131 6.68596 0.166
NP_441644.1_6 Forward -151 -141 17.3841 0.00127
NP_441644.1_6 Reverse -142 -152 10.1076 0.0628
NP_441644.1_6 Reverse -366 -376 5.28945 0.199
NP_441644.1_6 Reverse -242 -252 4.69947 0.228
NP_442215.1_1 Reverse -169 -188 4.32602 0.252
NP_442215.1_2 Reverse -140 -156 9.20332 0.0599
NP_442215.1_2 Forward -346 -330 -6.92296 0.281
NP_442029.1_6 Reverse -137 -156 18.584 0.0759
NP_440253.1_2 Forward -151 -133 2.87075 0.128
NP_440253.1_2 Reverse -142 -160 -1.84914 0.252
NP_440929.1_8 Forward -151 -142 19.2726 0.000701
NP_440929.1_8 Reverse -142 -151 19.2726 0.000701
NP_442933.1_10 Forward -151 -142 17.601 0.00325
NP_442933.1_10 Reverse -142 -151 17.601 0.00325
NP_442933.1_10 Forward -90 -81 4.71961 0.22
NP_439922.1_2 Reverse -127 -146 15.1424 0.273
NP_442554.1_8 Forward -150 -140 15.3197 0.00882
NP_442554.1_8 Reverse -143 -153 14.1397 0.0144
NP_442554.1_8 Forward -89 -79 4.50326 0.184
NP_442970.1_1 Reverse -126 -140 21.3063 0.0621
NP_441762.1_7 Forward -152 -140 9.57708 0.0142
NP_441762.1_7 Forward -285 -273 3.57889 0.0676
NP_441762.1_7 Reverse -141 -153 2.98891 0.0676
NP_442142.1_4 Forward -154 -141 15.1616 0.0289
NP_442142.1_4 Reverse -139 -152 5.52525 0.188
NP_442142.1_4 Forward -97 -84 3.65697 0.248
NP_442142.1_4 Reverse -68 -81 2.87033 0.273
NP_442292.1_1 Forward -150 -141 18.486 0.00229
NP_442292.1_1 Reverse -143 -152 9.63616 0.0183
NP_442476.1_6 Reverse -143 -157 12.8809 0.0454
NP_442476.1_6 Forward -150 -136 1.57289 0.211
NP_442381.1_8 Forward -154 -135 -8.06369 0.212
NP_441711.1_4 Reverse -133 -152 4.12936 0.222
NP_443009.1_5 Reverse -141 -152 18.3477 0.00265
NP_443009.1_5 Reverse -80 -91 5.56471 0.197
NP_442406.1_9 Reverse -64 -83 0.982764 0.274
NP_441715.1_4 Reverse -143 -153 18.8596 0.00741
NP_441715.1_4 Forward -150 -140 7.94484 0.107
NP_441715.1_4 Reverse -276 -286 4.69992 0.254
NP_440279.1_6 Reverse -5 -24 5.01433 0.28
NP_443034.1_3 Forward -62 -43 16.4207 0.0856
NP_440464.1_10 Forward -150 -140 13.0082 0.169
NP_441468.1_1 Forward -150 -143 15.8704 0.0124
NP_441468.1_1 Reverse -143 -150 15.8704 0.0124
NP_441468.1_1 Forward -89 -82 4.26735 0.246
NP_441015.1_10 Reverse -66 -85 -1.37718 0.172
NP_441015.1_10 Reverse -137 -156 -2.26216 0.178
NP_441673.1_1 Forward -151 -142 20.8459 0.000698
NP_441673.1_1 Reverse -142 -151 20.8459 0.000698
NP_441826.1_2 Forward -157 -143 5.01447 0.0978
NP_441826.1_2 Reverse -236 -250 -3.54032 0.286
NP_441330.1_1 Forward -156 -137 -13.0786 0.183
NP_441330.1_1 Reverse -137 -156 -13.2752 0.183
NP_442868.1_6 Forward -153 -143 10.3048 0.038
NP_442868.1_6 Reverse -140 -150 9.81313 0.038
NP_442868.1_6 Forward -286 -276 5.5849 0.145
NP_442868.1_6 Forward -92 -82 0.57002 0.217
NP_441612.1_2 Forward -151 -141 8.54929 0.21
NP_442427.1_8 Reverse -133 -152 5.11266 0.279
NP_442427.1_10 Reverse -120 -139 9.14342 0.261
NP_442808.1_1 Forward -152 -142 18.4657 0.00201
NP_442808.1_1 Reverse -141 -151 8.63269 0.0481
NP_440145.1_3 Reverse -132 -151 -0.688862 0.143
NP_442820.1_9 Forward -227 -209 10.6389 0.187
NP_442542.1_2 Forward -153 -140 8.47575 0.154
NP_442542.1_2 Reverse -79 -92 6.01747 0.239
NP_442050.1_5 Forward -286 -276 8.63269 0.223
NP_442050.1_5 Reverse -140 -150 7.64939 0.243
NP_442050.1_5 Forward -153 -143 6.96107 0.27
NP_440558.1_2 Forward -347 -328 3.34271 0.158
NP_440558.1_2 Forward -245 -226 -1.67217 0.217
NP_441878.1_6 Forward -152 -142 10.4031 0.0176
NP_441878.1_6 Reverse -141 -151 10.4031 0.0176
NP_441878.1_6 Forward -91 -81 1.94665 0.0567
NP_441878.1_6 Reverse -80 -90 0.57002 0.14
NP_441036.1_8 Forward -152 -142 17.7779 0.000554
NP_441036.1_8 Reverse -141 -151 8.33817 0.174
NP_442650.1_2 Reverse -242 -256 3.34284 0.205
NP_441557.1_5 Forward -151 -142 19.9609 0.000699
NP_441557.1_5 Reverse -142 -151 19.9609 0.000699
NP_441557.1_5 Reverse -81 -90 -0.590259 0.219
NP_441557.1_9 Reverse -58 -72 18.9775 0.264
NP_441445.1_1 Forward -260 -241 0.392778 0.275
NP_441445.1_1 Reverse -72 -91 0.0977854 0.283
NP_442066.2_4 Reverse -142 -161 0.0977854 0.172
NP_442066.2_4 Forward -309 -290 -9.047 0.296
NP_442419.1_2 Forward -156 -137 -1.67217 0.246
NP_441914.1_4 Reverse -183 -202 22.3818 0.0344
NP_440101.1_3 Reverse -80 -99 1.27776 0.281
NP_441458.1_10 Forward -160 -141 8.65258 0.184
NP_442183.1_1 Forward -151 -137 8.25939 0.119
NP_442166.1_7 Reverse -82 -96 14.5526 0.175
NP_441549.1_9 Forward -348 -330 -7.15901 0.206
NP_442347.1_2 Forward -150 -141 12.4878 0.056
NP_442347.1_2 Reverse -143 -152 11.1111 0.056
NP_442645.1_2 Reverse -134 -153 -12.2919 0.144
NP_442645.1_2 Reverse -8 -27 -22.6167 0.292
NP_442965.1_2 Forward -117 -98 -8.26035 0.278
NP_441037.1_4 Reverse -140 -150 7.9999 0.237
NP_441037.1_4 Forward -153 -143 6.92787 0.237
NP_441037.1_4 Forward -253 -243 6.05075 0.283
NP_441633.1_3 Reverse -140 -153 8.57408 0.0377
NP_441633.1_3 Forward -153 -140 5.72248 0.0481
NP_441633.1_3 Forward -286 -273 -6.66722 0.265
NP_440136.1_2 Forward -150 -143 15.9687 0.0123
NP_440136.1_2 Reverse -143 -150 15.9687 0.0123
NP_442590.1_10 Reverse -74 -93 12.2908 0.145
NP_442998.1_5 Reverse -153 -163 13.1564 0.158
NP_442998.1_5 Reverse -216 -226 7.84651 0.28
NP_442998.1_10 Forward -149 -142 15.5754 0.0102
NP_442998.1_10 Reverse -144 -151 15.5754 0.0102
NP_440299.1_1 Forward -155 -142 18.1116 0.00453
NP_440299.1_1 Reverse -138 -151 13.0967 0.0319
NP_441799.1_1 Reverse -138 -152 16.1252 0.0153
NP_441799.1_1 Forward -288 -274 11.307 0.0591
NP_441799.1_1 Forward -155 -141 5.30886 0.214
NP_442333.2_1 Reverse -273 -292 -10.6203 0.293
NP_440256.1_1 Reverse -139 -158 7.37428 0.0259
NP_440256.1_1 Forward -154 -135 -10.227 0.297
NP_441559.1_8 Forward -156 -142 12.1926 0.0574
NP_441559.1_8 Reverse -271 -285 2.65453 0.143
NP_441270.1_4 Reverse -176 -195 15.3382 0.245
NP_440915.1_6 Forward -155 -141 12.4876 0.0208
NP_440915.1_6 Forward -94 -80 8.16106 0.0596
NP_442785.1_7 Forward -276 -262 11.2093 0.228
NP_441464.1_8 Forward -151 -137 3.93283 0.283
NP_441939.1_3 Reverse -143 -162 12.4875 0.1
NP_441494.1_6 Forward -256 -243 9.36073 0.227
NP_442993.1_1 Forward -302 -286 -7.31629 0.146
NP_442993.1_1 Forward -233 -217 -13.2161 0.288
NP_442993.1_1 Reverse -378 -394 -13.3145 0.291
NP_442386.1_9 Forward -152 -143 15.7322 0.0144
NP_442386.1_9 Reverse -141 -150 13.8639 0.0289
NP_441340.1_5 Forward -150 -143 15.6737 0.0124
NP_441340.1_5 Reverse -143 -150 15.6737 0.0124
NP_441340.1_5 Reverse -82 -89 4.07068 0.239
NP_440186.1_8 Forward -193 -174 4.62101 0.256
NP_442240.1_2 Reverse -143 -162 -11.4069 0.137
NP_440161.1_3 Forward -346 -327 7.27595 0.299
NP_440586.1_8 Forward -150 -143 13.2151 0.026
NP_440586.1_8 Reverse -143 -150 13.2151 0.026
NP_440586.1_8 Forward -79 -72 5.8403 0.283
NP_442251.1_6 Forward -150 -143 15.2804 0.0124
NP_442251.1_6 Reverse -143 -150 15.2804 0.0124
NP_440192.1_4 Reverse -273 -292 10.5618 0.237
NP_442959.1_5 Reverse -122 -141 12.0942 0.222
NP_440684.1_9 Reverse -136 -150 11.7993 0.168
NP_441262.1_3 Reverse -142 -149 14.7888 0.0223
NP_441262.1_3 Forward -151 -144 14.7888 0.0223
NP_440027.1_3 Reverse -71 -89 11.5231 0.159
NP_440027.1_3 Forward -90 -72 7.19654 0.214
NP_443051.1_1 Reverse -141 -150 10.4228 0.00754
NP_443051.1_1 Forward -152 -143 10.4228 0.00754
NP_443051.1_1 Reverse -80 -89 -1.18024 0.297
NP_439937.1_8 Reverse -240 -259 5.50599 0.192
NP_439937.1_9 Reverse -274 -291 -2.81344 0.153
NP_439937.1_9 Reverse -141 -158 -8.51661 0.176
NP_439937.1_9 Forward -285 -268 -15.9897 0.287
NP_440836.1_6 Forward -167 -153 5.60446 0.299
NP_440439.1_1 Forward -154 -141 10.2457 0.0372
NP_440439.1_1 Reverse -235 -248 -0.177378 0.209
NP_439943.1_7 Reverse -137 -156 7.07928 0.208
NP_440372.1_2 Forward -150 -143 16.3621 0.0124
NP_440372.1_2 Reverse -143 -150 16.3621 0.0124
NP_440271.1_2 Reverse -209 -228 3.24438 0.28
NP_440271.1_2 Reverse -326 -345 -0.197208 0.292
NP_440171.1_3 Reverse -242 -261 4.12936 0.284
NP_440819.1_5 Reverse -153 -161 7.68924 0.266
NP_439977.1_5 Forward -157 -138 -2.36049 0.277
NP_441572.1_7 Forward -157 -138 6.68596 0.0785
NP_441572.1_7 Forward -112 -93 -1.08219 0.186
NP_441572.1_7 Forward -96 -77 -1.08219 0.186
NP_442384.1_10 Reverse -142 -155 19.1938 0.00338
NP_442384.1_10 Forward -90 -77 11.3273 0.0367
NP_442384.1_10 Forward -151 -138 8.77074 0.0608
NP_442114.1_4 Reverse -142 -153 9.20345 0.17
NP_441980.1_8 Reverse -332 -351 10.8159 0.227
NP_441018.1_7 Reverse -138 -157 6.68596 0.283
NP_442262.1_10 Forward -150 -143 14.1988 0.0123
NP_442262.1_10 Reverse -143 -150 14.1988 0.0123
NP_441689.1_5 Reverse -140 -150 5.78111 0.197
NP_440344.1_10 Forward -158 -141 4.56207 0.0245
NP_440344.1_10 Reverse -135 -152 -11.0726 0.2
NP_440531.1_6 Reverse -73 -92 3.73603 0.14
NP_440531.1_6 Forward -310 -291 2.3594 0.158
NP_442910.1_1 Forward -158 -139 -7.37537 0.254
NP_441965.1_10 Reverse -139 -155 2.71347 0.284
NP_440297.1_9 Forward -150 -140 -0.118297 0.282
NP_440297.1_9 Reverse -143 -153 -0.118297 0.282
NP_440297.1_9 Forward -89 -79 -0.118297 0.282
NP_441592.1_4 Reverse -173 -192 0.687771 0.23
NP_440894.1_10 Forward -355 -336 3.44104 0.272
NP_440999.1_9 Forward -155 -141 19.9608 0.0114
NP_440999.1_9 Forward -255 -241 3.53951 0.128
NP_440999.1_9 Forward -94 -80 -1.18038 0.229
NP_440999.1_9 Reverse -271 -285 -2.95034 0.281
NP_440888.1_2 Reverse -142 -156 16.9119 0.00511
NP_440888.1_2 Forward -151 -137 8.06211 0.172
NP_440888.1_2 Reverse -173 -187 5.70218 0.267
NP_440888.1_2 Reverse -91 -105 5.21053 0.288
NP_440052.1_5 Forward -162 -143 12.8808 0.0714
NP_439969.1_3 Forward -95 -76 3.73603 0.226
NP_442948.1_2 Reverse -141 -160 11.3075 0.135
NP_442277.1_4 Forward -160 -141 2.9486 0.235
NP_442033.1_10 Reverse -273 -292 -1.67217 0.142
NP_442033.1_10 Reverse -79 -98 -4.72043 0.179
NP_441949.1_2 Reverse -132 -151 2.55606 0.261
NP_441543.1_2 Reverse -143 -152 18.486 0.00236
NP_441543.1_2 Forward -150 -141 16.9127 0.00359
NP_442845.1_2 Reverse -136 -150 10.521 0.148
NP_442845.1_2 Reverse -65 -79 3.34284 0.294
NP_441551.1_5 Reverse -271 -287 9.39927 0.21
NP_441551.1_5 Reverse -77 -93 7.236 0.249
NP_441469.1_8 Forward -152 -143 16.126 0.00797
NP_441469.1_8 Reverse -80 -89 10.3245 0.223
NP_441469.1_8 Forward -285 -276 8.94785 0.227
NP_441469.1_8 Reverse -141 -150 6.48957 0.227
NP_443064.1_6 Forward -151 -141 12.5669 0.0796
NP_442578.1_7 Forward -150 -143 14.5921 0.026
NP_442578.1_7 Reverse -143 -150 14.5921 0.026
NP_442578.1_7 Reverse -243 -250 9.87221 0.122
NP_441462.1_2 Forward -151 -141 11.5831 0.00406
NP_441462.1_2 Reverse -142 -152 11.5831 0.00406
NP_441462.1_2 Reverse -81 -91 -0.118297 0.184
NP_441462.1_2 Forward -90 -80 -0.806614 0.254
NP_441621.1_7 Reverse -140 -154 -3.34366 0.188
NP_441621.1_7 Forward -253 -239 -3.93365 0.198
NP_443062.1_1 Forward -151 -133 11.6662 0.0955
NP_443062.1_1 Reverse -142 -160 7.18082 0.182
NP_443062.1_1 Forward -80 -62 5.42569 0.229
NP_443062.1_6 Reverse -73 -92 3.83436 0.228
NP_443062.1_6 Reverse -134 -153 1.96607 0.264
NP_440936.1_10 Forward -321 -302 -1.00309 0.241
NP_442204.1_1 Forward -155 -144 11.5634 0.0565
NP_442204.1_5 Forward -161 -142 3.34271 0.192
NP_440516.1_2 Forward -157 -139 2.87075 0.163
NP_440516.1_6 Reverse -266 -280 8.16044 0.25
NP_440516.1_8 Forward -151 -142 16.9127 0.00442
NP_440516.1_8 Reverse -142 -151 16.9127 0.00442
NP_440516.1_8 Reverse -85 -94 -0.0986038 0.162
NP_440516.1_8 Forward -284 -275 -0.491928 0.262
NP_442428.1_4 Forward -195 -176 2.3594 0.264
NP_442428.1_5 Forward -150 -143 15.8704 0.0124
NP_442428.1_5 Reverse -143 -150 15.8704 0.0124
NP_442428.1_5 Forward -89 -82 4.66067 0.244
NP_442428.1_8 Forward -258 -239 -1.86883 0.289
NP_441835.1_2 Forward -139 -120 6.09597 0.27
NP_441867.1_2 Reverse -332 -351 -20.65 0.292
NP_440673.1_3 Forward -149 -142 12.4288 0.0426
NP_440673.1_3 Reverse -144 -151 12.4288 0.0426
NP_440673.1_3 Reverse -83 -90 10.4622 0.139
NP_440077.1_7 Forward -193 -174 13.1758 0.268
NP_440865.1_9 Reverse -136 -155 -8.26035 0.263
NP_441052.1_2 Forward -151 -141 19.9412 0.00106
NP_441052.1_2 Reverse -142 -152 10.5014 0.0285
NP_442219.1_9 Forward -150 -141 17.7976 0.00718
NP_442219.1_9 Reverse -143 -152 8.35786 0.0681
NP_442219.1_9 Forward -250 -241 5.60459 0.146
NP_440436.1_4 Reverse -143 -152 18.1905 0.00233
NP_440436.1_4 Forward -150 -141 17.2072 0.00233
NP_441884.1_9 Reverse -22 -41 -20.8467 0.211
NP_441884.1_9 Forward -103 -84 -28.5165 0.296
NP_442864.1_7 Forward -196 -178 11.2289 0.262
NP_440314.1_9 Forward -150 -131 4.42435 0.0805
NP_441719.1_4 Forward -150 -143 16.3621 0.0124
NP_441719.1_4 Reverse -143 -150 16.3621 0.0124
NP_441733.1_10 Reverse -139 -152 7.09911 0.156
NP_441004.1_1 Reverse -227 -246 -13.3736 0.257
NP_441004.1_1 Reverse -136 -155 -14.7502 0.27
NP_442366.1_3 Reverse -141 -159 0.0191479 0.181
NP_442366.1_3 Forward -152 -134 -4.99573 0.28
NP_442366.1_5 Reverse -139 -149 15.4175 0.0374
NP_440129.1_10 Forward -158 -144 4.22782 0.185
NP_440129.1_10 Reverse -247 -261 2.45787 0.253
NP_441115.1_4 Reverse -141 -159 8.3765 0.25
NP_442206.1_10 Reverse -142 -157 1.15987 0.236
NP_440328.1_4 Forward -157 -138 -1.27885 0.299
NP_443054.1_2 Forward -153 -139 -0.0987402 0.284
NP_441851.1_10 Forward -152 -142 16.008 0.00552
NP_441851.1_10 Reverse -141 -151 15.8113 0.00552
NP_442208.1_5 Reverse -140 -159 -9.93197 0.295
NP_442856.1_7 Forward -160 -141 -0.688862 0.209
NP_441668.1_4 Reverse -132 -151 1.57275 0.212
NP_442515.1_1 Forward -152 -138 3.34284 0.12
NP_442515.1_1 Reverse -340 -354 -0.000409212 0.206
NP_442515.1_1 Reverse -141 -155 -4.52363 0.298
NP_440593.1_3 Reverse -237 -256 3.83436 0.149
NP_441540.1_8 Reverse -303 -322 21.5339 0.0423
NP_441349.1_10 Forward -161 -142 1.27776 0.084
NP_441349.1_10 Reverse -132 -151 -6.88371 0.238
NP_441409.1_6 Forward -157 -138 -15.2418 0.285
NP_440389.1_5 Forward -158 -139 11.644 0.28
NP_440432.1_9 Forward -150 -135 6.17475 0.0477
NP_439960.1_10 Forward -243 -225 2.96908 0.165
NP_439960.1_10 Forward -101 -83 0.117479 0.215
NP_442450.1_5 Reverse -140 -150 7.55152 0.13
NP_440588.1_2 Forward -160 -141 14.0608 0.0175
NP_442243.1_1 Forward -157 -139 14.9646 0.106
NP_441570.1_1 Forward -151 -133 -16.3038 0.242
NP_441570.1_1 Forward -251 -233 -17.5821 0.283
NP_441078.1_4 Forward -151 -142 19.6659 0.0007
NP_441078.1_4 Reverse -142 -151 19.6659 0.0007
NP_441078.1_4 Forward -90 -81 -1.86856 0.272
NP_442729.1_4 Reverse -173 -192 20.7464 0.0596
NP_441663.1_8 Forward -157 -138 -3.3438 0.286
NP_440526.1_3 Forward -150 -139 1.04151 0.267
NP_441432.1_8 Reverse -141 -150 16.8143 0.00595
NP_441432.1_8 Forward -152 -143 8.25953 0.0755
NP_441432.1_8 Reverse -334 -343 5.80125 0.137
NP_442320.1_8 Reverse -136 -150 13.1759 0.0144
NP_442320.1_8 Forward -157 -143 6.48943 0.0272
NP_442344.1_7 Forward -150 -131 -5.50708 0.168
NP_441732.1_2 Forward -155 -139 -6.52964 0.0495
NP_441732.1_2 Reverse -331 -347 -16.3627 0.165
NP_440760.1_1 Forward -151 -132 -11.9969 0.0903
NP_442353.1_2 Forward -290 -271 11.0125 0.184
NP_442489.1_7 Forward -151 -142 20.1576 0.000695
NP_442489.1_7 Reverse -142 -151 20.1576 0.000695
NP_442489.1_7 Forward -90 -81 -1.37691 0.195
NP_442489.1_7 Reverse -275 -284 -2.06522 0.288
NP_440386.1_3 Forward -142 -123 -7.17871 0.274
NP_442079.1_7 Forward -150 -131 0.294447 0.286
NP_440559.1_1 Forward -150 -141 17.4043 0.00658
NP_440559.1_1 Reverse -143 -152 8.75118 0.0586
NP_441659.2_8 Forward -151 -141 18.1713 0.00133
NP_441659.2_8 Reverse -142 -152 11.9764 0.0147
NP_441659.2_8 Forward -90 -80 4.40493 0.136
NP_442913.1_10 Forward -276 -257 -3.93378 0.221
NP_441040.1_5 Reverse -168 -187 7.07928 0.229
NP_442346.1_5 Reverse -141 -151 16.6963 0.00248
NP_442346.1_5 Forward -91 -81 11.1898 0.0735
NP_442346.1_5 Forward -152 -142 9.02648 0.118
NP_442346.1_5 Reverse -80 -90 6.8632 0.188
NP_440352.1_5 Reverse -144 -163 11.1957 0.267
NP_440545.1_3 Reverse -138 -155 9.67528 0.0382
NP_440545.1_3 Forward -94 -77 0.628827 0.135
NP_440545.1_3 Reverse -238 -255 -1.82945 0.175
NP_440545.1_3 Forward -348 -331 -3.20608 0.201
NP_440545.1_3 Reverse -77 -94 -3.40274 0.203
NP_440545.1_3 Forward -255 -238 -5.86102 0.262
NP_440459.1_2 Reverse -140 -157 11.3469 0.177
NP_440459.1_2 Forward -276 -259 8.7903 0.249
NP_442603.1_7 Reverse -142 -156 10.6187 0.125
NP_441888.1_7 Forward -156 -142 13.5693 0.0743
NP_441888.1_7 Reverse -249 -263 1.76955 0.239
NP_441948.1_4 Reverse -74 -92 -2.93078 0.179
NP_441948.1_4 Forward -291 -273 -4.11075 0.217
NP_441833.1_4 Forward -150 -143 15.9687 0.0124
NP_441833.1_4 Reverse -143 -150 15.9687 0.0124
NP_442699.1_8 Reverse -146 -165 5.50599 0.147
NP_442162.1_9 Forward -150 -143 16.2637 0.0124
NP_442162.1_9 Reverse -143 -150 16.2637 0.0124
NP_440671.1_4 Forward -157 -143 10.226 0.163
NP_440671.1_4 Forward -393 -379 9.73436 0.172
NP_440772.1_8 Forward -100 -81 14.4541 0.253
NP_442045.1_5 Forward -160 -141 -0.000545616 0.266
NP_442073.1_6 Forward -160 -141 -1.18052 0.271
NP_442199.1_5 Forward -159 -140 -3.63879 0.209
NP_442140.1_3 Reverse -143 -153 14.238 0.0486
NP_442140.1_3 Forward -150 -140 12.2714 0.0632
NP_441671.1_10 Reverse -74 -93 3.93269 0.219
NP_440875.1_9 Reverse -144 -154 17.327 0.0126
NP_440875.1_9 Reverse -268 -278 9.05339 0.233
NP_440875.1_9 Forward -92 -82 8.95605 0.233
NP_441813.1_5 Forward -153 -143 19.4496 0.00647
NP_441813.1_5 Reverse -140 -150 8.63316 0.0367
NP_440590.1_4 Reverse -143 -156 13.4906 0.013
NP_440590.1_4 Forward -150 -137 0.707601 0.144
NP_440567.1_1 Reverse -143 -157 9.63603 0.0422
NP_440567.1_1 Forward -150 -136 5.1128 0.107
NP_442497.1_10 Forward -150 -141 10.4228 0.0087
NP_442497.1_10 Reverse -143 -152 10.4228 0.0087
NP_442497.1_10 Forward -89 -80 0.589713 0.153
NP_442497.1_10 Reverse -276 -285 0.196389 0.208
NP_442497.1_10 Reverse -243 -252 -1.18024 0.256
NP_440821.1_4 Forward -153 -143 10.2065 0.0163
NP_440821.1_4 Reverse -140 -150 9.41981 0.0286
NP_440821.1_4 Forward -253 -243 -0.216628 0.244
NP_441239.1_9 Forward -153 -141 14.1986 0.0288
NP_441239.1_9 Reverse -140 -152 5.93884 0.202
NP_441239.1_9 Forward -92 -80 4.5622 0.251
NP_441239.1_9 Forward -45 -33 4.16888 0.26
NP_441239.1_9 Reverse -79 -91 3.67722 0.279
NP_441009.1_4 Reverse -142 -161 12.1925 0.243
NP_441892.1_1 Reverse -72 -89 -2.12444 0.218
NP_442044.1_1 Forward -256 -237 -6.68705 0.21
NP_442643.1_1 Reverse -136 -155 -11.1119 0.231
NP_441769.1_3 Reverse -124 -143 -2.16459 0.245
NP_440863.1_1 Reverse -216 -230 20.3889 0.0788
NP_441526.1_6 Reverse -225 -244 5.80098 0.265
NP_441617.1_8 Forward -144 -125 15.0432 0.124
NP_440264.1_4 Reverse -121 -140 12.0942 0.091
NP_440546.1_4 Reverse -142 -152 11.8882 0.0679
NP_440546.1_4 Forward -151 -141 10.046 0.109
NP_440546.1_4 Forward -80 -70 8.20381 0.199
NP_440546.1_6 Forward -138 -119 7.47261 0.272
NP_441230.1_3 Forward -92 -73 5.40766 0.269
NP_440675.1_1 Forward -197 -178 2.65439 0.262
NP_440462.1_6 Forward -153 -143 17.2863 0.00752
NP_440462.1_6 Reverse -140 -150 1.35667 0.294
NP_442611.1_1 Forward -256 -237 6.19431 0.169
NP_442611.1_1 Reverse -142 -161 5.11266 0.181
NP_440868.1_4 Forward -155 -143 10.5604 0.0364
NP_440868.1_4 Reverse -81 -93 6.52882 0.0878
NP_440868.1_4 Reverse -138 -150 5.84051 0.0879
NP_440868.1_4 Reverse -271 -283 1.21895 0.19
NP_440868.1_4 Reverse -238 -250 -0.846001 0.282
NP_441497.1_3 Forward -119 -100 -11.6036 0.294
NP_442402.1_2 Forward -229 -215 13.077 0.263
NP_442402.1_4 Forward -159 -140 -8.85106 0.284
NP_442402.1_4 Reverse -363 -382 -9.04772 0.285
NP_442402.1_10 Forward -315 -305 12.2709 0.218
NP_440036.1_10 Reverse -11 -23 16.8536 0.284
NP_441848.1_4 Reverse -195 -211 10.2244 0.261
NP_441848.1_8 Forward -311 -293 11.5231 0.19
NP_441084.1_6 Reverse -332 -346 9.24716 0.29
NP_440696.1_3 Forward -90 -72 1.39578 0.217
NP_442023.1_1 Reverse -176 -195 12.9783 0.285
NP_442039.1_4 Forward -150 -143 15.1821 0.0124
NP_442039.1_4 Reverse -143 -150 15.1821 0.0124
NP_442039.1_7 Reverse -337 -347 7.35486 0.277
NP_441811.1_8 Reverse -3 -17 5.99778 0.289
NP_440825.1_7 Forward -150 -140 12.9096 0.152
NP_442837.1_3 Forward -150 -143 15.7721 0.0124
NP_442837.1_3 Reverse -143 -150 15.7721 0.0124
NP_442053.1_1 Forward -151 -142 18.3876 0.0007
NP_442053.1_1 Reverse -142 -151 18.3876 0.0007
NP_442053.1_1 Forward -94 -85 3.63797 0.298
NP_440505.1_3 Forward -153 -143 15.9097 0.00857
NP_440505.1_3 Reverse -140 -150 9.22315 0.122
NP_441959.1_10 Reverse -80 -98 11.7174 0.225
NP_441252.1_8 Forward -190 -171 11.9958 0.281
NP_441203.1_1 Reverse -143 -162 -18.9784 0.297
NP_440914.1_1 Forward -151 -141 17.5935 0.000537
NP_440914.1_1 Reverse -142 -152 8.6151 0.186
NP_441011.1_8 Reverse -143 -152 16.9127 0.00602
NP_441011.1_8 Forward -150 -141 8.25953 0.144
NP_442533.1_1 Forward -197 -178 -8.45701 0.205
NP_442533.1_6 Forward -151 -142 17.2076 0.00137
NP_442533.1_6 Reverse -142 -151 17.2076 0.00137
NP_442533.1_6 Reverse -81 -90 12.7828 0.0265
NP_440263.1_5 Forward -138 -124 7.86607 0.294
NP_442232.1_3 Reverse -63 -82 -15.8318 0.296
NP_442229.1_1 Reverse -140 -154 7.3738 0.196
NP_443016.1_1 Reverse -136 -155 -5.31042 0.245
NP_443016.1_1 Forward -262 -243 -7.08038 0.267
NP_441482.1_7 Forward -157 -143 -0.688726 0.0612
NP_439944.1_9 Forward -150 -140 10.5014 0.0887
NP_441028.1_6 Forward -160 -150 15.2208 0.152
NP_441028.1_6 Reverse -389 -399 9.81266 0.21
NP_441028.1_6 Forward -23 -13 5.78111 0.243
NP_441028.1_6 Forward -161 -151 5.38779 0.255
NP_440116.1_8 Reverse -259 -278 -8.45701 0.253
NP_440115.1_6 Forward -154 -144 7.64985 0.146
NP_440007.1_9 Forward -155 -141 1.96621 0.281
NP_440007.1_9 Reverse -331 -345 0.392915 0.298
NP_439965.1_1 Forward -160 -141 -6.88371 0.218
NP_441602.1_3 Reverse -75 -94 -5.21209 0.28
NP_441170.1_4 Reverse -133 -151 4.24738 0.251
NP_441972.1_5 Reverse -324 -343 -3.24547 0.199
NP_441972.1_5 Reverse -243 -262 -5.99873 0.227
NP_441106.1_1 Forward -152 -143 18.191 0.0028
NP_441106.1_1 Reverse -141 -150 9.63616 0.0311
NP_441106.1_1 Forward -91 -82 2.94966 0.248
NP_439903.1_6 Forward -362 -343 5.11187 0.186
NP_441186.1_7 Forward -78 -59 14.0608 0.103
NP_441286.1_1 Reverse -141 -153 6.03717 0.0258
NP_441286.1_1 Forward -152 -140 3.38223 0.0467
NP_442674.1_1 Reverse -332 -351 11.1439 0.252
NP_440670.1_8 Forward -151 -142 18.3876 0.000699
NP_440670.1_8 Reverse -142 -151 18.3876 0.000699
NP_441930.1_3 Forward -143 -124 6.23263 0.263
NP_440886.1_7 Forward -152 -142 17.7774 0.0011
NP_440886.1_7 Reverse -141 -151 7.94438 0.0805
NP_440886.1_7 Reverse -274 -284 6.0761 0.147
NP_440828.1_4 Forward -258 -239 -7.57277 0.288
NP_440767.1_2 Reverse -200 -219 -4.03212 0.285
NP_442072.1_9 Reverse -141 -159 -22.6953 0.253
NP_440223.1_7 Reverse -149 -163 14.5526 0.218
NP_440907.2_8 Reverse -143 -153 7.94438 0.117
NP_440907.2_8 Forward -150 -140 7.64939 0.117
NP_442264.1_2 Forward -348 -331 10.1669 0.188
NP_441463.1_3 Reverse -132 -151 9.93088 0.0481
NP_441626.1_2 Forward -150 -143 15.7721 0.0124
NP_441626.1_2 Reverse -143 -150 15.7721 0.0124
NP_442211.1_9 Reverse -66 -85 5.01433 0.225
NP_441901.1_1 Reverse -256 -275 -0.4922 0.277
NP_442365.1_7 Forward -98 -79 -0.590531 0.181
NP_442794.1_1 Forward -155 -143 10.4621 0.0721
NP_442794.1_1 Reverse -138 -150 9.38042 0.0795
NP_442615.1_1 Forward -160 -142 5.62401 0.0376
NP_442615.1_1 Reverse -133 -151 -2.63579 0.146
NP_441962.1_4 Reverse -336 -355 -11.0136 0.236
NP_441962.1_9 Forward -301 -282 6.68596 0.258
NP_440387.1_1 Forward -151 -135 6.64671 0.0282
NP_440855.1_1 Reverse -323 -342 -1.67217 0.288
NP_441431.1_2 Forward -154 -140 19.8618 0.00685
NP_441431.1_2 Forward -93 -79 7.57046 0.238
NP_441836.1_2 Reverse -75 -94 -0.197208 0.212
NP_441993.1_1 Reverse -136 -155 10.6204 0.124
NP_440358.1_8 Forward -386 -367 4.22769 0.213
NP_440114.1_10 Forward -151 -137 5.80112 0.292
NP_442437.1_8 Forward -262 -243 9.43923 0.213
NP_442698.1_10 Reverse -58 -77 2.65439 0.284
NP_440287.1_6 Reverse -7 -26 15.1424 0.0872
NP_441272.1_7 Forward -356 -346 13.353 0.257
NP_440293.1_9 Forward -187 -173 19.7514 0.0935
NP_441237.1_9 Forward -150 -140 14.828 0.0242
NP_442743.1_4 Reverse -143 -162 0.58944 0.174
NP_442743.1_5 Reverse -137 -156 4.916 0.209
NP_441246.1_2 Forward -148 -129 7.86593 0.195
NP_442942.1_7 Forward -89 -70 7.96426 0.275
NP_439910.1_2 Reverse -134 -151 -12.7442 0.0944
NP_440457.1_1 Reverse -77 -89 8.49544 0.101
NP_440457.1_1 Forward -155 -143 7.61046 0.101
NP_442940.1_2 Reverse -238 -257 -1.37718 0.298
NP_440798.1_6 Reverse -143 -156 3.95252 0.147
NP_441436.1_8 Reverse -141 -160 9.0459 0.271
NP_440473.1_9 Reverse -282 -301 -9.93197 0.267
NP_442509.1_9 Reverse -142 -152 16.2041 0.00739
NP_442509.1_9 Forward -284 -274 8.82935 0.192
NP_442509.1_9 Forward -151 -141 8.14104 0.192
NP_440554.1_4 Reverse -143 -153 16.4996 0.0189
NP_441885.1_5 Forward -151 -141 20.9245 0.000538
NP_441885.1_5 Reverse -142 -152 11.4848 0.00668
NP_441885.1_5 Forward -25 -15 -1.78992 0.284
NP_440478.1_4 Reverse -138 -157 10.9142 0.266
NP_440478.1_10 Forward -153 -139 6.6861 0.288
NP_442341.1_7 Reverse -141 -155 10.9143 0.0591
NP_442341.1_7 Forward -152 -138 7.66941 0.0994
NP_442341.1_9 Forward -153 -139 10.5204 0.133
NP_441173.1_9 Forward -224 -216 12.9004 0.206
NP_441173.1_9 Forward -223 -215 9.75379 0.284
NP_442395.2_4 Reverse -141 -160 8.75009 0.121
NP_442395.2_4 Reverse -241 -260 4.12856 0.188
NP_443000.1_7 Forward -153 -143 11.5831 0.0344
NP_443000.1_7 Reverse -140 -150 10.3048 0.0345
NP_440275.1_3 Forward -153 -143 15.418 0.0178
NP_440275.1_3 Forward -253 -243 8.82982 0.0602
NP_440275.1_3 Reverse -140 -150 8.04317 0.0602
NP_440091.1_1 Reverse -138 -150 -0.452677 0.273
NP_442275.1_1 Reverse -276 -295 2.16274 0.284
NP_442275.1_1 Forward -284 -265 1.27776 0.284
NP_440679.1_10 Reverse -238 -257 -14.7502 0.245
NP_441105.1_3 Forward -162 -143 5.89931 0.0643
NP_441105.1_3 Forward -262 -243 0.392778 0.125
NP_441105.1_3 Reverse -131 -150 -7.76869 0.259
NP_440216.1_1 Reverse -142 -156 17.4042 0.00188
NP_440216.1_1 Forward -151 -137 -2.75368 0.0574
NP_440216.1_1 Forward -90 -76 -11.2101 0.169
NP_440172.1_1 Forward -151 -141 15.0247 0.00945
NP_440172.1_1 Reverse -142 -152 8.73149 0.0586
NP_442015.1_10 Forward -155 -142 21.4554 0.00329
NP_442015.1_10 Forward -94 -81 3.16588 0.185
NP_442015.1_10 Reverse -138 -151 1.49425 0.204
NP_441226.1_7 Forward -150 -143 14.4934 0.0123
NP_441226.1_7 Reverse -143 -150 14.4934 0.0123
NP_441226.1_7 Reverse -82 -89 11.5435 0.0757
NP_441111.1_7 Forward -150 -142 18.7023 0.00294
NP_441111.1_7 Reverse -143 -151 18.7023 0.00294
NP_441111.1_7 Forward -89 -81 -0.570565 0.233
NP_441766.1_2 Forward -151 -142 17.5026 0.00297
NP_441766.1_2 Reverse -142 -151 17.5026 0.00297
NP_441766.1_2 Reverse -81 -90 4.81794 0.158
NP_441766.1_2 Reverse -275 -284 4.62128 0.172
NP_441766.1_9 Forward -196 -177 -1.08219 0.261
NP_442417.1_5 Reverse -142 -156 16.8142 0.0349
NP_440416.1_1 Forward -151 -132 -12.5869 0.272
NP_440416.1_9 Forward -158 -139 -5.31042 0.0797
NP_440416.1_9 Forward -345 -326 -16.3235 0.212
NP_440416.1_9 Reverse -135 -154 -18.5851 0.26
NP_440416.1_9 Reverse -70 -89 -19.0768 0.269
NP_440416.1_9 Forward -97 -78 -20.7484 0.288
NP_443052.1_8 Reverse -132 -151 -9.93197 0.198
NP_443052.1_8 Reverse -328 -347 -13.6686 0.293
NP_443052.1_9 Reverse -178 -197 -5.80207 0.274
NP_440261.1_5 Reverse -143 -156 6.80412 0.0316
NP_440261.1_5 Forward -89 -76 1.88757 0.0655
NP_440261.1_5 Reverse -276 -289 -4.7006 0.165
NP_440988.1_9 Reverse -83 -102 14.0599 0.181
NP_440988.1_10 Reverse -333 -347 10.998 0.187
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

GATAGAGAGAAAAGGCGGTTGAGTATATCATGGGCATATAAGACGTTTTTGTTGGTTGCCACTGCCTTGCATAGCGAAGTTATTTGTTTTCCTCAACTACCCCTCGCTGTTTACCGGGAAATCGCGGCCCATGTGCAACAGCTTGCCGGTGTGACCGCGACCCTTCTGACTCCCACTTTTACCCAGTTTGACTATTTCAACAGTCAGGTGGGGGGCCTGGAGCTGACCCTACAGGATGATTTTTCCCCCGGCGATCGCCAAATTATTGAGGAAATTCTCGCCTTCTATGCCAAAAGATACGGCACTCCCGAGCGACGGCCCGCCATGGTTTCTTCCTACACCGCTTAGAATATCTGCTCCACTGGTCGAGAACTAGACTGTCCCCAATCATTCCAACTTG

CDS

ATGGCTGCTAACCCTGCCCTGCCCCCCCAAAACATTGAAGCTGAAGAGTGCATCCTGGGGGGGATTCTCCTCGATCCAGAGGCCATGGGGCGCATCATTGACCTCCTGGTAGTAGACGCTTTTTACGTCAAGGCCCATCGTTTGATCTATGAGGCCATGCTTAGTCTCCATGGCCAAAGTCAGCCCACGGATTTGATGTCTGTCAGCAGTTGGCTCCAAGATCACCATCATTTCGAGGCGATCGGGGGCATGGTGAAATTAACTCAATTATTAGATCGCACCATTTCAGCGGTGAACATTGACCGTTTTGCCGCCCTAATCATGGATAAATATTTGCGTCGCCAATTAATTGCAGCGGGGCATGACATCGTTGATTTGGGTTACGAAACTAGCAAAGAATTAGAAACAATTTTCGATGAATCGGAACAAAAAATATTTCGCCTCACCCAATCTCGTCCCCAAGCAGGGCTAGTACCGTTATCAGAAACCTTAGTTAATACTTTCATTGAATTAGATAAATTACACGAAAAACTTTCCAGTCCAGGGGTAGAAACCCAATTCTATGATCTTGATGCAATGACAGGGGGATTACAGCGGGCAGATTTAATTATTTTGGCCGGCAGGCCGTCGATGGGAAAAACGGCATTCGGTTTAGGAATTGCCGCTAACATCGCTAAAAACCAGAATTTGCCTGTGGCTATTTTTAGCTTAGAAATGTCCAAGGAACAGTTGGCATTAAGACTAGTGGCTAGTGAATCCTTAATTGATAGTAACCGTTTACGGACAGGGCACTTTAGCCAAGCAGAATTTGAACCTTTAACGGCGGCCATGGGCACCCTTTCCAGTTTACCTATCTACATTGACGATACGGCAAGTATTTCCGTAACCCAAATGCGTTCCCAGGTGCGTCGCCTCCAAAGTGAACAAAAAGGTCCATTGGGTATGGTTCTAATTGATTATTTGCAACTGATGGAAGGAGGCAGTGATAATCGGGTACAGGAATTATCAAAAATTACCCGTTCTCTCAAAGGTTTAGCCAGGGAAATTAACGCGCCAGTAATTGCTTTATCTCAGTTAAGTCGAGCGGTGGAATCTAGAACTAACAAACGGCCAATGATGTCAGATTTAAGAGAGAGTGGCTGCATCAGTGGAGATAGTTTGATCAGCTTGGCGAGCACAGGAAAAAGAGTTTCTATTAAAGATTTGTTAGATGAAAAAGATTTTGAAATATGGGCAATTAATGAACAGACGATGAAGCTAGAATCAGCTAAAGTTAGTCGTGTATTTTGTACTGGCAAAAAGCTAGTTTATATTTTAAAAACTCGACTAGGTAGAACTATCAAGGCAACAGCAAATCATAGATTTTTAACTATTGATGGTTGGAAAAGATTAGATGAGCTATCTTTAAAAGAGCATATTGCTCTACCCCGTAAACTAGAAAGCTCCTCTTTACAATTAATGAGTGATGAGGAACTAGGATTACTAGGGCATCTAATTGGTGATGGCTGTACTTTACCTCGCCATGCTATTCAATATACAAGCAATAAAATAGAATTAGCTGAAAAGGTAGTCGAATTAGCAAAAGCAGTTTTTGGCGACCAAATTAATCCTCGTATCAGCCAAGAAAGGCAATGGTACCAAGTTTATATCCCTGCTAGTTATCGGCTAACCCATAACAAAAAAAATCCGATTACAAAATGGCTAGAGAATTTAGACGTATTCGGACTGCGTTCCTACGAAAAATTTGTTCCTAATCAAGTTTTTGAACAACCACAGAGGGCGATCGCCATTTTTCTAAGACATTTATGGAGTACAGATGGTTGCGTCAAATTAATAGTAGAAAAATCATCTAGACCGGTAGCTTATTACGCAACTAGTAGCGAGAAGTTAGCAAAGGATGTACAGTCGTTACTCTTGAAATTAGGCATTAACGCACGTCTATCAAAAATAAGTCAGAATGGCAAAGGCAGGGATAACTATCATGTAACCATTACAGGGCAAGCTGATTTACAAATCTTTGTTGATCAAATTGGCGCTGTTGACAAAGACAAACAGGCAAGTGTTGAGGAAATTAAAACCCATATCGCTCAACATCAAGCAAACACTAACAGGGATGTCATTCCAAAACAAATTTGGAAGACCTATGTGTTGCCACAAATTCAAATAAAAGGGATAACTACTCGCGACTTGCAAATGAGACTTGGTAATGCCTACTGTGGGACAGCTCTTTATAAACATAATTTGAGTAGGGAAAGAGCAGCAAAAATAGCCACTATTACCCAATCACCAGAAATAGAAAAGTTGTCTCAGAGTGATATTTACTGGGACTCCATCGTTTCTATTACGGAGACTGGAGTCGAAGAGGTTTTTGATTTGACTGTGCCAGGACCACATAACTTTGTCGCCAATGACATCATTGTCCATAACAGTATCGAACAAGACGCAGATTTAATTATGATGATTTATCGAGATGAATATTATAATCCCGACACGCCGGACCCAGGGGTAGCAGAATTGCTAATTGTTAAACATAGAAATGGACCCACTGGCGTAGTTAAATTGTTATTTAAACCGGAATTTACCCAATTTTTAAATTTGCAACGAAGTAATGATTACTAG

Protein

MAANPALPPQNIEAEECILGGILLDPEAMGRIIDLLVVDAFYVKAHRLIYEAMLSLHGQSQPTDLMSVSSWLQDHHHFEAIGGMVKLTQLLDRTISAVNIDRFAALIMDKYLRRQLIAAGHDIVDLGYETSKELETIFDESEQKIFRLTQSRPQAGLVPLSETLVNTFIELDKLHEKLSSPGVETQFYDLDAMTGGLQRADLIILAGRPSMGKTAFGLGIAANIAKNQNLPVAIFSLEMSKEQLALRLVASESLIDSNRLRTGHFSQAEFEPLTAAMGTLSSLPIYIDDTASISVTQMRSQVRRLQSEQKGPLGMVLIDYLQLMEGGSDNRVQELSKITRSLKGLAREINAPVIALSQLSRAVESRTNKRPMMSDLRESGCISGDSLISLASTGKRVSIKDLLDEKDFEIWAINEQTMKLESAKVSRVFCTGKKLVYILKTRLGRTIKATANHRFLTIDGWKRLDELSLKEHIALPRKLESSSLQLMSDEELGLLGHLIGDGCTLPRHAIQYTSNKIELAEKVVELAKAVFGDQINPRISQERQWYQVYIPASYRLTHNKKNPITKWLENLDVFGLRSYEKFVPNQVFEQPQRAIAIFLRHLWSTDGCVKLIVEKSSRPVAYYATSSEKLAKDVQSLLLKLGINARLSKISQNGKGRDNYHVTITGQADLQIFVDQIGAVDKDKQASVEEIKTHIAQHQANTNRDVIPKQIWKTYVLPQIQIKGITTRDLQMRLGNAYCGTALYKHNLSRERAAKIATITQSPEIEKLSQSDIYWDSIVSITETGVEEVFDLTVPGPHNFVANDIIVHNSIEQDADLIMMIYRDEYYNPDTPDPGVAELLIVKHRNGPTGVVKLLFKPEFTQFLNLQRSNDY