Your browser is old and dusty. Try Google Chrome!

Details for slr0448

ORF slr0448
Accession NP_441810.1
Symbol radA
Category DNA repair protein RadA
Definition DNA replication, restriction, modification, recombination, and repair
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_441061.1_2 Forward -118 -104 -2.55701 0.296
NP_440897.1_6 Reverse -309 -328 -3.44288 0.244
NP_441453.1_4 Reverse -309 -317 3.85433 0.284
NP_441453.1_7 Forward -295 -288 11.9372 0.298
NP_442151.1_6 Forward -255 -241 5.21113 0.288
NP_440226.1_1 Forward -148 -129 2.26107 0.271
NP_441465.1_8 Forward -100 -82 11.2289 0.188
NP_442173.1_1 Forward -254 -246 8.18089 0.111
NP_442975.1_10 Reverse -66 -80 5.70218 0.212
NP_441225.1_3 Forward -241 -222 10.2259 0.257
NP_440784.1_7 Reverse -310 -317 8.59391 0.129
NP_440061.1_9 Forward -320 -306 5.89884 0.266
NP_442062.1_3 Reverse -174 -193 0.884433 0.23
NP_442062.1_8 Reverse -309 -319 6.07655 0.138
NP_442062.1_8 Forward -119 -109 3.22496 0.279
NP_441859.1_3 Forward -319 -300 1.37531 0.287
NP_441802.1_1 Reverse -94 -113 9.63589 0.205
NP_440304.1_4 Reverse -108 -118 4.20827 0.272
NP_440044.1_8 Forward -317 -298 4.71934 0.11
NP_442181.1_1 Forward -302 -283 11.9958 0.18
NP_441208.1_9 Reverse -107 -121 7.47274 0.221
NP_442110.1_7 Forward -372 -358 1.47456 0.226
NP_441738.1_2 Reverse -248 -255 10.0685 0.125
NP_440056.1_1 Forward -360 -341 7.37428 0.297
NP_441713.1_1 Reverse -271 -290 -8.26035 0.147
NP_441716.1_1 Forward -217 -203 2.75286 0.294
NP_441163.1_1 Reverse -102 -119 12.7228 0.183
NP_442634.1_4 Reverse -254 -268 -3.04867 0.16
NP_441265.1_3 Reverse -303 -317 8.16106 0.168
NP_443018.1_3 Forward -109 -102 5.34899 0.212
NP_440376.1_1 Forward -119 -110 2.458 0.221
NP_442730.1_8 Reverse -355 -374 1.86696 0.299
NP_443065.1_6 Forward -311 -292 16.6174 0.139
NP_442687.1_7 Reverse -308 -318 6.27322 0.175
NP_441077.1_6 Reverse -177 -193 2.12702 0.289
NP_440642.1_10 Forward -67 -53 6.0955 0.238
NP_441422.1_7 Forward -257 -240 -7.92597 0.264
NP_442658.1_1 Reverse -108 -118 5.58445 0.262
NP_442658.1_1 Forward -320 -310 5.48612 0.265
NP_442161.1_7 Forward -115 -96 10.3242 0.106
NP_440141.1_8 Reverse -101 -120 11.4058 0.206
NP_442782.1_2 Reverse -364 -378 2.5562 0.275
NP_440720.1_1 Reverse -235 -254 8.65258 0.178
NP_442937.1_5 Reverse -379 -398 11.6025 0.133
NP_441958.1_5 Reverse -308 -318 -0.314959 0.198
NP_440651.1_1 Forward -88 -69 6.78429 0.282
NP_439905.1_1 Reverse -358 -371 7.19745 0.264
NP_442911.1_2 Forward -129 -110 -6.78538 0.192
NP_440858.1_1 Forward -244 -225 -3.24547 0.27
NP_443055.1_6 Reverse -331 -349 4.34495 0.182
NP_440993.1_2 Reverse -63 -79 5.27008 0.237
NP_442431.1_10 Reverse -378 -396 6.214 0.195
NP_441000.1_6 Reverse -245 -259 4.03116 0.0995
NP_441000.1_6 Reverse -308 -322 2.85119 0.126
NP_440147.1_4 Reverse -307 -320 2.96921 0.199
NP_440147.1_4 Forward -121 -108 -0.767364 0.299
NP_441550.1_8 Reverse -307 -317 11.5826 0.0464
NP_441550.1_8 Reverse -244 -254 6.0761 0.214
NP_441916.1_7 Forward -318 -308 4.99491 0.15
NP_441916.1_10 Forward -356 -337 0.982764 0.27
NP_441725.1_5 Forward -254 -244 6.17489 0.115
NP_441725.1_5 Forward -118 -108 4.89658 0.115
NP_441725.1_5 Forward -317 -307 -0.314959 0.246
NP_439966.1_9 Forward -257 -248 6.29291 0.253
NP_442281.1_1 Reverse -304 -318 3.14559 0.243
NP_442281.1_1 Reverse -105 -119 2.35894 0.269
NP_440253.1_2 Forward -393 -375 -2.73412 0.274
NP_440929.1_8 Reverse -246 -255 3.04799 0.238
NP_442933.1_10 Forward -318 -309 10.6195 0.0484
NP_442554.1_8 Forward -317 -307 6.37155 0.12
NP_442554.1_8 Forward -118 -108 4.3066 0.189
NP_442554.1_8 Forward -254 -244 2.04498 0.285
NP_441762.1_7 Forward -319 -307 -6.05754 0.268
NP_442142.1_4 Reverse -306 -319 9.95012 0.083
NP_443009.1_5 Reverse -308 -319 8.31797 0.112
NP_441715.1_4 Reverse -310 -320 7.74818 0.108
NP_441198.1_8 Reverse -307 -317 12.0017 0.167
NP_441468.1_1 Forward -317 -310 4.26735 0.246
NP_441876.1_9 Forward -114 -104 12.2709 0.267
NP_441826.1_2 Reverse -339 -353 -2.85201 0.277
NP_441826.1_2 Reverse -303 -317 -4.22864 0.293
NP_441330.1_1 Reverse -304 -323 -13.9635 0.209
NP_440051.1_5 Forward -191 -177 19.1085 0.0797
NP_440145.1_3 Reverse -329 -348 -6.1954 0.292
NP_442820.1_4 Reverse -192 -209 13.7068 0.265
NP_442542.1_2 Reverse -108 -121 7.19745 0.19
NP_442050.1_5 Reverse -244 -254 9.71433 0.193
NP_442903.1_2 Forward -176 -157 6.82725 0.168
NP_440558.1_2 Reverse -106 -125 -1.7705 0.218
NP_440558.1_2 Reverse -342 -361 -3.63879 0.237
NP_441878.1_6 Reverse -109 -119 2.24165 0.0462
NP_441878.1_6 Reverse -308 -318 -0.314959 0.174
NP_441878.1_6 Forward -119 -109 -6.70647 0.194
NP_442503.1_9 Forward -119 -100 7.37428 0.272
NP_441557.1_5 Reverse -309 -318 -0.885252 0.26
NP_442777.1_1 Forward -117 -98 11.11 0.194
NP_440762.1_9 Forward -218 -202 14.2182 0.239
NP_441116.1_9 Reverse -195 -209 14.1593 0.229
NP_442444.1_6 Reverse -328 -346 12.437 0.272
NP_441467.1_10 Forward -144 -130 6.19444 0.281
NP_442347.1_2 Forward -306 -297 4.32629 0.284
NP_441633.1_3 Forward -320 -307 5.52582 0.0498
NP_441633.1_3 Forward -257 -244 -2.63565 0.177
NP_441799.1_1 Reverse -305 -319 11.012 0.0629
NP_441799.1_1 Reverse -106 -120 5.01387 0.227
NP_440256.1_1 Reverse -306 -325 -6.09707 0.201
NP_441362.1_5 Reverse -127 -145 12.1936 0.227
NP_441559.1_8 Forward -110 -96 -6.29359 0.276
NP_441559.1_8 Reverse -251 -265 -7.17857 0.287
NP_440915.1_6 Forward -322 -308 5.01447 0.0943
NP_441866.1_6 Reverse -343 -362 8.25844 0.258
NP_442555.1_6 Forward -151 -132 19.6656 0.176
NP_441464.1_8 Forward -119 -105 6.88276 0.222
NP_442386.1_9 Forward -319 -310 5.21086 0.262
NP_442386.1_10 Reverse -384 -397 4.93583 0.262
NP_441340.1_5 Forward -254 -247 3.97235 0.274
NP_442791.1_5 Forward -308 -289 -7.67036 0.279
NP_440168.1_9 Forward -120 -101 -0.000545616 0.273
NP_440586.1_8 Reverse -310 -317 9.28187 0.164
NP_441262.1_3 Forward -255 -248 11.6422 0.0477
NP_440926.1_10 Forward -29 -10 14.6508 0.259
NP_440408.1_7 Forward -360 -341 7.96426 0.284
NP_440171.1_3 Reverse -306 -325 3.83436 0.284
NP_440171.1_3 Forward -51 -32 2.55606 0.285
NP_442511.1_6 Forward -204 -185 3.14605 0.271
NP_440316.1_10 Reverse -291 -301 5.78156 0.281
NP_441803.1_2 Reverse -301 -320 0.687771 0.247
NP_439977.1_5 Forward -261 -242 3.53937 0.159
NP_442368.1_10 Forward -322 -303 14.9458 0.27
NP_441572.1_1 Forward -79 -60 -4.72043 0.235
NP_442887.1_5 Reverse -362 -381 -12.2919 0.281
NP_442384.1_10 Forward -318 -305 0.60927 0.286
NP_442384.1_10 Reverse -110 -123 0.510939 0.289
NP_442262.1_10 Forward -109 -102 7.6106 0.274
NP_440163.1_10 Forward -122 -112 14.7297 0.0937
NP_440297.1_9 Forward -317 -307 -0.609952 0.292
NP_443036.1_3 Reverse -105 -122 15.3785 0.254
NP_440999.1_9 Forward -110 -96 -3.44199 0.293
NP_441543.1_2 Reverse -310 -319 10.1278 0.0788
NP_441469.1_8 Reverse -308 -317 8.84951 0.227
NP_442337.1_8 Forward -335 -316 0.58944 0.246
NP_441306.1_10 Forward -320 -306 13.1753 0.25
NP_441306.1_10 Forward -286 -272 11.2087 0.267
NP_441462.1_2 Forward -119 -109 -1.29827 0.299
NP_443062.1_1 Reverse -246 -264 6.01073 0.211
NP_443062.1_1 Forward -318 -300 4.35311 0.264
NP_443062.1_6 Forward -126 -107 8.16093 0.152
NP_442487.1_2 Reverse -344 -363 1.17865 0.284
NP_440516.1_6 Reverse -110 -124 18.2885 0.186
NP_442428.1_5 Forward -317 -310 11.4455 0.062
NP_440436.1_4 Reverse -310 -319 4.42421 0.265
NP_441004.1_4 Reverse -107 -117 9.02648 0.259
NP_441004.1_5 Reverse -106 -120 10.816 0.241
NP_442813.1_4 Forward -65 -46 -3.63879 0.293
NP_440296.1_10 Reverse -289 -308 -12.9802 0.269
NP_440094.1_8 Reverse -259 -278 2.3594 0.242
NP_443054.1_2 Forward -120 -106 0.392915 0.267
NP_443054.1_2 Reverse -66 -80 0.196253 0.274
NP_441851.1_2 Reverse -250 -269 7.7676 0.181
NP_441046.1_2 Forward -359 -340 -0.0988766 0.276
NP_442843.1_1 Reverse -102 -121 -10.4236 0.278
NP_439960.1_4 Reverse -207 -226 11.995 0.295
NP_442168.1_5 Forward -317 -298 -3.44213 0.285
NP_442335.1_7 Reverse -111 -125 14.2569 0.213
NP_442006.1_2 Reverse -244 -261 -16.0874 0.238
NP_441570.1_1 Forward -306 -288 -16.9921 0.26
NP_441078.1_4 Reverse -110 -119 -1.6719 0.266
NP_441432.1_8 Reverse -291 -300 2.55633 0.298
NP_441432.1_9 Forward -190 -177 10.4405 0.249
NP_442489.1_7 Reverse -110 -119 -1.47524 0.203
NP_442489.1_7 Forward -318 -309 -1.6719 0.235
NP_442489.1_7 Forward -119 -110 -1.96689 0.28
NP_442079.1_7 Forward -317 -298 2.85105 0.222
NP_441040.1_2 Forward -326 -307 -12.6852 0.26
NP_441040.1_2 Forward -127 -108 -16.4218 0.296
NP_442849.1_1 Forward -42 -28 7.57108 0.287
NP_442849.1_6 Forward -110 -96 14.4542 0.236
NP_441968.1_1 Reverse -59 -67 15.162 0.257
NP_440779.1_5 Forward -318 -301 -5.95935 0.157
NP_442346.1_5 Reverse -308 -318 12.9597 0.0318
NP_442346.1_5 Reverse -109 -119 4.60159 0.281
NP_440545.1_3 Reverse -242 -259 -6.84433 0.289
NP_440847.1_3 Forward -117 -103 10.9137 0.279
NP_441948.1_4 Reverse -290 -308 -3.32411 0.19
NP_442162.1_9 Forward -254 -247 9.28223 0.0694
NP_440671.1_4 Forward -261 -247 5.40779 0.283
NP_442140.1_3 Forward -317 -307 4.0116 0.265
NP_442140.1_3 Reverse -247 -257 3.51995 0.294
NP_440875.1_9 Reverse -248 -258 11.0975 0.181
NP_440875.1_9 Forward -214 -204 6.81464 0.297
NP_440590.1_4 Reverse -247 -260 -5.38892 0.277
NP_442497.1_10 Forward -317 -308 0.29472 0.199
NP_440821.1_4 Reverse -307 -317 -0.0199663 0.217
NP_440821.1_4 Reverse -244 -254 -0.609952 0.279
NP_440227.1_2 Forward -220 -204 7.82668 0.29
NP_441239.1_9 Reverse -108 -120 13.412 0.037
NP_441239.1_9 Reverse -244 -256 9.77374 0.0972
NP_441239.1_9 Reverse -66 -78 9.47875 0.105
NP_441239.1_9 Forward -320 -308 6.03717 0.202
NP_441239.1_9 Reverse -307 -319 3.77555 0.276
NP_441239.1_9 Forward -120 -108 3.48056 0.285
NP_440400.1_1 Forward -385 -366 5.30853 0.22
NP_441892.1_1 Reverse -300 -317 -1.53445 0.208
NP_442270.1_9 Reverse -341 -360 -8.35868 0.217
NP_442270.1_9 Forward -371 -352 -8.85033 0.226
NP_440989.1_3 Reverse -105 -124 15.6341 0.138
NP_441119.1_10 Forward -321 -302 8.25926 0.234
NP_440675.1_1 Reverse -381 -400 2.55606 0.262
NP_442402.1_4 Reverse -343 -362 7.76679 0.114
NP_442402.1_4 Forward -336 -317 -4.91784 0.233
NP_441084.1_6 Reverse -323 -337 9.73195 0.269
NP_442039.1_4 Forward -254 -247 10.8555 0.109
NP_442380.1_10 Forward -215 -197 7.39397 0.286
NP_440160.1_2 Reverse -308 -327 -8.26035 0.286
NP_441252.1_6 Forward -362 -355 11.6422 0.288
NP_441408.2_7 Forward -357 -338 9.73422 0.0989
NP_442174.1_9 Reverse -254 -273 10.5209 0.168
NP_441011.1_8 Forward -317 -308 8.06287 0.16
NP_442533.1_6 Reverse -309 -318 12.8811 0.0253
NP_442533.1_6 Reverse -110 -119 4.71961 0.177
NP_442232.1_3 Reverse -238 -257 -14.5535 0.288
NP_442232.1_3 Reverse -301 -320 -15.4385 0.291
NP_439944.1_9 Forward -317 -307 5.19158 0.27
NP_441028.1_6 Forward -19 -9 7.35439 0.229
NP_441527.1_4 Reverse -51 -70 -7.78302 0.237
NP_441527.1_4 Reverse -175 -194 -13.1306 0.298
NP_440115.1_6 Reverse -306 -316 6.96153 0.166
NP_441059.1_2 Reverse -97 -116 -4.81876 0.242
NP_441602.1_3 Forward -260 -241 0.884433 0.217
NP_441972.1_5 Forward -317 -298 -9.83364 0.293
NP_441106.1_1 Forward -319 -310 4.32629 0.227
NP_439903.1_6 Forward -388 -369 1.6703 0.241
NP_442306.1_10 Forward -123 -104 -4.91709 0.11
NP_440670.1_8 Forward -255 -246 9.53783 0.0559
NP_440670.1_8 Forward -119 -110 5.01461 0.175
NP_441463.1_3 Forward -328 -309 -10.4236 0.294
NP_442615.1_1 Forward -327 -309 -3.32411 0.159
NP_442615.1_1 Reverse -300 -318 -5.97904 0.231
NP_441962.1_4 Reverse -105 -124 -11.1119 0.238
NP_441962.1_4 Reverse -241 -260 -12.2919 0.255
NP_441836.1_2 Forward -324 -305 4.12936 0.147
NP_441993.1_1 Forward -83 -64 7.89159 0.159
NP_441993.1_1 Forward -340 -321 1.4594 0.276
NP_440114.1_10 Reverse -292 -306 9.63603 0.168
NP_440114.1_10 Forward -119 -105 8.06273 0.217
NP_441425.1_6 Reverse -143 -153 15.8113 0.294
NP_441510.2_7 Reverse -42 -56 13.5686 0.28
NP_440293.1_3 Forward -330 -311 -3.3438 0.244
NP_440293.1_9 Reverse -208 -222 9.12168 0.291
NP_441237.1_9 Forward -118 -108 11.3864 0.184
NP_441237.1_9 Forward -254 -244 11.1898 0.196
NP_440502.1_3 Reverse -72 -82 14.2769 0.251
NP_441984.1_3 Reverse -57 -75 5.91901 0.276
NP_441440.1_8 Forward -369 -356 13.884 0.299
NP_440554.1_4 Reverse -310 -320 5.87989 0.129
NP_440554.1_4 Reverse -247 -257 5.28991 0.153
NP_442341.1_7 Reverse -109 -123 1.86788 0.278
NP_442341.1_7 Forward -120 -106 1.47456 0.288
NP_441173.1_9 Reverse -227 -235 10.9338 0.242
NP_440507.2_3 Reverse -300 -319 8.84842 0.241
NP_440275.1_3 Forward -257 -247 3.12662 0.235
NP_443060.1_8 Reverse -2 -21 16.0274 0.257
NP_441902.1_3 Reverse -10 -20 14.5365 0.218
NP_439962.1_4 Reverse -238 -257 -4.6221 0.271
NP_440701.1_1 Forward -266 -247 26.8438 0.000844
NP_440701.1_2 Forward -300 -281 29.8921 0.000501
NP_440701.1_4 Forward -387 -368 30.7761 0.0000687
NP_440701.1_7 Forward -228 -209 18.584 0.126
NP_440046.1_5 Reverse -176 -195 10.1973 0.222
NP_442417.1_2 Reverse -334 -352 12.5072 0.269
NP_440416.1_9 Reverse -302 -321 -17.2085 0.234
NP_443052.1_8 Reverse -299 -318 -10.817 0.216
NP_443052.1_8 Reverse -318 -337 -13.2752 0.279
NP_442154.1_1 Reverse -382 -400 -15.0255 0.218
NP_440261.1_5 Forward -317 -304 6.60746 0.0318
NP_440261.1_5 Forward -118 -105 -12.4687 0.297
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

CATGCAACCCAACCACCACATTTCCAAAACTGTCCGCATTGGGGAAGTCAATGACGAAGGTCAGTTCACCATTGTTTGGTCCAGTGATGGCCCCGTGGACCCCATTCCCTGGAACCAGTTCGTACCGGAAACCAAAGGTTTCACCTGCGATTGGACCCGCACAGATGTGGAAAATCCTGGTAAGTTCAAGGCCAGCTAAATTGGCCTAGTTTTTACTAGTTTTTAACCGAGTAAAGAACTAAAACACTGCTCACTGATTGTTTGATGGTTTGAATTATTACGGCCATTGGCCCCATTGATTTCCCTAGAACGGAATTTGAAGGGGCCAGTGGTTTTTTCTTGCTCCATTCGGCGTGATTAGGTGAAGATAGGGCCCTAAGTTTCTCCTCCATTGACAACC

CDS

ATGGCTAAAGCCCGGACAAAGTTTGTTTGCTCTGCCTGTGGGGCGGATCATGCCCAATGGTTTGGCCGCTGCCCCAAATGCCATGAGTATGGAAGTTTGCAGGAGGAAATTGTCAATGCCGTTTCTAGTGGTACCAATCACCGTAGTTTAGGGGCGCAAAAATCCCGTTCTTCCAAGGTAAAAACCGGCCAGCCCCAGGCGGCTTTAACTTTTTCCCAGATTCGCCAGGAAAATCAAGGGCGTTTCCTCTCTGGTTACGGGGAGTTGGACCGGGTTTTGGGAGGGGGCATTGTGCCAGGGGCGTTAATTTTAATTGGCGGAGATCCGGGCATTGGCAAATCAACTTTGTTGCTCCAGGTGGCTTTCCAGTTGGCCACCCGTTTGCCCCGGATTTTATACGTTTCAGCGGAGGAATCAGGACAACAAATTAAGCTCCGAGCCACCCGCTTAGGCATTACCCAAACCGTTGAGCCAAGCCAAGCTCAAGATGGCATAAACAATCTTGCCCACGATGGCAATTTATTTGTTTTACCGGAAACTAATTTGGACGATATTTTGCGGGAATTGGAAGCCTTGCAACCCCAGGTGGCCATCATTGACAGTATTCAAAATTTATATTTTCCGGCCCTTAGTTCGGCCCCTGGTTCCGTTTCCCAAGTGCGGGAATGTACGGGTTTATTAATGCAATTGGCCAAGCGAGATCACATTAGTTTGTTTATTGTGGGGCACGTAACTAAAGAAGGGGCGATCGCCGGGCCGAAGGTTTTGGAGCATTTGGTGGATACGGTGTTGTATTTTCAGGGCGATCGATTTGCATCCCATCGCTTGCTGAGATCCGTAAAAAATCGTTTTGGGGCCACCCAGGAAATCGGCATTTTTGAAATGGTGCAATCGGGGCTGCAGGAAGTGCTCAACCCGTCCCAATTATTTTTGGGCAGTCGGGAGGAATTTATGTCCGGCACCGCCATCACTGTGGCTTGTGAAGGTACCCGCCCCTTGGTGGTGGAATTGCAAGCTTTAGTGAGTCCCACCAGTTACGCTTCCCCTCGGCGATCGACTACTGGGGTGGACTACAATCGCCTTTTACAAGTTCTGGCTGTATTGGAAAAACGCCTGGGGGTACCCCTCTCTAAATTGGATGCGTACCTATCGGTGGCGGGGGGTCTGGAGGTGGAAGAACCGGCGGTGGATTTGGCCATGGCGATCGCCTTGGTGGCTAGTTTCCGGGACCGGGTGGTGGACCCAACCATGATTATTCTGGGGGAAATCGGTTTAGGCGGCCAAATTCGTCCCGTTTCCCAGTTAGAAATTCGTTTAAAAGAAGCGGCAAAGTTAGGGTTCAAAAAGGCCATTGTGCCCAAAGGTCAAACGGGCATTGAATCCGCTGGCATCAAGCTGATCCCTGTAGGCAAGGTCTTTGCGGCGATCGCCGTTGCTCTACCAGCCAACGAAAATACAACGGATCAAGGCAATGGGTCAGAAGCCAAAATTGAGGAGGACTTAGGTAAAAAGGATTAG

Protein

MAKARTKFVCSACGADHAQWFGRCPKCHEYGSLQEEIVNAVSSGTNHRSLGAQKSRSSKVKTGQPQAALTFSQIRQENQGRFLSGYGELDRVLGGGIVPGALILIGGDPGIGKSTLLLQVAFQLATRLPRILYVSAEESGQQIKLRATRLGITQTVEPSQAQDGINNLAHDGNLFVLPETNLDDILRELEALQPQVAIIDSIQNLYFPALSSAPGSVSQVRECTGLLMQLAKRDHISLFIVGHVTKEGAIAGPKVLEHLVDTVLYFQGDRFASHRLLRSVKNRFGATQEIGIFEMVQSGLQEVLNPSQLFLGSREEFMSGTAITVACEGTRPLVVELQALVSPTSYASPRRSTTGVDYNRLLQVLAVLEKRLGVPLSKLDAYLSVAGGLEVEEPAVDLAMAIALVASFRDRVVDPTMIILGEIGLGGQIRPVSQLEIRLKEAAKLGFKKAIVPKGQTGIESAGIKLIPVGKVFAAIAVALPANENTTDQGNGSEAKIEEDLGKKD