Your browser is old and dusty. Try Google Chrome!

Details for slr0446

ORF slr0446
Accession NP_441808.1
Symbol dnaX
Category DNA polymerase III delta' subunit
Definition DNA replication, restriction, modification, recombination, and repair
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_442711.1_1 Reverse -116 -130 12.0943 0.222
NP_441061.1_2 Forward -383 -369 11.0127 0.0548
NP_441061.1_2 Reverse -303 -317 6.98109 0.11
NP_441061.1_2 Forward -124 -110 2.65453 0.173
NP_441061.1_2 Reverse -117 -131 1.27789 0.192
NP_441061.1_2 Forward -395 -381 0.0979218 0.218
NP_441061.1_2 Forward -317 -303 -1.08205 0.249
NP_440557.1_1 Reverse -117 -136 -1.96717 0.28
NP_440795.1_7 Forward -124 -117 14.6904 0.0123
NP_440795.1_7 Reverse -117 -124 14.6904 0.0123
NP_441418.1_6 Forward -125 -106 -18.2901 0.0827
NP_441418.1_6 Reverse -375 -394 -18.9784 0.0841
NP_441418.1_6 Forward -264 -245 -19.6667 0.093
NP_441418.1_6 Reverse -116 -135 -20.4534 0.114
NP_441418.1_6 Reverse -381 -400 -29.7948 0.238
NP_441418.1_6 Forward -185 -166 -30.1882 0.262
NP_441418.1_6 Reverse -308 -327 -30.4831 0.28
NP_441418.1_6 Forward -258 -239 -30.7781 0.296
NP_440897.1_6 Forward -125 -106 -2.75457 0.221
NP_441453.1_4 Reverse -116 -124 16.539 0.00633
NP_441453.1_4 Forward -125 -117 16.539 0.00633
NP_441453.1_4 Reverse -381 -389 5.0343 0.209
NP_441453.1_4 Forward -264 -256 5.0343 0.209
NP_441453.1_4 Forward -317 -309 4.24765 0.259
NP_441453.1_4 Reverse -176 -184 4.14932 0.264
NP_441453.1_7 Forward -323 -316 12.1338 0.295
NP_441623.1_1 Reverse -91 -109 -3.32411 0.258
NP_442151.1_6 Reverse -116 -130 12.4876 0.0722
NP_442151.1_6 Reverse -308 -322 11.111 0.108
NP_442151.1_6 Forward -125 -111 11.0127 0.109
NP_442151.1_6 Forward -185 -171 7.9644 0.184
NP_441818.1_1 Forward -263 -252 11.5629 0.176
NP_441818.1_1 Forward -124 -113 9.79292 0.232
NP_440226.1_1 Reverse -116 -135 10.6192 0.061
NP_440226.1_1 Forward -125 -106 2.75272 0.253
NP_440226.1_1 Forward -264 -245 2.16274 0.276
NP_441465.1_8 Forward -180 -162 6.80398 0.25
NP_441630.1_3 Reverse -108 -127 -0.0988766 0.285
NP_442623.1_3 Forward -124 -105 1.17943 0.0521
NP_440150.1_6 Forward -128 -109 2.3594 0.273
NP_443002.1_5 Forward -383 -365 16.0463 0.192
NP_442173.1_1 Forward -124 -116 15.4574 0.00633
NP_442173.1_1 Reverse -117 -125 15.4574 0.00633
NP_442173.1_1 Forward -395 -387 5.23096 0.216
NP_442752.1_4 Forward -125 -118 13.8055 0.0199
NP_442752.1_4 Reverse -116 -123 13.8055 0.0199
NP_442752.1_4 Reverse -255 -262 10.8555 0.0846
NP_442752.1_4 Forward -264 -257 5.25066 0.256
NP_443027.1_4 Forward -127 -117 13.943 0.0452
NP_443027.1_4 Reverse -114 -124 11.0914 0.107
NP_443027.1_4 Reverse -306 -316 6.76487 0.269
NP_441812.1_1 Reverse -272 -286 12.3887 0.248
NP_442975.1_10 Forward -129 -115 21.6317 0.000774
NP_442975.1_10 Forward -394 -380 3.63724 0.252
NP_440784.1_7 Forward -124 -117 15.9687 0.0123
NP_440784.1_7 Reverse -117 -124 15.9687 0.0123
NP_440061.1_9 Forward -127 -113 11.012 0.117
NP_440061.1_9 Forward -187 -173 7.66879 0.198
NP_440061.1_9 Forward -398 -384 7.17714 0.216
NP_440061.1_9 Reverse -114 -128 5.1122 0.294
NP_441476.1_5 Forward -130 -111 -3.3438 0.235
NP_440878.1_9 Forward -135 -116 -1.96717 0.258
NP_442062.1_2 Reverse -370 -389 7.57094 0.284
NP_442062.1_8 Reverse -116 -126 19.4496 0.000558
NP_442062.1_8 Forward -125 -115 17.3846 0.00193
NP_442062.1_8 Forward -185 -175 4.79825 0.198
NP_442062.1_8 Forward -264 -254 4.20827 0.228
NP_441859.1_3 Forward -126 -107 2.16195 0.266
NP_441859.1_3 Forward -397 -378 2.06362 0.267
NP_440304.1_4 Forward -127 -117 9.91146 0.051
NP_440304.1_4 Forward -398 -388 5.28991 0.218
NP_440304.1_4 Reverse -114 -124 1.84832 0.299
NP_442242.1_4 Forward -124 -117 14.3954 0.0124
NP_442242.1_4 Reverse -117 -124 14.3954 0.0124
NP_441660.1_9 Forward -248 -229 10.0292 0.218
NP_440011.1_1 Reverse -307 -326 13.2741 0.258
NP_439918.1_2 Reverse -356 -375 2.16274 0.207
NP_439918.1_2 Reverse -369 -388 -2.36049 0.242
NP_439918.1_2 Reverse -363 -382 -5.11376 0.298
NP_441208.1_9 Forward -267 -253 9.5377 0.209
NP_441208.1_9 Forward -188 -174 9.43936 0.213
NP_441208.1_9 Forward -243 -229 8.55439 0.219
NP_441208.1_9 Reverse -113 -127 7.76774 0.219
NP_440370.1_10 Forward -178 -159 7.37428 0.258
NP_440132.1_1 Reverse -367 -385 16.9321 0.0756
NP_442375.1_5 Forward -309 -295 19.4684 0.272
NP_442110.1_7 Reverse -116 -130 10.226 0.0684
NP_442110.1_7 Forward -125 -111 1.76955 0.222
NP_440856.1_4 Reverse -109 -128 5.99764 0.0783
NP_440856.1_7 Forward -267 -248 -3.73712 0.202
NP_440856.1_7 Forward -258 -239 -6.78538 0.246
NP_441083.1_5 Forward -125 -115 20.3345 0.00053
NP_441083.1_5 Reverse -255 -265 14.533 0.0143
NP_441083.1_5 Reverse -116 -126 11.3864 0.0159
NP_441083.1_5 Forward -264 -254 9.51814 0.026
NP_441083.1_5 Forward -185 -175 1.06167 0.218
NP_441434.1_7 Reverse -118 -132 3.34284 0.249
NP_441738.1_2 Forward -123 -116 15.28 0.0102
NP_441738.1_2 Reverse -118 -125 15.28 0.0102
NP_441558.1_5 Reverse -114 -133 20.7473 0.00412
NP_441558.1_5 Reverse -174 -193 8.75091 0.141
NP_441558.1_5 Reverse -306 -325 4.22769 0.286
NP_440209.1_1 Reverse -116 -124 18.1123 0.00295
NP_440209.1_1 Forward -125 -117 18.1123 0.00295
NP_442889.1_1 Reverse -302 -321 -10.817 0.217
NP_442889.1_8 Forward -128 -114 13.2736 0.0588
NP_442889.1_8 Reverse -280 -294 5.01387 0.243
NP_441713.1_1 Reverse -170 -189 9.83255 0.052
NP_441713.1_1 Forward -131 -112 -16.4218 0.283
NP_440178.1_7 Reverse -227 -246 -21.24 0.215
NP_440178.1_7 Reverse -115 -134 -22.0267 0.249
NP_442570.1_3 Reverse -366 -385 2.85105 0.18
NP_441716.1_1 Forward -125 -111 19.9608 0.00829
NP_441716.1_1 Forward -185 -171 9.83269 0.105
NP_441716.1_1 Reverse -1 -15 3.73617 0.259
NP_441327.1_1 Forward -48 -29 10.941 0.184
NP_442111.1_4 Reverse -115 -129 12.586 0.0422
NP_442111.1_4 Forward -163 -149 5.50613 0.162
NP_442111.1_4 Forward -126 -112 5.21113 0.172
NP_442111.1_4 Reverse -380 -394 3.8345 0.229
NP_440481.1_6 Forward -121 -103 16.8337 0.116
NP_440343.1_9 Forward -250 -231 6.39097 0.3
NP_440906.1_5 Forward -124 -117 15.8704 0.0124
NP_440906.1_5 Reverse -117 -124 15.8704 0.0124
NP_440906.1_9 Forward -391 -372 13.2733 0.296
NP_440747.1_10 Reverse -113 -125 26.5883 0.000317
NP_440747.1_10 Reverse -173 -185 -2.02597 0.0196
NP_440747.1_10 Forward -128 -116 -2.02597 0.0196
NP_440747.1_10 Forward -267 -255 -4.28759 0.0903
NP_440747.1_10 Reverse -252 -264 -12.1541 0.227
NP_440747.1_10 Reverse -305 -317 -12.2524 0.254
NP_441130.1_10 Reverse -114 -128 15.2409 0.034
NP_441130.1_10 Forward -127 -113 11.0127 0.107
NP_441486.1_1 Forward -128 -114 5.01447 0.0398
NP_441486.1_1 Forward -393 -379 0.982901 0.122
NP_441486.1_1 Reverse -113 -127 -4.22864 0.192
NP_441486.1_1 Reverse -252 -266 -4.52363 0.201
NP_440944.1_2 Forward -119 -100 -3.44213 0.292
NP_442634.1_4 Forward -127 -113 -2.85201 0.156
NP_442634.1_4 Reverse -114 -128 -3.34366 0.161
NP_442634.1_4 Forward -187 -173 -4.91696 0.223
NP_442634.1_4 Forward -319 -305 -5.11362 0.235
NP_441265.1_3 Reverse -110 -124 4.32615 0.181
NP_441265.1_3 Forward -131 -117 1.67122 0.2
NP_441014.1_8 Reverse -342 -361 -9.83364 0.299
NP_442848.1_1 Forward -131 -117 -3.24533 0.263
NP_442848.1_9 Reverse -375 -394 5.30933 0.202
NP_442848.1_9 Reverse -309 -328 3.83436 0.215
NP_443018.1_3 Forward -124 -117 14.8871 0.0123
NP_443018.1_3 Reverse -117 -124 14.8871 0.0123
NP_443018.1_3 Forward -316 -309 12.5271 0.0523
NP_443018.1_3 Reverse -309 -316 12.5271 0.0523
NP_443018.1_3 Forward -184 -177 4.26735 0.267
NP_443018.1_3 Reverse -177 -184 4.16902 0.278
NP_441316.1_7 Forward -319 -304 -3.56002 0.282
NP_441634.1_1 Reverse -303 -322 -0.983855 0.275
NP_441634.1_8 Reverse -114 -128 24.5823 0.00171
NP_441634.1_8 Reverse -379 -393 -3.44199 0.295
NP_440376.1_1 Forward -125 -116 19.4693 0.000692
NP_440376.1_1 Reverse -116 -125 19.4693 0.000692
NP_440376.1_1 Forward -185 -176 14.356 0.01
NP_440376.1_1 Forward -264 -255 7.07956 0.0869
NP_440376.1_1 Reverse -255 -264 5.89959 0.116
NP_440376.1_1 Reverse -176 -185 0.393051 0.279
NP_440376.1_1 Forward -272 -263 0.196389 0.283
NP_440376.1_1 Reverse -381 -390 -1.27858 0.297
NP_441588.1_4 Forward -167 -157 13.648 0.0943
NP_441588.1_4 Reverse -118 -128 6.96153 0.178
NP_442687.1_7 Forward -126 -116 15.8113 0.0125
NP_442687.1_7 Reverse -115 -125 8.92815 0.0994
NP_442687.1_7 Reverse -175 -185 4.79825 0.234
NP_442191.1_4 Forward -159 -145 11.9627 0.233
NP_442191.1_4 Forward -124 -110 11.6718 0.247
NP_442191.1_7 Forward -124 -105 17.3057 0.206
NP_442485.1_3 Reverse -370 -389 2.3594 0.213
NP_442485.1_3 Forward -328 -309 -1.37718 0.257
NP_441846.1_10 Forward -125 -106 -22.2233 0.257
NP_441013.1_2 Reverse -105 -123 -2.43913 0.282
NP_440533.1_9 Forward -125 -106 6.98095 0.189
NP_440533.1_9 Reverse -116 -135 6.78429 0.189
NP_442296.1_9 Forward -131 -112 0.196116 0.197
NP_441763.1_10 Forward -136 -117 7.17681 0.248
NP_440360.1_5 Forward -284 -265 2.55606 0.297
NP_440360.1_10 Forward -394 -380 1.86788 0.282
NP_442658.1_1 Forward -127 -117 18.7607 0.00222
NP_442658.1_1 Reverse -114 -124 7.94438 0.199
NP_442658.1_1 Reverse -373 -383 6.96107 0.214
NP_440141.1_8 Reverse -366 -385 3.83436 0.298
NP_441414.1_9 Forward -125 -106 -4.91709 0.164
NP_441414.1_9 Reverse -116 -135 -5.60541 0.178
NP_442937.1_5 Reverse -376 -395 18.7807 0.0243
NP_442937.1_5 Reverse -111 -130 7.17762 0.26
NP_442321.1_1 Reverse -306 -325 3.53937 0.126
NP_441958.1_5 Forward -126 -116 12.2714 0.00183
NP_441958.1_5 Reverse -115 -125 12.2714 0.00183
NP_441958.1_5 Forward -186 -176 1.94665 0.0664
NP_441958.1_5 Forward -265 -255 0.963343 0.12
NP_441958.1_5 Reverse -254 -264 0.176696 0.164
NP_441958.1_5 Reverse -152 -162 -2.57657 0.28
NP_441127.1_1 Reverse -381 -395 9.5377 0.272
NP_440203.1_5 Reverse -179 -189 13.2542 0.122
NP_439905.1_1 Forward -383 -370 16.1456 0.0699
NP_439905.1_2 Reverse -105 -119 9.43936 0.233
NP_440984.1_7 Forward -269 -255 11.6026 0.122
NP_440984.1_7 Forward -130 -116 10.6193 0.122
NP_440984.1_7 Forward -388 -374 4.62115 0.296
NP_441162.1_3 Forward -363 -344 8.06259 0.275
NP_439990.1_5 Reverse -111 -124 23.3237 0.000299
NP_439990.1_5 Reverse -171 -184 10.2457 0.128
NP_442376.1_2 Forward -130 -111 -11.9969 0.286
NP_442911.1_2 Forward -135 -116 4.916 0.0361
NP_442911.1_2 Reverse -106 -125 0.884433 0.0635
NP_442911.1_2 Forward -400 -381 -7.08038 0.2
NP_441580.1_6 Forward -136 -117 3.44104 0.117
NP_441580.1_6 Forward -395 -376 -0.590531 0.168
NP_440153.1_5 Reverse -161 -175 7.47274 0.161
NP_440153.1_5 Reverse -117 -131 3.93283 0.199
NP_443055.1_6 Reverse -255 -273 1.98502 0.222
NP_443055.1_6 Reverse -232 -250 0.0184138 0.251
NP_440993.1_2 Forward -130 -114 2.91013 0.262
NP_440993.1_3 Reverse -106 -125 2.6536 0.201
NP_440993.1_3 Forward -135 -116 0.392004 0.255
NP_440138.1_6 Forward -124 -105 2.85027 0.259
NP_441099.1_5 Reverse -106 -125 16.0274 0.0153
NP_441099.1_5 Reverse -166 -185 0.786102 0.073
NP_441099.1_5 Forward -135 -116 -9.24366 0.216
NP_442002.1_9 Forward -126 -119 10.7572 0.185
NP_441294.1_7 Forward -129 -115 17.2177 0.0101
NP_441646.1_1 Reverse -109 -128 0.884433 0.242
NP_441646.1_1 Forward -192 -173 0.687771 0.245
NP_442438.1_10 Forward -130 -116 17.7975 0.0179
NP_442438.1_10 Reverse -111 -125 0.786239 0.213
NP_442438.1_10 Forward -395 -381 0.0979218 0.239
NP_442431.1_10 Reverse -369 -387 0.805796 0.266
NP_441000.1_6 Reverse -115 -129 -3.44199 0.221
NP_441000.1_6 Forward -126 -112 -3.93365 0.225
NP_442870.1_2 Forward -278 -262 15.0048 0.297
NP_440147.1_4 Reverse -114 -127 16.8339 0.00906
NP_440147.1_4 Forward -127 -114 11.0324 0.0341
NP_440147.1_4 Forward -187 -174 3.06754 0.196
NP_441550.1_8 Reverse -114 -124 15.1225 0.0132
NP_441550.1_8 Forward -127 -117 10.501 0.066
NP_441550.1_8 Forward -266 -256 7.25606 0.169
NP_441550.1_8 Forward -319 -309 4.7978 0.283
NP_441916.1_7 Reverse -116 -126 18.4663 0.00144
NP_441916.1_7 Forward -125 -115 10.3048 0.0261
NP_441041.1_4 Reverse -263 -282 9.83255 0.0309
NP_441041.1_4 Forward -125 -106 5.50599 0.0506
NP_441041.1_4 Forward -185 -166 3.73603 0.0627
NP_441041.1_4 Reverse -381 -400 -2.45882 0.112
NP_441041.1_4 Reverse -116 -135 -8.26035 0.199
NP_441041.1_4 Reverse -375 -394 -9.63698 0.219
NP_441041.1_7 Forward -128 -116 19.5648 0.00277
NP_441041.1_7 Reverse -113 -125 7.51478 0.162
NP_440016.1_9 Reverse -110 -129 17.699 0.259
NP_442396.1_5 Reverse -251 -264 10.639 0.106
NP_441547.1_2 Reverse -105 -123 7.78729 0.215
NP_441725.1_4 Reverse -111 -125 4.42388 0.278
NP_441725.1_5 Reverse -117 -127 9.02648 0.0553
NP_441725.1_5 Forward -124 -114 2.04498 0.115
NP_441725.1_5 Reverse -309 -319 -0.0199663 0.223
NP_439966.1_7 Forward -127 -117 17.4824 0.00636
NP_439966.1_7 Reverse -114 -124 15.3192 0.0152
NP_439966.1_9 Forward -127 -118 10.7178 0.0863
NP_442941.1_3 Forward -124 -114 19.2529 0.00262
NP_442941.1_3 Forward -263 -253 7.84651 0.0564
NP_442941.1_3 Reverse -117 -127 2.53664 0.14
NP_440289.1_2 Forward -128 -115 19.6855 0.00426
NP_440289.1_2 Reverse -113 -126 -3.61896 0.267
NP_440983.1_5 Forward -261 -242 4.32602 0.192
NP_442281.1_1 Forward -130 -116 17.6985 0.00542
NP_442281.1_1 Forward -322 -308 14.0603 0.0216
NP_442281.1_1 Forward -269 -255 10.0287 0.0639
NP_442281.1_1 Reverse -111 -125 8.45543 0.0808
NP_442281.1_1 Reverse -185 -199 8.16044 0.0845
NP_441334.1_7 Forward -127 -108 -18.5851 0.275
NP_440177.1_9 Reverse -255 -274 12.1925 0.238
NP_442256.1_2 Forward -127 -109 -9.22396 0.254
NP_440437.1_1 Reverse -110 -129 0.884433 0.162
NP_442012.1_1 Reverse -170 -189 -1.27885 0.282
NP_441556.1_10 Reverse -111 -125 12.4606 0.195
NP_441556.1_10 Reverse -171 -185 10.0271 0.28
NP_440498.1_1 Forward -134 -116 4.05072 0.133
NP_442982.1_5 Forward -135 -116 -2.36049 0.286
NP_441644.1_6 Forward -125 -115 17.3841 0.00127
NP_441644.1_6 Forward -317 -307 13.1559 0.0227
NP_441644.1_6 Reverse -116 -126 10.1076 0.0628
NP_441644.1_6 Reverse -176 -186 7.84605 0.115
NP_441644.1_6 Forward -264 -254 7.35439 0.129
NP_441644.1_6 Forward -185 -175 6.37109 0.161
NP_441644.1_6 Reverse -90 -100 5.09279 0.21
NP_441644.1_6 Reverse -263 -273 3.42118 0.282
NP_442215.1_2 Forward -127 -111 3.99177 0.0889
NP_442215.1_2 Reverse -300 -316 3.00846 0.104
NP_442215.1_2 Reverse -114 -130 0.648521 0.148
NP_442215.1_2 Reverse -174 -190 -4.26803 0.23
NP_442215.1_2 Forward -392 -376 -7.11963 0.286
NP_440253.1_2 Reverse -116 -134 4.34571 0.104
NP_440253.1_2 Forward -125 -107 -3.12744 0.286
NP_440929.1_8 Forward -125 -116 19.2726 0.000701
NP_440929.1_8 Reverse -116 -125 19.2726 0.000701
NP_440929.1_8 Forward -264 -255 6.78456 0.082
NP_440929.1_8 Reverse -176 -185 6.68623 0.0887
NP_440566.1_2 Reverse -310 -329 5.60432 0.273
NP_442933.1_10 Forward -125 -116 17.601 0.00325
NP_442933.1_10 Reverse -116 -125 17.601 0.00325
NP_442933.1_10 Forward -185 -176 5.01461 0.204
NP_440382.1_2 Reverse -282 -301 1.6703 0.286
NP_441751.2_8 Forward -124 -110 5.01447 0.0448
NP_442926.1_3 Reverse -297 -316 2.0644 0.296
NP_442554.1_8 Forward -124 -114 16.2046 0.0065
NP_442554.1_8 Reverse -117 -127 16.008 0.0065
NP_442554.1_8 Reverse -309 -319 12.0747 0.0295
NP_442554.1_8 Forward -316 -306 11.7798 0.0325
NP_442554.1_8 Forward -184 -174 7.45319 0.092
NP_442554.1_8 Reverse -177 -187 5.87989 0.135
NP_442554.1_8 Reverse -256 -266 2.04498 0.285
NP_441762.1_7 Reverse -115 -127 12.4287 0.0142
NP_441762.1_7 Forward -126 -114 2.39892 0.0676
NP_442142.1_4 Reverse -113 -126 16.0466 0.0264
NP_442142.1_4 Forward -128 -115 13.8833 0.0324
NP_442142.1_4 Reverse -173 -186 4.83694 0.209
NP_442292.1_1 Forward -124 -115 18.486 0.00229
NP_442292.1_1 Reverse -117 -126 9.63616 0.0183
NP_442292.1_1 Reverse -177 -186 5.11294 0.162
NP_442292.1_1 Forward -316 -307 4.22796 0.181
NP_442292.1_1 Forward -389 -380 -0.68859 0.268
NP_442292.1_1 Forward -263 -254 -0.68859 0.268
NP_442292.1_1 Forward -184 -175 -0.786921 0.287
NP_442292.1_5 Forward -286 -267 -1.57384 0.265
NP_442476.1_6 Reverse -117 -131 7.57108 0.112
NP_440895.1_6 Reverse -110 -123 10.049 0.202
NP_442381.1_8 Forward -128 -109 5.01433 0.0708
NP_441711.1_4 Forward -134 -115 8.06259 0.144
NP_441523.1_6 Reverse -172 -191 2.75272 0.286
NP_443009.1_5 Reverse -115 -126 18.3477 0.00265
NP_443009.1_5 Reverse -254 -265 4.67974 0.234
NP_443009.1_5 Forward -318 -307 4.08976 0.263
NP_442301.1_2 Forward -388 -369 3.9319 0.284
NP_441715.1_4 Forward -124 -114 17.3846 0.0106
NP_441715.1_4 Reverse -117 -127 9.32148 0.097
NP_440357.1_3 Forward -127 -108 2.16274 0.269
NP_440881.1_3 Forward -395 -376 15.1416 0.276
NP_440183.1_9 Reverse -310 -329 -13.7669 0.26
NP_440379.1_5 Forward -393 -374 1.96607 0.153
NP_441468.1_1 Forward -124 -117 15.8704 0.0124
NP_441468.1_1 Reverse -117 -124 15.8704 0.0124
NP_441468.1_1 Forward -184 -177 4.36568 0.237
NP_441468.1_1 Reverse -309 -316 3.97235 0.277
NP_441468.1_1 Forward -316 -309 3.97235 0.277
NP_442099.1_1 Forward -389 -371 14.8671 0.274
NP_441020.2_6 Forward -127 -110 6.03703 0.28
NP_441015.1_10 Forward -245 -226 -4.03212 0.197
NP_441015.1_10 Reverse -111 -130 -5.01543 0.215
NP_441015.1_10 Forward -124 -105 -8.06369 0.272
NP_441015.1_10 Reverse -309 -328 -10.3253 0.284
NP_441673.1_1 Forward -125 -116 20.8459 0.000698
NP_441673.1_1 Reverse -116 -125 20.8459 0.000698
NP_441673.1_1 Forward -185 -176 1.57302 0.0764
NP_441673.1_1 Reverse -176 -185 1.57302 0.0764
NP_441673.1_1 Forward -264 -255 1.27803 0.155
NP_441673.1_1 Reverse -255 -264 1.27803 0.155
NP_441673.1_1 Reverse -381 -390 -8.06341 0.254
NP_441731.1_3 Reverse -108 -127 -6.39206 0.29
NP_441876.1_9 Reverse -340 -350 14.6309 0.267
NP_441826.1_2 Forward -131 -117 13.9626 0.0213
NP_441826.1_2 Reverse -110 -124 -2.65535 0.273
NP_441826.1_2 Reverse -170 -184 -3.24533 0.284
NP_441826.1_2 Reverse -263 -277 -3.34366 0.284
NP_441826.1_2 Reverse -147 -161 -4.03198 0.291
NP_442490.1_9 Reverse -216 -235 -1.08219 0.179
NP_442490.1_9 Forward -125 -106 -5.01543 0.273
NP_442868.1_6 Reverse -114 -124 19.2529 0.00563
NP_442868.1_6 Forward -127 -117 8.53483 0.0555
NP_442868.1_6 Reverse -174 -184 -0.41329 0.295
NP_442719.1_2 Reverse -90 -108 -9.81463 0.267
NP_441056.1_1 Forward -125 -106 -0.295539 0.16
NP_441056.1_1 Forward -390 -371 -7.37537 0.272
NP_441612.1_2 Forward -125 -115 8.54929 0.21
NP_442227.1_2 Reverse -100 -119 2.0644 0.239
NP_443058.1_7 Reverse -115 -134 1.76941 0.294
NP_442427.1_5 Reverse -176 -195 12.5858 0.148
NP_442808.1_1 Forward -126 -116 18.4657 0.00201
NP_442808.1_1 Reverse -115 -125 8.63269 0.0481
NP_442808.1_1 Forward -265 -255 6.76441 0.0982
NP_442808.1_1 Forward -385 -375 5.68278 0.144
NP_442808.1_1 Reverse -175 -185 4.7978 0.19
NP_442808.1_1 Reverse -230 -240 3.42118 0.24
NP_441101.1_10 Reverse -112 -131 -5.70374 0.285
NP_442692.1_5 Reverse -91 -109 11.3272 0.219
NP_440145.1_3 Reverse -166 -185 6.4893 0.0511
NP_442718.1_2 Reverse -198 -217 -3.3438 0.291
NP_442542.1_2 Forward -127 -114 19.0955 0.0177
NP_442542.1_2 Reverse -314 -327 8.37742 0.156
NP_442542.1_9 Forward -132 -118 9.43874 0.135
NP_442050.1_5 Reverse -114 -124 14.3359 0.0206
NP_442050.1_5 Forward -127 -117 8.23937 0.234
NP_442342.1_9 Forward -127 -111 2.12349 0.29
NP_441114.1_3 Reverse -310 -319 7.66954 0.231
NP_440558.1_2 Reverse -173 -192 4.62101 0.151
NP_440558.1_2 Reverse -107 -126 -1.86883 0.218
NP_440558.1_2 Reverse -167 -186 -1.96717 0.22
NP_440558.1_2 Forward -189 -170 -3.63879 0.237
NP_441878.1_6 Forward -318 -308 10.5014 0.0176
NP_441878.1_6 Forward -126 -116 10.4031 0.0176
NP_441878.1_6 Reverse -115 -125 10.4031 0.0176
NP_441878.1_6 Forward -186 -176 2.53664 0.0363
NP_441878.1_6 Reverse -89 -99 0.865012 0.132
NP_441878.1_6 Reverse -307 -317 0.668351 0.139
NP_441878.1_6 Forward -265 -255 0.668351 0.139
NP_441878.1_6 Reverse -175 -185 -0.0199663 0.163
NP_441036.1_8 Forward -126 -116 17.7779 0.000554
NP_441036.1_8 Reverse -115 -125 8.33817 0.174
NP_442650.1_2 Reverse -381 -395 2.94952 0.232
NP_441557.1_4 Reverse -210 -224 10.0294 0.291
NP_441557.1_5 Forward -125 -116 19.9609 0.000699
NP_441557.1_5 Reverse -116 -125 19.9609 0.000699
NP_441557.1_5 Forward -185 -176 0.688044 0.128
NP_441557.1_5 Reverse -176 -185 0.688044 0.128
NP_441557.1_5 Forward -264 -255 0.393051 0.166
NP_441557.1_5 Reverse -255 -264 0.393051 0.166
NP_441445.1_1 Forward -249 -230 4.42435 0.195
NP_441445.1_1 Reverse -107 -126 1.76941 0.247
NP_441445.1_1 Forward -281 -262 -0.39387 0.291
NP_441445.1_4 Forward -292 -273 15.5124 0.244
NP_442066.2_9 Forward -129 -116 8.37742 0.185
NP_441433.1_8 Forward -317 -298 -2.45882 0.27
NP_442419.1_2 Forward -389 -370 -0.0988766 0.243
NP_441308.1_8 Forward -127 -117 9.22315 0.226
NP_440101.1_3 Forward -130 -111 2.26107 0.259
NP_440101.1_5 Forward -132 -113 1.0811 0.261
NP_440101.1_10 Forward -185 -166 14.6508 0.126
NP_441458.1_10 Reverse -107 -126 4.71934 0.227
NP_441458.1_10 Reverse -372 -391 1.47442 0.288
NP_442183.1_1 Reverse -116 -130 11.406 0.0702
NP_442183.1_1 Forward -264 -250 8.25939 0.119
NP_442166.1_7 Forward -124 -110 12.586 0.175
NP_442135.1_1 Reverse -237 -256 16.5674 0.288
NP_442135.1_8 Forward -394 -376 10.4422 0.229
NP_441574.1_1 Reverse -362 -381 -2.55715 0.226
NP_441574.1_1 Forward -191 -172 -5.9004 0.27
NP_441574.1_1 Reverse -369 -388 -5.99873 0.272
NP_440540.1_8 Forward -131 -112 7.47261 0.289
NP_442347.1_2 Forward -124 -115 12.4878 0.056
NP_442347.1_2 Reverse -117 -126 11.1111 0.056
NP_442347.1_2 Forward -263 -254 3.34298 0.284
NP_442645.1_2 Reverse -366 -385 -19.8634 0.288
NP_442645.1_2 Reverse -108 -127 -22.6167 0.292
NP_442645.1_2 Reverse -168 -187 -22.8133 0.296
NP_441037.1_4 Forward -127 -117 16.2838 0.0168
NP_441037.1_4 Forward -319 -309 6.34312 0.267
NP_441037.1_4 Reverse -226 -236 6.34312 0.267
NP_440151.1_2 Reverse -308 -326 19.3895 0.138
NP_441633.1_3 Reverse -114 -127 20.5705 0.00512
NP_441633.1_3 Forward -127 -114 -3.71729 0.177
NP_440136.1_2 Forward -124 -117 15.9687 0.0123
NP_440136.1_2 Reverse -117 -124 15.9687 0.0123
NP_442590.1_10 Forward -324 -305 6.68596 0.239
NP_442590.1_10 Forward -192 -173 5.80098 0.258
NP_442998.1_5 Forward -307 -297 11.6814 0.179
NP_442998.1_10 Forward -123 -116 15.5754 0.0102
NP_442998.1_10 Reverse -118 -125 15.5754 0.0102
NP_442998.1_10 Forward -262 -255 6.0373 0.205
NP_442998.1_10 Forward -388 -381 3.97235 0.297
NP_440299.1_1 Reverse -112 -125 20.2748 0.00128
NP_440299.1_1 Forward -129 -116 11.4251 0.0489
NP_440299.1_1 Reverse -172 -185 11.2284 0.0518
NP_440299.1_1 Reverse -227 -240 3.7553 0.232
NP_440299.1_1 Forward -394 -381 3.55864 0.241
NP_441799.1_1 Reverse -112 -126 9.14375 0.0988
NP_441799.1_1 Forward -321 -307 5.80051 0.194
NP_440640.1_6 Reverse -309 -328 3.93269 0.213
NP_441007.1_10 Forward -130 -117 3.46087 0.182
NP_441007.1_10 Forward -242 -229 1.49425 0.203
NP_441007.1_10 Reverse -303 -316 1.10092 0.209
NP_442333.2_5 Forward -328 -309 -13.0786 0.251
NP_440256.1_1 Reverse -113 -132 10.9142 0.0168
NP_440256.1_1 Forward -275 -256 -2.65548 0.122
NP_440256.1_1 Reverse -157 -176 -8.16202 0.253
NP_440087.1_1 Forward -141 -122 -4.42544 0.246
NP_441512.1_4 Forward -173 -154 12.3892 0.228
NP_441559.1_8 Reverse -111 -125 12.4876 0.0574
NP_441559.1_8 Forward -190 -176 10.0294 0.0623
NP_441559.1_8 Forward -130 -116 -6.29359 0.276
NP_440915.1_6 Forward -129 -115 15.9292 0.0183
NP_440915.1_6 Reverse -112 -126 10.6193 0.0301
NP_440915.1_6 Reverse -172 -186 3.14618 0.107
NP_440915.1_6 Reverse -251 -265 -1.08205 0.22
NP_440717.1_1 Reverse -117 -136 7.96426 0.265
NP_441704.1_8 Reverse -105 -124 9.83173 0.173
NP_442452.1_8 Reverse -110 -124 12.9786 0.273
NP_441464.1_10 Reverse -358 -372 8.06273 0.287
NP_440702.1_2 Reverse -354 -373 -8.06369 0.286
NP_442993.1_1 Reverse -116 -132 -7.0213 0.146
NP_442386.1_9 Forward -126 -117 15.7322 0.0144
NP_442386.1_9 Reverse -115 -124 13.8639 0.0289
NP_442386.1_9 Reverse -175 -184 10.324 0.132
NP_442386.1_9 Forward -385 -376 4.62087 0.294
NP_440570.1_5 Reverse -106 -125 2.3594 0.234
NP_442054.1_4 Forward -395 -376 6.98095 0.299
NP_441750.1_4 Reverse -112 -131 0.58944 0.297
NP_441340.1_5 Forward -124 -117 15.6737 0.0124
NP_441340.1_5 Reverse -117 -124 15.6737 0.0124
NP_441340.1_5 Reverse -309 -316 4.07068 0.239
NP_441340.1_5 Reverse -177 -184 4.07068 0.239
NP_441340.1_5 Forward -316 -309 4.07068 0.239
NP_442484.1_2 Reverse -105 -124 2.85105 0.218
NP_440168.1_4 Forward -202 -183 -7.57203 0.285
NP_440168.1_8 Forward -131 -112 3.44104 0.244
NP_440168.1_8 Forward -191 -172 1.27776 0.3
NP_440168.1_9 Forward -266 -247 -5.01543 0.296
NP_442240.1_1 Reverse -108 -127 3.04693 0.295
NP_441027.1_3 Forward -305 -286 15.8436 0.262
NP_441134.1_10 Reverse -306 -324 12.9988 0.221
NP_440586.1_1 Forward -250 -231 2.45773 0.226
NP_440586.1_1 Reverse -365 -384 -2.75381 0.259
NP_440586.1_8 Forward -124 -117 13.2151 0.026
NP_440586.1_8 Reverse -117 -124 13.2151 0.026
NP_440586.1_8 Reverse -177 -184 7.70858 0.227
NP_440586.1_8 Forward -316 -309 7.61025 0.227
NP_440586.1_8 Reverse -309 -316 7.61025 0.227
NP_440452.1_2 Reverse -242 -261 19.8614 0.246
NP_442251.1_6 Forward -124 -117 15.2804 0.0124
NP_442251.1_6 Reverse -117 -124 15.2804 0.0124
NP_440192.1_4 Forward -127 -108 13.5695 0.169
NP_440684.1_9 Reverse -375 -389 7.47274 0.263
NP_441262.1_3 Reverse -116 -123 14.7888 0.0223
NP_441262.1_3 Forward -125 -118 14.7888 0.0223
NP_440027.1_3 Forward -179 -161 4.73828 0.253
NP_443051.1_1 Reverse -115 -124 10.4228 0.00754
NP_443051.1_1 Forward -126 -117 10.4228 0.00754
NP_443051.1_1 Forward -186 -177 0.29472 0.195
NP_443051.1_5 Forward -58 -39 15.1424 0.171
NP_439937.1_9 Reverse -115 -132 -8.41828 0.176
NP_439937.1_9 Forward -126 -109 -8.41828 0.176
NP_440408.1_3 Forward -131 -112 0.982764 0.204
NP_440408.1_7 Forward -125 -106 10.4225 0.247
NP_440408.1_7 Reverse -189 -208 9.0459 0.265
NP_440408.1_7 Reverse -362 -381 7.7676 0.284
NP_440439.1_1 Reverse -113 -126 9.16406 0.0465
NP_440439.1_1 Forward -128 -115 2.47756 0.133
NP_439943.1_1 Forward -185 -166 -5.9004 0.237
NP_440372.1_2 Forward -124 -117 16.3621 0.0124
NP_440372.1_2 Reverse -117 -124 16.3621 0.0124
NP_440316.1_10 Forward -318 -308 7.84651 0.245
NP_440316.1_10 Forward -272 -262 7.55152 0.246
NP_440316.1_10 Reverse -374 -384 5.87989 0.277
NP_441803.1_2 Reverse -111 -130 11.7008 0.069
NP_439977.1_5 Reverse -110 -129 9.53756 0.0937
NP_439977.1_5 Reverse -170 -189 7.17762 0.123
NP_439977.1_5 Forward -131 -112 6.68596 0.128
NP_441572.1_7 Forward -131 -112 15.2408 0.026
NP_441572.1_7 Reverse -154 -173 -1.57384 0.188
NP_442384.1_10 Forward -125 -112 20.8655 0.00194
NP_442384.1_10 Reverse -176 -189 3.85419 0.176
NP_442384.1_10 Forward -264 -251 3.65753 0.183
NP_442384.1_10 Reverse -116 -129 2.2809 0.23
NP_442384.1_10 Forward -185 -172 1.00259 0.271
NP_442114.1_4 Reverse -116 -127 12.1534 0.107
NP_441018.1_7 Reverse -371 -390 10.1275 0.217
NP_441018.1_7 Reverse -377 -396 7.57094 0.269
NP_442790.1_4 Reverse -366 -385 -15.6352 0.295
NP_442262.1_10 Forward -124 -117 14.1988 0.0123
NP_442262.1_10 Reverse -117 -124 14.1988 0.0123
NP_442262.1_10 Forward -316 -309 10.4622 0.145
NP_442262.1_10 Reverse -309 -316 10.4622 0.145
NP_441689.1_5 Reverse -253 -263 10.206 0.132
NP_441689.1_5 Reverse -114 -124 5.78111 0.197
NP_440344.1_10 Forward -132 -115 12.4285 0.006
NP_440344.1_10 Reverse -109 -126 -0.256152 0.0402
NP_440344.1_10 Forward -391 -374 -10.0892 0.166
NP_440282.1_10 Forward -327 -308 -9.24366 0.275
NP_440531.1_6 Forward -325 -306 -0.787193 0.221
NP_440531.1_6 Reverse -108 -127 -1.37718 0.231
NP_440562.1_3 Reverse -117 -134 8.10198 0.15
NP_441965.1_10 Forward -128 -112 11.9566 0.107
NP_441640.1_8 Forward -124 -105 -4.42544 0.265
NP_442693.1_7 Forward -126 -107 7.07928 0.295
NP_440297.1_9 Reverse -309 -319 9.61647 0.0917
NP_440297.1_9 Forward -316 -306 0.0783647 0.282
NP_440297.1_9 Forward -124 -114 -0.118297 0.282
NP_440297.1_9 Reverse -117 -127 -0.216628 0.282
NP_440350.1_5 Reverse -44 -63 -6.58872 0.296
NP_442280.1_10 Forward -327 -309 13.9283 0.13
NP_442280.1_10 Reverse -106 -124 5.74663 0.283
NP_441896.1_3 Forward -134 -115 -1.27885 0.255
NP_440894.1_10 Reverse -111 -130 10.3242 0.155
NP_440894.1_10 Forward -181 -162 3.14605 0.278
NP_440894.1_10 Forward -130 -111 2.3594 0.29
NP_443036.1_8 Reverse -364 -383 13.8641 0.268
NP_440999.1_9 Forward -129 -115 23.6974 0.0055
NP_440999.1_9 Forward -394 -380 2.06454 0.154
NP_440999.1_9 Reverse -112 -126 1.08123 0.171
NP_440999.1_9 Reverse -172 -186 -0.393733 0.205
NP_440888.1_2 Reverse -116 -130 20.9434 0.000502
NP_440888.1_2 Forward -125 -111 16.1252 0.00789
NP_440888.1_2 Forward -264 -250 10.2254 0.1
NP_440888.1_2 Forward -185 -171 7.27547 0.202
NP_440491.1_1 Forward -128 -109 10.5229 0.184
NP_439969.1_3 Forward -130 -111 8.45592 0.126
NP_439969.1_9 Forward -258 -246 17.7386 0.23
NP_442948.1_2 Reverse -115 -134 3.53937 0.283
NP_442033.1_10 Forward -127 -108 12.4875 0.042
NP_440575.1_1 Reverse -292 -311 -3.44288 0.294
NP_441543.1_2 Reverse -117 -126 18.486 0.00236
NP_441543.1_2 Forward -124 -115 16.9127 0.00359
NP_441543.1_2 Forward -389 -380 5.80125 0.174
NP_441543.1_2 Reverse -177 -186 4.22796 0.267
NP_442845.1_2 Reverse -249 -263 5.1128 0.243
NP_442845.1_2 Forward -131 -117 3.44117 0.29
NP_441178.1_6 Reverse -305 -324 3.63691 0.269
NP_441319.1_8 Reverse -110 -128 12.6055 0.127
NP_441469.1_8 Forward -126 -117 16.126 0.00797
NP_441469.1_8 Forward -318 -309 10.9145 0.191
NP_441469.1_8 Reverse -115 -124 6.48957 0.227
NP_443064.1_6 Reverse -255 -265 14.2152 0.0796
NP_443064.1_6 Forward -125 -115 12.5669 0.0796
NP_443064.1_6 Forward -264 -254 10.2399 0.166
NP_442578.1_7 Forward -124 -117 14.5921 0.026
NP_442578.1_7 Reverse -117 -124 14.5921 0.026
NP_442578.1_7 Reverse -382 -389 8.69224 0.172
NP_440071.1_2 Reverse -173 -187 16.5192 0.24
NP_441462.1_2 Forward -125 -115 11.5831 0.00406
NP_441462.1_2 Reverse -116 -126 11.5831 0.00406
NP_441462.1_2 Reverse -255 -265 8.53483 0.0354
NP_441462.1_2 Reverse -176 -186 1.35667 0.0943
NP_441621.1_7 Forward -127 -113 6.58777 0.068
NP_441621.1_7 Reverse -114 -128 -3.44199 0.188
NP_443062.1_1 Forward -125 -107 15.664 0.0359
NP_443062.1_1 Reverse -65 -83 8.05839 0.16
NP_443062.1_1 Reverse -116 -134 7.47334 0.175
NP_443062.1_1 Forward -185 -167 3.57305 0.293
NP_443062.1_6 Reverse -108 -127 6.58763 0.18
NP_442204.1_1 Reverse -112 -123 11.5634 0.0565
NP_442204.1_1 Forward -189 -178 7.92515 0.108
NP_442204.1_1 Forward -117 -106 5.27021 0.213
NP_442204.1_5 Forward -135 -116 8.94757 0.109
NP_441560.1_3 Forward -99 -81 6.214 0.28
NP_441560.1_8 Reverse -111 -130 17.5508 0.0433
NP_440255.1_7 Forward -58 -41 14.6902 0.219
NP_440255.1_9 Forward -66 -47 15.899 0.219
NP_440516.1_8 Forward -125 -116 16.9127 0.00442
NP_440516.1_8 Reverse -116 -125 16.9127 0.00442
NP_440516.1_8 Reverse -255 -264 7.07956 0.0867
NP_440516.1_8 Forward -264 -255 5.11294 0.118
NP_440516.1_8 Forward -99 -90 -0.295266 0.232
NP_442428.1_5 Forward -124 -117 15.8704 0.0124
NP_442428.1_5 Reverse -117 -124 15.8704 0.0124
NP_442428.1_5 Forward -184 -177 4.66067 0.244
NP_442428.1_5 Forward -316 -309 4.36568 0.271
NP_442428.1_5 Reverse -309 -316 4.36568 0.271
NP_441790.1_3 Reverse -117 -136 4.42435 0.113
NP_442120.1_10 Forward -131 -112 -15.1435 0.289
NP_442120.1_10 Reverse -228 -247 -15.6352 0.294
NP_441867.1_2 Forward -116 -97 -7.57203 0.189
NP_440673.1_2 Forward -250 -231 15.0721 0.0952
NP_440673.1_2 Reverse -371 -390 10.1945 0.22
NP_440673.1_3 Forward -123 -116 12.4288 0.0426
NP_440673.1_3 Reverse -118 -125 12.4288 0.0426
NP_440673.1_3 Forward -235 -228 7.41394 0.263
NP_440673.1_7 Forward -136 -117 0.58944 0.267
NP_440865.1_9 Forward -131 -112 -7.27704 0.244
NP_441052.1_2 Forward -125 -115 19.9412 0.00106
NP_441052.1_2 Reverse -116 -126 10.5014 0.0285
NP_441052.1_2 Forward -185 -175 7.25653 0.0765
NP_441052.1_2 Reverse -1 -11 2.33998 0.209
NP_441052.1_2 Forward -264 -254 0.668351 0.256
NP_442219.1_8 Reverse -166 -185 7.87721 0.26
NP_442219.1_8 Forward -394 -375 6.81424 0.287
NP_442219.1_9 Forward -124 -115 17.7976 0.00718
NP_442219.1_9 Reverse -117 -126 8.35786 0.0681
NP_442219.1_9 Forward -184 -175 5.11294 0.186
NP_440436.1_4 Reverse -117 -126 18.1905 0.00233
NP_440436.1_4 Forward -124 -115 17.2072 0.00233
NP_441884.1_8 Forward -126 -107 -7.27704 0.248
NP_441884.1_9 Forward -128 -109 -3.14714 0.0594
NP_441884.1_9 Reverse -228 -247 -21.3384 0.242
NP_441884.1_9 Forward -267 -248 -26.8449 0.29
NP_440314.1_9 Reverse -91 -110 -8.06369 0.245
NP_440314.1_9 Forward -184 -165 -9.63698 0.273
NP_441719.1_4 Forward -124 -117 16.3621 0.0124
NP_441719.1_4 Reverse -117 -124 16.3621 0.0124
NP_441733.1_10 Forward -128 -115 10.639 0.106
NP_441733.1_10 Reverse -113 -126 7.39411 0.153
NP_441004.1_1 Reverse -369 -388 2.45773 0.106
NP_441004.1_1 Forward -261 -242 -9.24366 0.206
NP_441004.1_1 Reverse -344 -363 -17.0118 0.288
NP_441004.1_1 Forward -28 -9 -17.9951 0.296
NP_441004.1_1 Forward -131 -112 -18.0934 0.297
NP_441004.1_2 Reverse -364 -383 -0.197208 0.252
NP_441004.1_4 Reverse -372 -382 13.5497 0.216
NP_441004.1_4 Reverse -313 -323 7.84651 0.286
NP_441004.1_5 Forward -275 -261 9.83269 0.248
NP_442366.1_3 Forward -126 -108 5.82068 0.0829
NP_442366.1_3 Reverse -163 -181 -5.58572 0.289
NP_442139.1_7 Reverse -364 -383 18.4857 0.13
NP_440129.1_10 Reverse -109 -123 5.21113 0.185
NP_442873.1_9 Reverse -245 -264 10.6184 0.207
NP_440296.1_10 Forward -267 -248 -14.7502 0.273
NP_441115.1_4 Forward -126 -108 14.6697 0.0525
NP_441115.1_4 Reverse -115 -133 13.4897 0.077
NP_442694.1_4 Reverse -207 -216 12.0944 0.268
NP_442206.1_10 Forward -125 -110 4.01147 0.179
NP_442206.1_10 Forward -317 -302 1.15987 0.236
NP_440094.1_9 Reverse -115 -134 2.65439 0.173
NP_443054.1_2 Reverse -114 -128 19.7641 0.0121
NP_442430.1_10 Forward -135 -116 13.5683 0.191
NP_442430.1_10 Reverse -106 -125 13.47 0.192
NP_442308.1_4 Reverse -110 -129 1.57275 0.267
NP_441851.1_10 Forward -126 -116 16.008 0.00552
NP_441851.1_10 Reverse -115 -125 15.8113 0.00552
NP_441851.1_10 Forward -265 -255 6.37155 0.172
NP_441851.1_10 Forward -318 -308 5.97822 0.19
NP_441851.1_10 Reverse -254 -264 4.3066 0.277
NP_440611.1_8 Reverse -174 -193 11.3075 0.195
NP_442011.1_1 Reverse -245 -264 -3.24547 0.29
NP_442856.1_7 Forward -134 -115 -1.96717 0.233
NP_441668.1_4 Forward -281 -262 -1.27885 0.271
NP_442515.1_1 Reverse -227 -241 1.27789 0.165
NP_442515.1_1 Forward -265 -251 0.392915 0.193
NP_442515.1_1 Reverse -115 -129 -2.36035 0.273
NP_440593.1_3 Forward -130 -111 1.17943 0.19
NP_440593.1_3 Reverse -376 -395 0.687771 0.193
NP_440593.1_3 Reverse -165 -184 -2.85214 0.228
NP_440593.1_3 Forward -190 -171 -6.09707 0.27
NP_440593.1_9 Reverse -113 -127 11.3077 0.24
NP_440463.1_8 Reverse -365 -384 10.9852 0.203
NP_440165.1_5 Forward -126 -107 10.3242 0.0553
NP_441349.1_10 Reverse -106 -125 1.86774 0.0795
NP_441409.1_6 Reverse -110 -129 -10.0303 0.198
NP_440432.1_9 Reverse -309 -324 -2.28172 0.169
NP_440432.1_9 Reverse -117 -132 -2.47838 0.172
NP_442843.1_1 Reverse -309 -328 5.60432 0.144
NP_439960.1_10 Reverse -109 -127 5.82068 0.144
NP_439960.1_10 Forward -360 -342 -4.60241 0.293
NP_440474.1_8 Reverse -117 -131 8.45543 0.186
NP_440474.1_8 Reverse -229 -243 4.22722 0.287
NP_442450.1_5 Forward -319 -309 4.69992 0.297
NP_440588.1_2 Reverse -107 -126 3.6377 0.0983
NP_440588.1_2 Forward -267 -248 1.86774 0.127
NP_440588.1_2 Reverse -299 -318 1.76941 0.13
NP_440588.1_2 Forward -194 -175 -1.18052 0.155
NP_442006.1_2 Forward -249 -232 -5.56602 0.143
NP_442006.1_2 Forward -352 -335 -8.22096 0.192
NP_442006.1_2 Forward -326 -309 -16.3824 0.25
NP_442006.1_2 Reverse -188 -205 -17.5624 0.279
NP_442006.1_2 Forward -255 -238 -18.0541 0.287
NP_442006.1_2 Forward -99 -82 -19.0374 0.297
NP_440483.1_1 Forward -256 -237 -4.52377 0.219
NP_442243.1_1 Reverse -170 -188 -2.53818 0.293
NP_441570.1_1 Forward -125 -107 1.00246 0.034
NP_441570.1_1 Reverse -160 -178 -1.84914 0.0598
NP_441570.1_1 Forward -264 -246 -17.4838 0.278
NP_441570.1_1 Reverse -116 -134 -17.7788 0.291
NP_440078.1_10 Reverse -263 -282 8.35759 0.208
NP_441078.1_4 Forward -125 -116 19.6659 0.0007
NP_441078.1_4 Reverse -116 -125 19.6659 0.0007
NP_441078.1_4 Forward -185 -176 7.86621 0.0432
NP_441078.1_4 Reverse -255 -264 7.37455 0.0688
NP_441078.1_4 Reverse -176 -185 0.884706 0.154
NP_441078.1_4 Forward -264 -255 0.0980582 0.205
NP_441078.1_4 Forward -390 -381 -1.27858 0.246
NP_441078.1_4 Forward -317 -308 -1.6719 0.266
NP_441078.1_4 Reverse -308 -317 -1.77023 0.266
NP_441078.1_4 Reverse -381 -390 -2.06522 0.295
NP_442729.1_5 Forward -250 -240 14.6313 0.214
NP_442729.1_8 Reverse -251 -264 11.4257 0.125
NP_442729.1_8 Forward -129 -116 8.47575 0.125
NP_441663.1_8 Forward -270 -251 4.03102 0.172
NP_442348.1_2 Reverse -374 -383 9.14451 0.28
NP_442443.1_1 Forward -391 -372 -0.39387 0.222
NP_441094.1_6 Forward -132 -115 7.41293 0.278
NP_440526.1_3 Reverse -117 -128 11.7595 0.0646
NP_440526.1_3 Forward -124 -113 8.02298 0.126
NP_441432.1_8 Reverse -115 -124 16.8143 0.00595
NP_441432.1_8 Forward -186 -177 11.3078 0.0569
NP_441432.1_8 Forward -126 -117 8.25953 0.0755
NP_441432.1_8 Reverse -254 -263 4.42462 0.213
NP_441432.1_8 Reverse -374 -383 3.7363 0.243
NP_442320.1_8 Forward -131 -117 24.2873 0.00275
NP_442344.1_7 Reverse -256 -275 -7.67036 0.191
NP_442344.1_7 Reverse -117 -136 -8.06369 0.202
NP_441732.1_2 Forward -189 -173 3.00846 0.0141
NP_441732.1_2 Reverse -112 -128 -6.33298 0.0495
NP_441732.1_2 Forward -129 -113 -15.1828 0.145
NP_441732.1_2 Forward -400 -384 -16.7561 0.195
NP_440760.1_1 Forward -390 -371 -18.2901 0.212
NP_440760.1_1 Reverse -116 -135 -20.65 0.224
NP_440760.1_1 Forward -125 -106 -21.535 0.238
NP_442797.1_1 Forward -382 -363 -5.50708 0.288
NP_442797.1_7 Reverse -261 -279 2.47742 0.239
NP_440131.1_4 Reverse -307 -326 5.11266 0.275
NP_442010.1_1 Reverse -295 -313 8.17984 0.274
NP_440713.1_4 Reverse -106 -125 20.2556 0.0172
NP_442489.1_7 Forward -125 -116 20.1576 0.000695
NP_442489.1_7 Reverse -116 -125 20.1576 0.000695
NP_442489.1_7 Forward -185 -176 8.35786 0.0225
NP_442489.1_7 Reverse -176 -185 0.884706 0.145
NP_442489.1_7 Forward -264 -255 0.786375 0.152
NP_442489.1_7 Reverse -255 -264 0.589713 0.17
NP_442489.1_7 Forward -317 -308 -1.6719 0.235
NP_442489.1_7 Reverse -308 -317 -1.77023 0.247
NP_442079.1_7 Forward -124 -105 3.24438 0.212
NP_440559.1_1 Forward -124 -115 17.4043 0.00658
NP_440559.1_1 Reverse -117 -126 8.75118 0.0586
NP_440559.1_1 Reverse -256 -265 4.71961 0.217
NP_441659.2_8 Forward -125 -115 18.1713 0.00133
NP_441659.2_8 Reverse -116 -126 11.9764 0.0147
NP_441659.2_8 Reverse -176 -186 9.51814 0.0293
NP_441659.2_8 Forward -317 -307 5.78156 0.0979
NP_441659.2_8 Forward -264 -254 5.28991 0.112
NP_441659.2_8 Reverse -228 -238 1.55333 0.238
NP_441659.2_8 Reverse -255 -265 -0.0199663 0.282
NP_442913.1_10 Forward -134 -115 4.916 0.0808
NP_442913.1_10 Forward -273 -254 -0.983855 0.165
NP_441040.1_2 Reverse -81 -100 -4.32711 0.164
NP_441040.1_2 Forward -273 -254 -11.4069 0.255
NP_441040.1_2 Forward -194 -175 -14.2585 0.285
NP_440708.1_6 Reverse -106 -125 4.32602 0.162
NP_441800.1_7 Forward -380 -362 -3.12744 0.268
NP_440779.1_5 Reverse -308 -325 -15.0058 0.3
NP_442346.1_5 Reverse -115 -125 16.6963 0.00248
NP_442346.1_5 Forward -318 -308 14.7297 0.0103
NP_442346.1_5 Forward -126 -116 9.02648 0.118
NP_442346.1_5 Reverse -227 -237 8.1415 0.146
NP_442346.1_5 Reverse -175 -185 6.17489 0.212
NP_442346.1_5 Forward -186 -176 5.97822 0.219
NP_442346.1_5 Reverse -307 -317 4.89658 0.269
NP_440545.1_3 Forward -321 -304 14.6902 0.0144
NP_440545.1_3 Forward -183 -166 6.43035 0.0557
NP_440545.1_3 Reverse -112 -129 6.43035 0.0557
NP_440545.1_3 Reverse -172 -189 5.34871 0.0623
NP_440545.1_3 Forward -189 -172 5.05372 0.0646
NP_440545.1_3 Forward -129 -112 0.137172 0.144
NP_440545.1_3 Reverse -377 -394 -1.53445 0.17
NP_440545.1_3 Reverse -224 -241 -4.18939 0.22
NP_440545.1_5 Forward -183 -166 3.57876 0.289
NP_441856.1_6 Forward -385 -371 15.8309 0.265
NP_440831.1_3 Reverse -107 -126 8.71699 0.221
NP_440831.1_3 Reverse -246 -265 6.87253 0.27
NP_441786.1_3 Forward -316 -297 6.19431 0.29
NP_440486.1_6 Forward -126 -107 11.1109 0.216
NP_440459.1_2 Reverse -114 -131 13.4119 0.131
NP_440459.1_2 Forward -280 -263 9.47861 0.227
NP_440459.1_2 Reverse -372 -389 9.18362 0.233
NP_440459.1_2 Reverse -260 -277 8.7903 0.249
NP_440459.1_2 Forward -188 -171 8.49531 0.259
NP_440459.1_2 Forward -134 -117 7.217 0.299
NP_441653.1_2 Forward -136 -117 4.10942 0.261
NP_440010.1_3 Forward -197 -178 -5.60541 0.25
NP_440010.1_4 Reverse -106 -125 -2.55791 0.284
NP_440010.1_10 Forward -276 -257 5.89931 0.226
NP_442551.1_4 Forward -188 -173 7.35472 0.166
NP_442551.1_4 Reverse -174 -189 -1.49507 0.246
NP_442603.1_7 Forward -125 -111 18.7801 0.0119
NP_441888.1_7 Reverse -111 -125 3.73617 0.225
NP_441888.1_7 Forward -130 -116 2.5562 0.225
NP_440449.1_6 Forward -133 -115 11.8546 0.126
NP_441948.1_4 Reverse -109 -127 8.08229 0.0623
NP_441047.1_2 Forward -389 -370 8.55425 0.159
NP_441502.1_3 Reverse -114 -133 11.0125 0.21
NP_441833.1_4 Forward -124 -117 15.9687 0.0124
NP_441833.1_4 Reverse -117 -124 15.9687 0.0124
NP_442162.1_9 Forward -124 -117 16.2637 0.0124
NP_442162.1_9 Reverse -117 -124 16.2637 0.0124
NP_440671.1_2 Reverse -377 -391 15.3392 0.188
NP_440671.1_4 Forward -131 -117 8.06273 0.204
NP_440224.1_4 Forward -186 -167 5.01433 0.225
NP_442199.1_5 Reverse -300 -319 -0.39387 0.177
NP_442140.1_3 Reverse -117 -127 17.4829 0.0159
NP_442140.1_3 Forward -124 -114 10.3048 0.0902
NP_442140.1_3 Reverse -309 -319 8.73149 0.119
NP_440951.1_6 Forward -394 -375 15.1424 0.282
NP_440875.1_9 Reverse -118 -128 17.619 0.0104
NP_440875.1_9 Forward -315 -305 11.0975 0.181
NP_440875.1_9 Forward -123 -113 8.37203 0.233
NP_440875.1_9 Reverse -305 -315 7.30133 0.269
NP_442547.1_7 Forward -189 -170 12.9477 0.208
NP_441813.1_5 Reverse -114 -124 18.1713 0.00743
NP_441813.1_5 Forward -127 -117 10.0098 0.0208
NP_440590.1_4 Reverse -117 -130 21.7504 0.00377
NP_440590.1_4 Forward -124 -111 14.7689 0.0106
NP_440590.1_4 Forward -389 -376 -0.177378 0.179
NP_440590.1_4 Forward -184 -171 -4.50394 0.262
NP_440567.1_1 Reverse -117 -131 18.8791 0.0136
NP_442497.1_10 Forward -124 -115 10.4228 0.0087
NP_442497.1_10 Reverse -117 -126 10.4228 0.0087
NP_442497.1_10 Reverse -309 -318 0.29472 0.199
NP_442497.1_10 Reverse -256 -265 0.29472 0.199
NP_440821.1_4 Forward -127 -117 18.7612 0.00422
NP_440821.1_4 Reverse -114 -124 9.41981 0.0286
NP_441239.1_9 Reverse -306 -318 16.6569 0.0166
NP_441239.1_9 Forward -127 -115 16.0669 0.0175
NP_441239.1_9 Reverse -114 -126 7.80712 0.148
NP_441239.1_9 Reverse -88 -100 7.70879 0.15
NP_441239.1_9 Forward -319 -307 6.72548 0.178
NP_441239.1_9 Forward -266 -254 5.64384 0.213
NP_441239.1_9 Forward -326 -314 4.95553 0.234
NP_441951.1_4 Reverse -375 -394 0.392778 0.297
NP_441009.1_4 Forward -125 -106 16.5191 0.157
NP_440624.1_6 Reverse -46 -64 8.3765 0.108
NP_441892.1_1 Forward -326 -309 19.9017 0.0173
NP_441892.1_1 Reverse -107 -124 -0.846137 0.192
NP_441892.1_1 Reverse -260 -277 -4.09106 0.255
NP_441892.1_1 Reverse -144 -161 -5.07437 0.273
NP_440665.1_1 Forward -261 -242 -7.96535 0.234
NP_442270.1_9 Forward -196 -177 -10.817 0.264
NP_442138.1_1 Reverse -247 -266 4.12856 0.24
NP_442052.1_8 Forward -319 -309 14.7297 0.253
NP_440546.1_4 Reverse -116 -126 11.8882 0.0679
NP_440546.1_4 Forward -125 -115 10.046 0.109
NP_441230.1_5 Forward -130 -111 3.73603 0.193
NP_440462.1_6 Forward -127 -117 17.9746 0.00578
NP_440462.1_6 Reverse -114 -124 9.61647 0.0429
NP_442611.1_1 Reverse -116 -135 4.22769 0.197
NP_440868.1_4 Reverse -112 -124 8.00379 0.0602
NP_440868.1_4 Forward -129 -117 2.98891 0.142
NP_440868.1_8 Forward -129 -110 -4.42544 0.263
NP_441497.1_3 Reverse -262 -281 -11.2103 0.294
NP_442499.1_3 Forward -186 -168 5.23069 0.282
NP_442402.1_10 Reverse -338 -348 12.9592 0.204
NP_441848.1_7 Reverse -8 -27 2.06362 0.228
NP_442258.1_2 Forward -276 -257 15.4374 0.0299
NP_441084.1_6 Forward -314 -300 11.2833 0.208
NP_442039.1_4 Forward -124 -117 15.1821 0.0124
NP_442039.1_4 Reverse -117 -124 15.1821 0.0124
NP_442039.1_4 Reverse -256 -263 8.10225 0.221
NP_442380.1_10 Forward -282 -264 7.88563 0.267
NP_442837.1_3 Forward -124 -117 15.7721 0.0124
NP_442837.1_3 Reverse -117 -124 15.7721 0.0124
NP_442053.1_1 Forward -125 -116 18.3876 0.0007
NP_442053.1_1 Reverse -116 -125 18.3876 0.0007
NP_442053.1_1 Forward -264 -255 13.2744 0.0188
NP_442053.1_1 Forward -185 -176 5.3096 0.197
NP_440505.1_3 Reverse -114 -124 18.3679 0.00213
NP_440505.1_3 Forward -127 -117 14.1397 0.0235
NP_440505.1_3 Reverse -253 -263 11.3864 0.0778
NP_440505.1_3 Reverse -379 -389 4.69992 0.272
NP_441203.1_2 Reverse -308 -327 0.884433 0.157
NP_440914.1_1 Forward -125 -115 17.5935 0.000537
NP_440914.1_1 Forward -264 -254 11.4453 0.0914
NP_440914.1_1 Reverse -116 -126 8.6151 0.186
NP_440914.1_1 Forward -185 -175 6.85846 0.263
NP_441011.1_8 Reverse -117 -126 16.9127 0.00602
NP_441011.1_8 Forward -124 -115 8.25953 0.144
NP_441011.1_8 Reverse -256 -265 7.27622 0.179
NP_442101.1_10 Forward -272 -253 -5.80207 0.177
NP_442533.1_6 Forward -125 -116 17.2076 0.00137
NP_442533.1_6 Reverse -116 -125 17.2076 0.00137
NP_442533.1_6 Reverse -176 -185 8.25953 0.0776
NP_442533.1_6 Forward -317 -308 7.17789 0.0948
NP_442533.1_6 Forward -185 -176 6.8829 0.101
NP_442533.1_6 Reverse -255 -264 6.78456 0.103
NP_442533.1_6 Reverse -308 -317 6.68623 0.105
NP_442533.1_6 Reverse -1 -10 6.48957 0.109
NP_442533.1_6 Reverse -147 -156 6.19458 0.115
NP_442533.1_6 Forward -264 -255 4.52295 0.179
NP_442533.1_6 Forward -10 -1 4.12963 0.191
NP_442533.1_6 Reverse -263 -272 2.06468 0.275
NP_442541.1_10 Reverse -231 -245 7.76712 0.225
NP_442541.1_10 Reverse -1 -15 1.37564 0.287
NP_440263.1_3 Forward -131 -112 1.57275 0.295
NP_442322.1_9 Reverse -8 -26 10.1465 0.251
NP_443016.1_1 Forward -323 -304 -1.86883 0.223
NP_443016.1_1 Forward -105 -86 -4.91709 0.238
NP_443016.1_10 Reverse -107 -126 22.3206 0.0312
NP_441482.1_7 Reverse -110 -124 -0.688726 0.0612
NP_439944.1_9 Forward -184 -174 14.238 0.0423
NP_439944.1_9 Forward -124 -114 10.5014 0.0887
NP_439944.1_9 Reverse -117 -127 10.4031 0.0887
NP_441697.1_5 Reverse -27 -46 -9.97933 0.278
NP_441028.1_6 Reverse -339 -349 11.5826 0.192
NP_440116.1_8 Forward -124 -105 4.52268 0.0714
NP_440116.1_8 Reverse -117 -136 -1.47551 0.12
NP_441527.1_4 Forward -60 -41 -11.8892 0.284
NP_440115.1_6 Reverse -113 -123 16.008 0.0325
NP_440115.1_6 Reverse -150 -160 6.96153 0.166
NP_440115.1_6 Reverse -384 -394 5.19158 0.265
NP_440007.1_4 Reverse -297 -316 14.5524 0.178
NP_441602.1_3 Reverse -111 -130 8.25926 0.117
NP_441602.1_4 Forward -136 -117 8.45592 0.29
NP_441972.1_5 Reverse -117 -136 0.687771 0.146
NP_441972.1_5 Forward -124 -105 -3.14714 0.197
NP_441972.1_5 Reverse -105 -124 -6.29373 0.229
NP_441972.1_5 Reverse -309 -328 -8.45701 0.265
NP_441106.1_1 Forward -126 -117 18.191 0.0028
NP_441106.1_1 Reverse -115 -124 9.63616 0.0311
NP_441106.1_1 Forward -186 -177 5.80125 0.124
NP_441420.1_1 Reverse -115 -134 7.86593 0.118
NP_440429.1_2 Reverse -111 -130 19.3707 0.0973
NP_440429.1_2 Forward -389 -370 10.1275 0.267
NP_440429.1_9 Reverse -1 -20 5.70265 0.211
NP_442306.1_10 Reverse -111 -130 -19.1751 0.197
NP_441286.1_1 Reverse -115 -127 14.7886 0.00418
NP_441286.1_1 Forward -126 -114 3.38223 0.0467
NP_441286.1_1 Reverse -254 -266 -3.79593 0.146
NP_441286.1_1 Forward -186 -174 -7.04085 0.3
NP_440670.1_8 Forward -125 -116 18.3876 0.000699
NP_440670.1_8 Reverse -116 -125 18.3876 0.000699
NP_440670.1_8 Reverse -255 -264 8.45619 0.0668
NP_440670.1_8 Forward -264 -255 6.09625 0.127
NP_441479.1_1 Forward -128 -109 9.0459 0.223
NP_440886.1_7 Forward -126 -116 17.7774 0.0011
NP_440886.1_7 Reverse -115 -125 7.94438 0.0805
NP_440886.1_7 Forward -391 -381 7.35439 0.0966
NP_440886.1_7 Reverse -182 -192 4.60114 0.227
NP_440828.1_4 Reverse -230 -249 5.89851 0.124
NP_442614.1_2 Forward -125 -111 9.14437 0.242
NP_442614.1_2 Forward -99 -85 7.76774 0.265
NP_442072.1_9 Reverse -115 -133 5.82068 0.0153
NP_440513.1_4 Forward -125 -106 8.45592 0.295
NP_442213.1_6 Reverse -108 -127 5.11266 0.285
NP_441753.1_10 Forward -134 -115 13.9625 0.0884
NP_441808.1_7 Forward -245 -226 16.6174 0.116
NP_441808.1_8 Forward -191 -172 18.3873 0.146
NP_440907.2_8 Reverse -117 -127 17.4824 0.00685
NP_440907.2_8 Reverse -256 -266 5.68278 0.191
NP_441021.1_1 Forward -395 -376 6.39097 0.0704
NP_440326.1_10 Reverse -53 -72 13.8937 0.284
NP_442459.1_7 Reverse -40 -59 -0.000545616 0.272
NP_441463.1_3 Reverse -106 -125 -1.96717 0.147
NP_441463.1_3 Forward -394 -375 -3.93378 0.189
NP_441463.1_3 Forward -135 -116 -9.34199 0.278
NP_441626.1_2 Forward -124 -117 15.7721 0.0124
NP_441626.1_2 Reverse -117 -124 15.7721 0.0124
NP_441626.1_2 Reverse -382 -389 4.85733 0.244
NP_441626.1_6 Forward -129 -111 9.94979 0.215
NP_441988.1_5 Forward -261 -242 11.7992 0.274
NP_442794.1_1 Reverse -112 -124 20.0002 0.00523
NP_442615.1_1 Forward -134 -116 2.0841 0.074
NP_442615.1_1 Forward -273 -255 -6.27403 0.241
NP_442615.1_1 Forward -171 -153 -7.55234 0.296
NP_441962.1_4 Reverse -111 -130 -0.885524 0.117
NP_441962.1_4 Forward -389 -370 -10.6203 0.232
NP_441962.1_4 Forward -130 -111 -13.1769 0.271
NP_440387.1_1 Reverse -381 -397 1.33684 0.106
NP_440387.1_1 Reverse -116 -132 0.451859 0.126
NP_440387.1_1 Reverse -176 -192 -2.00642 0.145
NP_440387.1_1 Forward -125 -109 -3.28472 0.157
NP_440387.1_1 Forward -264 -248 -6.43131 0.285
NP_441431.1_2 Forward -128 -114 8.84875 0.204
NP_441431.1_2 Reverse -173 -187 8.55376 0.211
NP_441431.1_2 Reverse -113 -127 7.57046 0.238
NP_441431.1_2 Reverse -87 -101 6.58715 0.266
NP_441431.1_2 Reverse -305 -319 6.39049 0.272
NP_441488.1_7 Reverse -110 -129 7.96426 0.121
NP_441488.1_8 Reverse -111 -125 9.73373 0.146
NP_441836.1_1 Reverse -105 -124 13.2525 0.229
NP_441836.1_2 Forward -131 -112 -1.27885 0.217
NP_441836.1_2 Forward -243 -224 -1.57384 0.221
NP_441836.1_2 Forward -191 -172 -2.0655 0.224
NP_441993.1_1 Forward -131 -112 9.15853 0.136
NP_441993.1_1 Forward -191 -172 3.31109 0.237
NP_441993.1_1 Forward -125 -106 2.92126 0.246
NP_441993.1_1 Reverse -309 -328 2.04414 0.265
NP_442224.1_1 Forward -266 -247 1.96607 0.233
NP_441174.1_2 Reverse -113 -127 17.6008 0.0437
NP_440114.1_10 Reverse -116 -130 6.88276 0.253
NP_442323.1_7 Reverse -111 -130 3.63691 0.238
NP_441510.2_6 Reverse -106 -125 13.7649 0.233
NP_441510.2_9 Forward -124 -105 10.7175 0.165
NP_440287.1_5 Reverse -101 -120 7.66846 0.286
NP_440766.1_4 Reverse -112 -126 8.75105 0.0871
NP_440766.1_4 Forward -129 -115 8.45605 0.0871
NP_439988.1_7 Forward -126 -112 11.7987 0.292
NP_439910.1_2 Forward -133 -116 -12.3509 0.0837
NP_439910.1_2 Forward -398 -381 -22.2823 0.22
NP_440457.1_1 Reverse -112 -124 7.61046 0.101
NP_440457.1_1 Forward -129 -117 5.34885 0.141
NP_440457.1_1 Reverse -149 -161 -0.846001 0.278
NP_440798.1_6 Reverse -256 -269 10.1474 0.0808
NP_440798.1_6 Reverse -117 -130 3.85419 0.147
NP_440798.1_6 Reverse -309 -322 1.69091 0.205
NP_441801.1_4 Reverse -143 -153 11.1898 0.231
NP_440801.1_8 Reverse -89 -108 6.88262 0.166
NP_440801.1_10 Reverse -242 -261 7.17762 0.272
NP_440801.1_10 Reverse -112 -131 6.19431 0.289
NP_440942.1_6 Forward -326 -307 5.11187 0.269
NP_441984.1_6 Forward -323 -311 17.1486 0.145
NP_441436.1_8 Forward -126 -107 7.47261 0.293
NP_440473.1_9 Forward -266 -247 -6.1954 0.228
NP_440473.1_9 Forward -136 -117 -10.0303 0.269
NP_442509.1_9 Reverse -116 -126 16.2041 0.00739
NP_442509.1_9 Reverse -255 -265 13.9425 0.0413
NP_442509.1_9 Forward -125 -115 8.14104 0.192
NP_440554.1_4 Reverse -117 -127 13.943 0.0218
NP_440554.1_4 Forward -124 -114 8.92815 0.0646
NP_440554.1_4 Forward -316 -306 6.56821 0.121
NP_441885.1_5 Forward -125 -115 20.9245 0.000538
NP_441885.1_5 Reverse -116 -126 11.4848 0.00668
NP_441885.1_5 Reverse -255 -265 6.8632 0.0528
NP_441885.1_5 Forward -185 -175 1.65166 0.106
NP_441885.1_5 Forward -264 -254 1.35667 0.11
NP_441885.1_5 Forward -390 -380 0.275027 0.174
NP_440478.1_10 Forward -127 -113 17.3058 0.107
NP_442341.1_7 Reverse -115 -129 22.0257 0.00401
NP_442341.1_7 Forward -265 -251 9.83269 0.0697
NP_442341.1_7 Forward -126 -112 9.2427 0.0751
NP_442341.1_9 Forward -101 -87 19.1735 0.0123
NP_442341.1_9 Reverse -306 -320 11.1104 0.13
NP_441756.1_5 Forward -129 -110 10.5209 0.117
NP_441756.1_5 Forward -328 -309 -1.96717 0.267
NP_441756.1_5 Reverse -305 -324 -3.73712 0.29
NP_442395.2_4 Forward -126 -107 7.4718 0.139
NP_442395.2_4 Reverse -115 -134 1.76863 0.234
NP_443000.1_7 Reverse -114 -124 19.9412 0.00223
NP_443000.1_7 Forward -127 -117 2.04498 0.226
NP_440507.2_3 Reverse -107 -126 13.175 0.145
NP_441842.1_10 Forward -132 -118 15.7325 0.0381
NP_440275.1_3 Forward -127 -117 17.9746 0.0082
NP_440275.1_3 Reverse -114 -124 15.123 0.0182
NP_440091.1_1 Forward -129 -117 12.6253 0.0353
NP_440679.1_10 Forward -262 -243 -16.0285 0.25
NP_443010.1_10 Forward -128 -111 6.05634 0.193
NP_441359.1_5 Reverse -113 -132 16.7157 0.0475
NP_440149.1_8 Forward -125 -106 -2.55715 0.172
NP_440149.1_10 Reverse -190 -209 -12.1936 0.285
NP_441105.1_3 Reverse -297 -316 -3.3438 0.177
NP_441105.1_3 Forward -136 -117 -6.1954 0.23
NP_441105.1_3 Forward -196 -177 -6.58872 0.236
NP_441105.1_3 Reverse -105 -124 -7.37537 0.251
NP_441105.1_3 Reverse -99 -118 -9.73531 0.295
NP_442373.1_2 Reverse -366 -385 3.73603 0.156
NP_440216.1_1 Reverse -116 -130 8.25939 0.0061
NP_440216.1_1 Forward -125 -111 -0.492064 0.0284
NP_440216.1_1 Reverse -255 -269 -4.03198 0.096
NP_440216.1_6 Forward -132 -116 5.76173 0.189
NP_440216.1_9 Forward -315 -306 5.89959 0.289
NP_440172.1_1 Forward -125 -115 15.0247 0.00945
NP_440172.1_1 Reverse -116 -126 8.73149 0.0586
NP_440172.1_1 Forward -185 -175 2.7333 0.268
NP_440172.1_1 Forward -264 -254 2.33998 0.279
NP_442371.1_1 Forward -52 -42 12.6642 0.245
NP_442015.1_10 Reverse -112 -125 21.1604 0.00329
NP_442015.1_10 Forward -268 -255 6.21414 0.122
NP_442015.1_10 Forward -129 -116 3.95252 0.178
NP_442015.1_10 Forward -394 -381 2.67422 0.187
NP_442015.1_10 Forward -189 -176 0.510939 0.224
NP_442015.1_10 Reverse -172 -185 -0.177378 0.255
NP_441226.1_7 Forward -124 -117 14.4934 0.0123
NP_441226.1_7 Reverse -117 -124 14.4934 0.0123
NP_441226.1_7 Reverse -177 -184 11.2485 0.0971
NP_441226.1_7 Reverse -256 -263 9.77352 0.131
NP_441111.1_7 Forward -124 -116 18.7023 0.00294
NP_441111.1_7 Reverse -117 -125 18.7023 0.00294
NP_441111.1_7 Forward -184 -176 -0.570565 0.233
NP_441111.1_7 Reverse -177 -185 -0.570565 0.233
NP_441111.1_7 Forward -389 -381 -0.668896 0.274
NP_441766.1_2 Forward -125 -116 17.5026 0.00297
NP_441766.1_2 Reverse -116 -125 17.5026 0.00297
NP_441766.1_2 Forward -264 -255 4.22796 0.193
NP_440416.1_1 Reverse -116 -135 -13.5702 0.281
NP_440416.1_9 Reverse -109 -128 2.3594 0.0409
NP_440416.1_9 Forward -132 -113 -14.7502 0.18
NP_440416.1_9 Reverse -301 -320 -15.4385 0.191
NP_440416.1_9 Reverse -248 -267 -19.2734 0.272
NP_443052.1_8 Forward -135 -116 -2.45882 0.0903
NP_443052.1_8 Forward -400 -381 -10.3253 0.207
NP_443052.1_9 Forward -385 -366 -3.04881 0.245
NP_442154.1_1 Reverse -373 -391 -4.8974 0.125
NP_442154.1_1 Forward -248 -230 -6.96235 0.141
NP_442154.1_1 Forward -257 -239 -7.55234 0.143
NP_442154.1_1 Reverse -367 -385 -13.2555 0.217
NP_441430.1_6 Forward -130 -111 11.2092 0.251
NP_442564.1_10 Reverse -341 -355 9.83269 0.296
NP_440261.1_5 Forward -124 -111 4.93583 0.0478
NP_440261.1_5 Reverse -117 -130 -1.06236 0.0655
NP_440261.1_5 Reverse -309 -322 -2.73398 0.0924
NP_440261.1_5 Forward -184 -171 -4.60227 0.158
NP_440261.1_5 Reverse -256 -269 -10.8955 0.221
NP_440261.1_5 Forward -161 -148 -10.8955 0.221
NP_440988.1_10 Forward -127 -113 5.67333 0.24
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

AGAATGCGACTGCTACCGCCAATGCCGCAACCCACATCCAATACCGTTGTGCCGGGGGGAAGTGTATCTAATCCGCCCCACTGGGCCATGGCATGGACAAAATCAATTTTCGATTGGATGAAATCCTTGGCCACTGGCGGATCGCCATAATGGCCGAGGTGGATATGGTCGCCCCAGTAATATTCCAAAATGCCGTCCTCTGTCCATTGGTCGTAGGCGTTGGCCACGGAATCCGATGACTGATAGCCCCGGGCAGTTAGGAGATACAGTCCAGCGGCGATCGCCAGGGAGAGGGAAATTAGGCCAGCGGGCAGAAGCAAATACTCGGGCATGGAATAGTTAAAACAGCAGGGAAAATTAAGTATTAATCTTGTTTAGGGTAACAAAGTTGGGCAGGGCC

CDS

ATGAATCGCTTCCAATCTATCCTTGGTCAAGACCAAGCCATTGCTCTACTCCAACAGGCGATCGCCCAGAAACGCATTGCTCCGGCCTATTTGCTAGTGGGGCCAGAGGGGGTGGGCAAAAGTTTAGCCGCCAAGGCCTTTGGGGAAACCTTGCTAATGGGCTTGGGTACTAAAAGCGATCGCCAGGAACGTTTTTTTGCCGGGAATCATCCCGATTTATTGAAAATAGAACCCACTTTTCAACACCAGGGCAAACTGCTAACCGCCAGCGAAGCAGACCAGGCTGGACTTAAACGACGGGCGGCTCCATTAATCCGAGTGGAACAGGTGCGGGAAATCAACCGTTTCCTCAGTCGTCCCCCGTTGGAAGCAGACAGGGCTGTGATTCTGATCGAGGAAGCCCAAGCTATGAATGAAGGGGCCGCCAATGCCTTGCTCAAAACCTTGGAAGAACCAGGAAGGGCTACTTTAATCCTTTTGGCCCCCAGCGTTGATGTCCTGTTGCCCACCATTGTTTCCCGCTGTCAACGCATCCCCTTTTATCGTTTAGGGGAAGGTGATATGACCAAAATTTTGCAGAGATTGGGCCGTCAGGAAATCCTCCACCACCCCGAACTGTTGGCGATCGCCCAGGGGAGTCCCGGTCTGTTATTTCAAGCTTGGGAGCAAATGCAGAGCATTCCGGCGGAACTGCGGCAAAAGTTAATGCAACCACCAACTAGTCCTCTAGCAGCCTTTGATTTGGCCAAGATGGTGGATGGCAACTTGGATAACAGTGCCCAACTCTGGTTAGTGGACTATCTCCAGTATCACTATTGGCATGGCCACCACCAACGGCCATGGTTAGAAATTCTGGAAAAAGCCCGTAAATACCTGGCCGCCTACGTTCAACCTCGGCTAGTGTGGGAAACGACTTTCCTCGCCCTTTATCGTTTAGAAAACTCTGGCGATCGCCGATAA

Protein

MNRFQSILGQDQAIALLQQAIAQKRIAPAYLLVGPEGVGKSLAAKAFGETLLMGLGTKSDRQERFFAGNHPDLLKIEPTFQHQGKLLTASEADQAGLKRRAAPLIRVEQVREINRFLSRPPLEADRAVILIEEAQAMNEGAANALLKTLEEPGRATLILLAPSVDVLLPTIVSRCQRIPFYRLGEGDMTKILQRLGRQEILHHPELLAIAQGSPGLLFQAWEQMQSIPAELRQKLMQPPTSPLAAFDLAKMVDGNLDNSAQLWLVDYLQYHYWHGHHQRPWLEILEKARKYLAAYVQPRLVWETTFLALYRLENSGDRR