Your browser is old and dusty. Try Google Chrome!

Details for slr0417

ORF slr0417
Accession NP_442310.1
Symbol gyrA
Category DNA gyrase subunit A
Definition DNA replication, restriction, modification, recombination, and repair
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_441061.1_2 Reverse -314 -328 19.3708 0.0144
NP_440795.1_7 Forward -321 -314 14.6904 0.0123
NP_440795.1_7 Reverse -314 -321 14.6904 0.0123
NP_441418.1_6 Reverse -313 -332 -1.96717 0.0166
NP_441418.1_6 Forward -322 -303 -21.1417 0.139
NP_441605.1_6 Reverse -260 -279 5.01433 0.207
NP_442291.1_5 Forward -323 -307 5.86006 0.0727
NP_442291.1_5 Reverse -312 -328 -1.80975 0.202
NP_441453.1_4 Reverse -313 -321 16.539 0.00633
NP_441453.1_4 Forward -322 -314 16.539 0.00633
NP_441453.1_7 Forward -57 -50 11.6422 0.298
NP_442151.1_6 Reverse -313 -327 10.226 0.127
NP_442151.1_6 Forward -322 -308 8.06273 0.183
NP_442151.1_6 Reverse -382 -396 7.07942 0.211
NP_442151.1_6 Forward -207 -193 6.09611 0.248
NP_442151.1_6 Forward -391 -377 5.60446 0.27
NP_441818.1_1 Reverse -314 -325 10.1862 0.232
NP_441818.1_9 Forward -131 -112 -8.45701 0.277
NP_440226.1_1 Forward -322 -303 20.059 0.0103
NP_440226.1_1 Reverse -135 -154 1.96607 0.282
NP_442623.1_3 Reverse -314 -333 -10.817 0.199
NP_440996.1_2 Reverse -282 -291 13.9627 0.293
NP_440996.1_3 Reverse -312 -330 10.6389 0.247
NP_441721.1_7 Forward -23 -4 16.6174 0.149
NP_442173.1_1 Forward -321 -313 15.4574 0.00633
NP_442173.1_1 Reverse -314 -322 15.4574 0.00633
NP_442173.1_1 Reverse -136 -144 11.3275 0.0463
NP_442752.1_4 Forward -322 -315 13.8055 0.0199
NP_442752.1_4 Reverse -313 -320 13.8055 0.0199
NP_442752.1_4 Reverse -382 -389 4.26735 0.293
NP_443027.1_4 Forward -324 -314 14.0414 0.0452
NP_443027.1_4 Reverse -380 -390 9.22315 0.172
NP_442975.1_10 Forward -326 -312 4.91554 0.234
NP_442975.1_10 Reverse -309 -323 2.35894 0.276
NP_440784.1_7 Forward -321 -314 15.9687 0.0123
NP_440784.1_7 Reverse -314 -321 15.9687 0.0123
NP_442909.1_7 Forward -321 -307 8.94708 0.161
NP_441250.1_3 Forward -315 -296 1.47442 0.288
NP_440061.1_9 Reverse -311 -325 10.717 0.123
NP_440061.1_9 Forward -324 -310 10.422 0.124
NP_441145.1_7 Reverse -157 -176 9.63589 0.214
NP_442062.1_8 Forward -322 -312 17.3846 0.00193
NP_442062.1_8 Reverse -313 -323 17.3846 0.00193
NP_442062.1_8 Reverse -382 -392 5.19158 0.181
NP_441859.1_3 Reverse -312 -331 10.6184 0.119
NP_441859.1_3 Reverse -134 -153 1.27698 0.29
NP_441043.1_1 Forward -56 -37 14.3549 0.286
NP_441802.1_1 Reverse -298 -317 5.01433 0.286
NP_440304.1_4 Forward -324 -314 10.8948 0.051
NP_440304.1_4 Reverse -196 -206 3.02829 0.299
NP_440304.1_4 Reverse -311 -321 1.84832 0.299
NP_442242.1_4 Forward -321 -314 14.3954 0.0124
NP_442242.1_4 Reverse -314 -321 14.3954 0.0124
NP_440044.1_8 Reverse -314 -333 -0.688862 0.225
NP_441581.1_9 Reverse -259 -278 7.68668 0.261
NP_442048.1_9 Forward -51 -32 18.4857 0.189
NP_440011.1_1 Forward -65 -46 10.9142 0.293
NP_439918.1_3 Reverse -310 -329 9.53756 0.249
NP_441208.1_9 Reverse -310 -324 7.07942 0.227
NP_441594.1_6 Forward -126 -107 1.27776 0.269
NP_441594.1_6 Reverse -316 -335 0.392778 0.287
NP_442110.1_7 Reverse -313 -327 10.7177 0.0644
NP_440769.1_8 Reverse -274 -293 9.43923 0.214
NP_440856.1_7 Reverse -310 -329 2.16274 0.157
NP_441083.1_5 Forward -322 -312 20.3345 0.00053
NP_441083.1_5 Reverse -313 -323 20.3345 0.00053
NP_441083.1_5 Reverse -382 -392 8.23984 0.0429
NP_441083.1_5 Forward -391 -381 1.35667 0.209
NP_441434.1_1 Reverse -210 -224 7.74647 0.267
NP_441738.1_2 Forward -320 -313 15.28 0.0102
NP_441738.1_2 Reverse -315 -322 15.28 0.0102
NP_441558.1_5 Forward -324 -305 13.1758 0.0619
NP_441558.1_5 Reverse -317 -336 5.60432 0.245
NP_440209.1_1 Reverse -313 -321 18.1123 0.00295
NP_440209.1_1 Forward -322 -314 18.1123 0.00295
NP_440209.1_1 Forward -391 -383 5.0343 0.194
NP_442889.1_8 Forward -325 -311 4.12889 0.27
NP_440178.1_7 Forward -323 -304 -20.8467 0.201
NP_440331.1_5 Reverse -163 -182 0.58944 0.0225
NP_441716.1_1 Reverse -313 -327 19.4691 0.00947
NP_441716.1_1 Forward -322 -308 8.55439 0.138
NP_441327.1_4 Reverse -306 -320 16.4209 0.282
NP_442111.1_1 Forward -336 -317 11.995 0.29
NP_442111.1_4 Reverse -312 -326 12.0943 0.0451
NP_442111.1_4 Forward -323 -309 2.65453 0.268
NP_440906.1_5 Forward -321 -314 15.8704 0.0124
NP_440906.1_5 Reverse -314 -321 15.8704 0.0124
NP_440747.1_10 Reverse -310 -322 24.7201 0.00036
NP_440747.1_10 Forward -325 -313 17.2469 0.000522
NP_440747.1_10 Reverse -379 -391 -11.9574 0.178
NP_440747.1_10 Forward -394 -382 -12.2524 0.254
NP_441854.1_10 Forward -116 -97 2.75272 0.282
NP_441486.1_1 Forward -325 -311 14.7492 0.00628
NP_441486.1_1 Reverse -310 -324 12.586 0.0112
NP_441486.1_1 Reverse -379 -393 -5.31028 0.231
NP_442634.1_4 Reverse -311 -325 -1.67204 0.149
NP_442848.1_1 Forward -328 -314 7.9644 0.0791
NP_442848.1_1 Reverse -307 -321 -0.787057 0.263
NP_441012.1_4 Forward -326 -313 7.49244 0.272
NP_443018.1_3 Forward -321 -314 14.8871 0.0123
NP_443018.1_3 Reverse -314 -321 14.8871 0.0123
NP_443018.1_3 Reverse -136 -143 8.8889 0.136
NP_441634.1_8 Forward -125 -111 -0.492064 0.259
NP_440376.1_1 Forward -322 -313 19.4693 0.000692
NP_440376.1_1 Reverse -313 -322 19.4693 0.000692
NP_440376.1_1 Reverse -382 -391 0.0980582 0.285
NP_440376.1_1 Forward -391 -382 -0.000272808 0.285
NP_441588.1_4 Forward -320 -310 9.02648 0.14
NP_442687.1_7 Forward -323 -313 8.92815 0.0994
NP_442687.1_7 Reverse -312 -322 8.92815 0.0994
NP_442687.1_7 Reverse -197 -207 7.35486 0.134
NP_442485.1_3 Forward -119 -100 -1.86883 0.261
NP_442658.1_1 Reverse -311 -321 6.76441 0.214
NP_442658.1_1 Forward -324 -314 6.76441 0.214
NP_442658.1_1 Forward -146 -136 5.48612 0.265
NP_440141.1_8 Reverse -182 -201 7.96426 0.232
NP_441855.2_4 Forward -330 -311 11.9332 0.204
NP_442782.1_7 Forward -330 -311 12.3892 0.0929
NP_441414.1_9 Forward -322 -303 -4.52377 0.156
NP_441414.1_9 Reverse -313 -332 -5.80207 0.18
NP_442937.1_5 Reverse -308 -327 16.5191 0.042
NP_441958.1_5 Forward -323 -313 12.2714 0.00183
NP_441958.1_5 Reverse -312 -322 12.2714 0.00183
NP_441958.1_5 Reverse -381 -391 -6.90313 0.293
NP_442486.1_4 Forward -320 -301 11.4058 0.179
NP_440203.1_5 Reverse -316 -326 15.7125 0.0611
NP_439905.1_2 Forward -113 -99 18.3875 0.159
NP_440984.1_7 Reverse -308 -322 5.60446 0.248
NP_440984.1_7 Forward -121 -107 4.52282 0.299
NP_439990.1_5 Forward -327 -314 11.3273 0.128
NP_439990.1_5 Forward -396 -383 7.00078 0.218
NP_442911.1_2 Forward -332 -313 25.5655 0.00397
NP_442911.1_2 Reverse -303 -322 4.916 0.0361
NP_443055.1_6 Forward -116 -98 -0.374908 0.259
NP_440993.1_4 Reverse -313 -330 7.217 0.232
NP_440138.1_6 Reverse -314 -333 15.8299 0.109
NP_442002.1_9 Forward -145 -138 9.97054 0.246
NP_441712.1_1 Reverse -271 -290 12.3233 0.251
NP_441294.1_7 Reverse -378 -392 11.2664 0.15
NP_441294.1_7 Reverse -309 -323 9.82656 0.223
NP_441294.1_7 Forward -377 -363 8.48272 0.298
NP_440106.1_2 Reverse -99 -117 10.8356 0.297
NP_440411.1_10 Forward -207 -188 9.48095 0.286
NP_441646.1_1 Reverse -23 -42 3.24438 0.207
NP_442438.1_10 Forward -327 -313 8.84938 0.0718
NP_442870.1_4 Forward -290 -276 14.5526 0.289
NP_440147.1_4 Reverse -311 -324 11.3273 0.0326
NP_440147.1_4 Forward -324 -311 2.18257 0.209
NP_441175.1_7 Forward -322 -303 16.3224 0.0719
NP_441295.1_4 Forward -327 -308 -3.63879 0.29
NP_441550.1_8 Reverse -311 -321 14.6309 0.0132
NP_441550.1_8 Forward -324 -314 12.3692 0.0336
NP_441550.1_8 Forward -393 -383 4.99446 0.274
NP_441916.1_7 Forward -322 -312 10.3048 0.0261
NP_441916.1_7 Reverse -313 -323 10.3048 0.0261
NP_441916.1_10 Forward -330 -311 6.09597 0.208
NP_441041.1_4 Forward -322 -303 -11.8003 0.252
NP_441041.1_7 Reverse -310 -322 8.58373 0.133
NP_441041.1_7 Reverse -195 -207 5.76558 0.241
NP_440569.1_10 Reverse -275 -294 9.7875 0.229
NP_440569.1_10 Reverse -137 -156 2.43462 0.293
NP_441547.1_2 Forward -333 -315 15.7521 0.0913
NP_442004.1_6 Reverse -313 -327 8.45605 0.14
NP_441725.1_4 Forward -327 -313 3.63724 0.278
NP_441725.1_5 Reverse -314 -324 11.2881 0.0247
NP_441725.1_5 Forward -321 -311 2.04498 0.115
NP_439966.1_7 Forward -324 -314 15.8108 0.0124
NP_439966.1_7 Reverse -311 -321 7.25606 0.15
NP_442941.1_3 Reverse -314 -324 19.9412 0.00262
NP_442941.1_3 Forward -321 -311 11.0914 0.0116
NP_442941.1_3 Forward -390 -380 0.57002 0.199
NP_442941.1_3 Reverse -383 -393 -1.29827 0.297
NP_440289.1_2 Forward -325 -312 3.75586 0.0741
NP_440289.1_2 Forward -239 -226 -1.06236 0.221
NP_440289.1_2 Reverse -310 -323 -4.9956 0.294
NP_442281.1_1 Reverse -308 -322 18.6818 0.00408
NP_442281.1_1 Forward -327 -313 17.6002 0.00542
NP_442281.1_1 Reverse -377 -391 3.8339 0.217
NP_442281.1_1 Forward -106 -92 1.96562 0.282
NP_442575.1_8 Reverse -93 -112 -1.47551 0.232
NP_442256.1_2 Reverse -311 -329 -0.964162 0.155
NP_442256.1_2 Forward -324 -306 -9.42063 0.268
NP_442012.1_1 Forward -328 -309 2.45773 0.2
NP_442049.1_6 Forward -110 -91 5.89931 0.231
NP_441087.1_6 Forward -73 -55 0.313405 0.258
NP_441556.1_10 Forward -70 -56 13.4339 0.178
NP_441644.1_6 Forward -322 -312 17.3841 0.00127
NP_441644.1_6 Reverse -313 -323 17.3841 0.00127
NP_441644.1_6 Reverse -382 -392 4.50281 0.235
NP_441644.1_6 Reverse -319 -329 3.22451 0.293
NP_442215.1_2 Reverse -311 -327 13.7265 0.0222
NP_442215.1_2 Reverse -90 -106 3.69678 0.093
NP_442215.1_2 Forward -393 -377 1.14018 0.14
NP_442215.1_2 Forward -324 -308 -3.18639 0.211
NP_442177.1_5 Forward -134 -120 9.93102 0.236
NP_442029.1_1 Reverse -97 -116 -14.3569 0.272
NP_442029.1_6 Reverse -308 -327 4.22769 0.271
NP_440253.1_2 Reverse -313 -331 4.73903 0.1
NP_440253.1_2 Forward -322 -304 2.87075 0.128
NP_440929.1_8 Forward -322 -313 19.2726 0.000701
NP_440929.1_8 Reverse -313 -322 19.2726 0.000701
NP_440780.1_1 Reverse -272 -291 7.59119 0.274
NP_442933.1_10 Forward -322 -313 17.601 0.00325
NP_442933.1_10 Reverse -313 -322 17.601 0.00325
NP_442933.1_10 Forward -391 -382 11.5045 0.042
NP_441751.2_8 Reverse -314 -328 7.9644 0.0327
NP_441751.2_8 Forward -321 -307 -0.983719 0.129
NP_442554.1_8 Reverse -314 -324 15.9097 0.00747
NP_442554.1_8 Forward -321 -311 15.3197 0.00882
NP_442554.1_8 Reverse -31 -41 3.51995 0.222
NP_441762.1_7 Forward -323 -311 0.432302 0.0747
NP_441762.1_7 Forward -145 -133 -6.35254 0.284
NP_441762.1_7 Reverse -312 -324 -6.84419 0.284
NP_442142.1_4 Forward -325 -312 15.4566 0.0264
NP_442142.1_4 Reverse -310 -323 12.2117 0.0464
NP_442142.1_4 Forward -331 -318 9.16348 0.101
NP_442142.1_4 Reverse -379 -392 6.11523 0.173
NP_442292.1_1 Forward -321 -312 18.486 0.00229
NP_442292.1_1 Reverse -314 -323 18.486 0.00229
NP_442292.1_1 Forward -390 -381 -0.786921 0.287
NP_440775.1_5 Reverse -325 -344 19.2723 0.155
NP_443009.1_5 Reverse -312 -323 8.90795 0.0965
NP_443009.1_5 Forward -323 -312 8.90795 0.0965
NP_443009.1_5 Forward -145 -134 4.77807 0.23
NP_442408.2_1 Reverse -313 -332 -3.44213 0.241
NP_441715.1_4 Reverse -314 -324 14.828 0.0268
NP_441715.1_4 Forward -321 -311 7.94484 0.107
NP_441198.1_8 Forward -146 -136 10.7322 0.247
NP_440379.1_5 Forward -117 -98 -3.04881 0.204
NP_440464.1_10 Forward -321 -311 13.0082 0.169
NP_440464.1_10 Reverse -140 -150 12.4352 0.225
NP_441468.1_1 Forward -321 -314 15.8704 0.0124
NP_441468.1_1 Reverse -314 -321 15.8704 0.0124
NP_441020.2_6 Reverse -311 -328 10.1669 0.151
NP_441020.2_6 Forward -324 -307 6.33202 0.267
NP_441015.1_10 Reverse -308 -327 -8.45701 0.273
NP_441673.1_1 Forward -322 -313 20.8459 0.000698
NP_441673.1_1 Reverse -313 -322 20.8459 0.000698
NP_441673.1_1 Reverse -382 -391 1.37636 0.114
NP_441673.1_1 Forward -391 -382 1.1797 0.163
NP_441731.1_3 Forward -330 -311 -6.78538 0.299
NP_441876.1_9 Reverse -45 -55 14.4342 0.267
NP_441826.1_2 Forward -328 -314 12.4876 0.0272
NP_441826.1_2 Reverse -307 -321 2.16287 0.134
NP_441637.1_9 Forward -214 -196 -2.63579 0.292
NP_442868.1_6 Forward -324 -314 9.91146 0.038
NP_442868.1_6 Reverse -311 -321 9.81313 0.038
NP_442868.1_6 Reverse -196 -206 4.40493 0.178
NP_442719.1_2 Reverse -220 -238 -9.81463 0.267
NP_442719.1_2 Reverse -32 -50 -10.9946 0.286
NP_441251.1_8 Forward -32 -19 13.1442 0.254
NP_441056.1_1 Reverse -313 -332 -8.26035 0.282
NP_441612.1_2 Reverse -382 -392 13.0995 0.21
NP_441612.1_2 Reverse -313 -323 8.54929 0.21
NP_441612.1_2 Forward -322 -312 8.54929 0.21
NP_443058.1_7 Reverse -312 -331 2.26107 0.293
NP_442361.1_3 Forward -328 -315 17.2272 0.0481
NP_442427.1_8 Reverse -304 -323 7.66927 0.208
NP_442808.1_1 Reverse -312 -322 8.63269 0.0481
NP_442808.1_1 Forward -323 -313 8.63269 0.0481
NP_442808.1_1 Reverse -113 -123 4.40448 0.199
NP_440031.1_10 Forward -198 -179 -0.39387 0.282
NP_440145.1_3 Reverse -303 -322 10.9142 0.04
NP_442050.1_5 Forward -324 -314 16.4991 0.00812
NP_442050.1_5 Reverse -311 -321 7.64939 0.243
NP_441493.2_10 Reverse -302 -321 6.58763 0.249
NP_441114.1_3 Reverse -94 -103 7.66954 0.231
NP_440558.1_2 Forward -331 -312 0.982764 0.185
NP_440558.1_2 Reverse -36 -55 -3.83545 0.239
NP_440558.1_2 Forward -111 -92 -4.81876 0.249
NP_441878.1_6 Forward -323 -313 10.4031 0.0176
NP_441878.1_6 Reverse -312 -322 10.4031 0.0176
NP_441036.1_8 Forward -323 -313 8.33817 0.174
NP_441036.1_8 Reverse -312 -322 8.33817 0.174
NP_442650.1_2 Reverse -313 -327 6.58777 0.13
NP_441557.1_5 Forward -322 -313 19.9609 0.000699
NP_441557.1_5 Reverse -313 -322 19.9609 0.000699
NP_441557.1_5 Reverse -382 -391 0.491382 0.144
NP_441557.1_5 Forward -391 -382 0.29472 0.174
NP_441445.1_1 Reverse -304 -323 9.0459 0.111
NP_441445.1_1 Forward -331 -312 5.89931 0.162
NP_441445.1_8 Reverse -94 -113 -4.52377 0.277
NP_442066.2_9 Forward -211 -198 16.8339 0.0421
NP_441433.1_8 Forward -63 -44 -4.81876 0.298
NP_441458.1_10 Forward -331 -312 13.8641 0.0856
NP_442183.1_1 Reverse -313 -327 16.3225 0.0151
NP_442183.1_1 Forward -322 -308 5.70279 0.206
NP_442397.1_9 Reverse -313 -332 4.81767 0.254
NP_440595.1_8 Reverse -313 -332 11.1109 0.247
NP_442347.1_2 Forward -390 -381 14.5527 0.056
NP_442347.1_2 Forward -321 -312 12.4878 0.056
NP_442347.1_2 Reverse -314 -323 12.4878 0.056
NP_442645.1_2 Reverse -305 -324 -13.4719 0.154
NP_441037.1_1 Forward -78 -59 25.6629 0.00427
NP_441037.1_4 Reverse -311 -321 7.9999 0.237
NP_442594.1_8 Reverse -239 -258 2.75272 0.293
NP_441633.1_3 Reverse -311 -324 1.10092 0.109
NP_441633.1_3 Reverse -133 -146 -5.09393 0.223
NP_441633.1_3 Forward -324 -311 -5.97891 0.236
NP_440136.1_2 Forward -321 -314 15.9687 0.0123
NP_440136.1_2 Reverse -314 -321 15.9687 0.0123
NP_442998.1_5 Forward -158 -148 8.63316 0.261
NP_442998.1_10 Forward -320 -313 15.5754 0.0102
NP_442998.1_10 Reverse -315 -322 15.5754 0.0102
NP_442998.1_10 Forward -389 -382 5.93897 0.206
NP_440299.1_1 Forward -326 -313 22.3398 0.000547
NP_440299.1_1 Reverse -309 -322 12.7034 0.0356
NP_441799.1_1 Reverse -309 -323 15.4369 0.0182
NP_441799.1_1 Forward -326 -312 5.30886 0.214
NP_441007.1_10 Reverse -308 -321 -0.865694 0.295
NP_441007.1_10 Forward -327 -314 -0.865694 0.295
NP_442201.1_10 Forward -148 -129 -4.03212 0.152
NP_442333.2_5 Forward -112 -93 -14.2585 0.272
NP_440256.1_1 Reverse -310 -329 5.211 0.0381
NP_440256.1_1 Forward -105 -86 -8.65367 0.264
NP_441559.1_8 Reverse -215 -229 -6.19526 0.275
NP_441559.1_8 Forward -327 -313 -6.68692 0.279
NP_440915.1_6 Forward -326 -312 3.8345 0.1
NP_440717.1_3 Forward -113 -99 8.45543 0.265
NP_440164.1_1 Reverse -156 -175 2.45773 0.273
NP_441704.1_8 Forward -333 -314 8.84842 0.202
NP_441464.1_8 Forward -207 -193 8.94771 0.192
NP_441464.1_10 Forward -127 -113 11.7993 0.216
NP_440787.1_5 Reverse -305 -319 11.7993 0.256
NP_440695.1_6 Forward -218 -204 9.73265 0.276
NP_441494.1_6 Forward -14 -1 7.78743 0.249
NP_442386.1_9 Reverse -312 -321 13.8639 0.0289
NP_442386.1_9 Forward -323 -314 13.8639 0.0289
NP_441340.1_5 Forward -321 -314 15.6737 0.0124
NP_441340.1_5 Reverse -314 -321 15.6737 0.0124
NP_441340.1_5 Forward -143 -136 4.07068 0.239
NP_443028.1_4 Reverse -272 -291 11.5187 0.263
NP_440168.1_9 Reverse -91 -110 -3.54046 0.296
NP_440168.1_9 Reverse -39 -58 -5.70374 0.296
NP_442240.1_1 Reverse -127 -146 8.4551 0.238
NP_442240.1_2 Forward -321 -302 -19.7651 0.295
NP_440586.1_1 Forward -121 -102 0.196116 0.237
NP_440586.1_8 Forward -321 -314 13.2151 0.026
NP_440586.1_8 Reverse -314 -321 13.2151 0.026
NP_440586.1_8 Reverse -383 -390 12.6251 0.0546
NP_440586.1_8 Reverse -320 -327 5.8403 0.283
NP_442251.1_6 Forward -321 -314 15.2804 0.0124
NP_442251.1_6 Reverse -314 -321 15.2804 0.0124
NP_440684.1_9 Reverse -307 -321 9.34103 0.221
NP_441262.1_3 Reverse -313 -320 14.7888 0.0223
NP_441262.1_3 Forward -322 -315 14.7888 0.0223
NP_443051.1_1 Reverse -312 -321 10.4228 0.00754
NP_443051.1_1 Forward -323 -314 10.4228 0.00754
NP_439984.1_3 Reverse -306 -320 15.3386 0.158
NP_439937.1_9 Reverse -38 -55 -1.63347 0.125
NP_439937.1_9 Reverse -134 -151 -10.0899 0.221
NP_439937.1_9 Forward -50 -33 -10.3849 0.227
NP_440439.1_1 Forward -325 -312 0.117615 0.202
NP_440372.1_2 Forward -321 -314 16.3621 0.0124
NP_440372.1_2 Reverse -314 -321 16.3621 0.0124
NP_440372.1_2 Forward -143 -136 4.07068 0.262
NP_440819.1_5 Reverse -299 -307 7.59091 0.272
NP_440316.1_10 Forward -124 -114 8.4365 0.239
NP_440267.1_2 Reverse -377 -391 7.57046 0.196
NP_442384.1_10 Reverse -313 -326 17.4239 0.00585
NP_442384.1_10 Forward -322 -309 8.47575 0.0656
NP_441018.1_7 Reverse -95 -114 6.78429 0.282
NP_442790.1_4 Forward -331 -312 -10.0303 0.2
NP_442262.1_10 Forward -321 -314 14.1988 0.0123
NP_442262.1_10 Reverse -314 -321 14.1988 0.0123
NP_442262.1_10 Reverse -136 -143 11.4455 0.102
NP_441689.1_5 Forward -324 -314 15.3192 0.0403
NP_441689.1_5 Reverse -311 -321 5.78111 0.197
NP_440163.1_10 Forward -325 -315 12.4681 0.159
NP_440344.1_10 Forward -329 -312 9.38028 0.00838
NP_440344.1_10 Forward -212 -195 -4.38605 0.0956
NP_442910.1_1 Forward -329 -310 -7.17871 0.254
NP_441965.1_10 Forward -325 -309 4.3851 0.242
NP_440297.1_9 Reverse -314 -324 9.32148 0.0917
NP_440297.1_9 Reverse -123 -133 1.25834 0.282
NP_440297.1_9 Forward -321 -311 -0.118297 0.282
NP_442280.1_10 Reverse -89 -107 5.74663 0.283
NP_440894.1_10 Forward -396 -377 2.85105 0.281
NP_442078.1_3 Forward -33 -14 -1.08295 0.274
NP_440999.1_9 Forward -326 -312 3.34284 0.131
NP_440888.1_2 Reverse -313 -327 15.8302 0.00862
NP_440888.1_2 Forward -391 -377 6.19383 0.243
NP_440888.1_2 Forward -322 -308 5.40719 0.28
NP_442033.1_10 Forward -209 -190 -12.0953 0.261
NP_440575.1_8 Reverse -284 -303 -3.73712 0.261
NP_441543.1_2 Forward -321 -312 16.9127 0.00359
NP_441543.1_2 Reverse -314 -323 16.9127 0.00359
NP_441543.1_2 Reverse -383 -392 11.9961 0.047
NP_442845.1_2 Reverse -313 -327 7.76774 0.195
NP_442845.1_2 Forward -328 -314 5.30946 0.237
NP_442845.1_2 Forward -131 -117 3.63784 0.282
NP_441178.1_6 Forward -111 -92 5.01354 0.268
NP_441918.1_7 Forward -323 -304 16.4207 0.116
NP_442710.1_7 Reverse -273 -292 -7.31885 0.294
NP_441469.1_8 Forward -323 -314 6.48957 0.227
NP_441469.1_8 Reverse -312 -321 6.48957 0.227
NP_443064.1_6 Forward -322 -312 12.5669 0.0796
NP_443064.1_6 Reverse -313 -323 12.5669 0.0796
NP_442578.1_7 Forward -321 -314 14.5921 0.026
NP_442578.1_7 Reverse -314 -321 14.5921 0.026
NP_442578.1_7 Reverse -383 -390 12.6255 0.0418
NP_440220.1_3 Reverse -130 -144 20.7474 0.131
NP_441462.1_2 Forward -322 -312 11.5831 0.00406
NP_441462.1_2 Reverse -313 -323 11.5831 0.00406
NP_441462.1_2 Reverse -198 -208 -0.708283 0.245
NP_443062.1_1 Reverse -313 -331 5.03566 0.242
NP_443062.1_1 Forward -322 -304 4.74314 0.25
NP_442204.1_1 Forward -326 -315 9.69511 0.0736
NP_442204.1_2 Forward -332 -313 6.58763 0.287
NP_441560.1_8 Forward -396 -377 11.8049 0.28
NP_440516.1_8 Forward -322 -313 16.9127 0.00442
NP_440516.1_8 Reverse -313 -322 16.9127 0.00442
NP_442080.1_7 Forward -106 -87 -3.54046 0.29
NP_442428.1_4 Forward -138 -119 7.07928 0.193
NP_442428.1_5 Forward -321 -314 15.8704 0.0124
NP_442428.1_5 Reverse -314 -321 15.8704 0.0124
NP_440818.1_1 Forward -20 -1 -4.03212 0.284
NP_441443.1_7 Forward -135 -116 4.52268 0.218
NP_440673.1_3 Forward -320 -313 12.4288 0.0426
NP_440673.1_3 Reverse -315 -322 12.4288 0.0426
NP_440673.1_3 Reverse -137 -144 11.3472 0.085
NP_440673.1_3 Forward -389 -382 10.1672 0.149
NP_441052.1_2 Forward -322 -312 19.9412 0.00106
NP_441052.1_2 Reverse -313 -323 19.9412 0.00106
NP_441052.1_2 Reverse -382 -392 13.5497 0.0285
NP_441052.1_2 Forward -391 -381 7.84651 0.0605
NP_442219.1_9 Forward -321 -312 17.7976 0.00718
NP_442219.1_9 Reverse -314 -323 17.7976 0.00718
NP_442219.1_9 Forward -390 -381 4.71961 0.198
NP_440436.1_2 Forward -336 -317 17.7819 0.175
NP_440436.1_4 Forward -321 -312 17.2072 0.00233
NP_440436.1_4 Reverse -314 -323 17.2072 0.00233
NP_441884.1_9 Reverse -310 -329 -23.9933 0.284
NP_441719.1_4 Forward -321 -314 16.3621 0.0124
NP_441719.1_4 Reverse -314 -321 16.3621 0.0124
NP_441719.1_4 Reverse -383 -390 3.77569 0.285
NP_441004.1_2 Forward -239 -220 2.26107 0.215
NP_442813.1_4 Forward -67 -48 -7.76869 0.299
NP_442813.1_5 Reverse -104 -123 5.89931 0.213
NP_442366.1_3 Reverse -312 -330 14.6705 0.0216
NP_442366.1_3 Forward -145 -127 -4.50408 0.272
NP_442366.1_5 Reverse -310 -320 14.0409 0.0497
NP_440129.1_10 Forward -329 -315 16.7159 0.0373
NP_442873.1_9 Forward -332 -313 3.83357 0.287
NP_442206.1_10 Reverse -313 -328 15.4179 0.0799
NP_442206.1_10 Forward -322 -307 3.71647 0.181
NP_443054.1_2 Forward -209 -195 4.71948 0.24
NP_443054.1_2 Reverse -194 -208 1.96621 0.245
NP_443054.1_2 Forward -324 -310 1.57289 0.245
NP_441851.1_10 Forward -323 -313 15.8113 0.00552
NP_441851.1_10 Reverse -312 -322 15.8113 0.00552
NP_441851.1_10 Reverse -134 -144 4.10993 0.287
NP_441668.1_4 Reverse -303 -322 14.2574 0.0623
NP_441668.1_4 Forward -332 -313 3.44104 0.187
NP_442515.1_1 Reverse -381 -395 12.1926 0.035
NP_442515.1_1 Forward -323 -309 2.85119 0.129
NP_442515.1_1 Reverse -312 -326 1.86788 0.147
NP_442515.1_1 Reverse -197 -211 0.786239 0.18
NP_441982.1_6 Reverse -279 -288 11.9124 0.288
NP_440165.1_5 Reverse -312 -331 -7.08038 0.256
NP_441046.1_2 Forward -283 -264 -0.0988766 0.276
NP_440940.1_7 Forward -332 -314 7.68819 0.196
NP_441349.1_10 Forward -332 -313 4.03102 0.0604
NP_441349.1_10 Reverse -372 -391 -3.54046 0.144
NP_441349.1_10 Reverse -303 -322 -8.65367 0.278
NP_441409.1_6 Forward -328 -309 1.17943 0.062
NP_442314.1_3 Forward -106 -92 12.4876 0.277
NP_440432.1_9 Forward -321 -306 -2.28172 0.169
NP_442843.1_1 Forward -57 -38 0.294447 0.17
NP_441124.1_5 Forward -286 -276 13.1036 0.215
NP_441124.1_5 Forward -220 -210 11.9577 0.239
NP_442450.1_5 Forward -324 -314 9.32148 0.115
NP_442450.1_5 Reverse -311 -321 7.55152 0.13
NP_442168.1_6 Reverse -32 -51 8.65258 0.23
NP_440588.1_2 Forward -331 -312 -3.24547 0.182
NP_442006.1_2 Forward -132 -115 -16.1858 0.243
NP_442006.1_2 Forward -57 -40 -17.9557 0.285
NP_442006.1_2 Forward -102 -85 -18.939 0.296
NP_441570.1_1 Reverse -313 -331 -0.275845 0.0447
NP_441570.1_1 Forward -322 -304 -8.92897 0.124
NP_441078.1_4 Forward -322 -313 19.6659 0.0007
NP_441078.1_4 Reverse -313 -322 19.6659 0.0007
NP_441078.1_4 Reverse -382 -391 0.393051 0.205
NP_441078.1_4 Forward -391 -382 -0.000272808 0.205
NP_442729.1_5 Reverse -318 -328 16.6963 0.174
NP_442729.1_5 Reverse -98 -108 9.02648 0.235
NP_442729.1_8 Forward -395 -382 8.57408 0.125
NP_442729.1_8 Forward -326 -313 8.37742 0.125
NP_442348.1_2 Forward -181 -172 9.83282 0.273
NP_442348.1_2 Forward -182 -173 7.47288 0.28
NP_440526.1_3 Forward -321 -310 8.02298 0.126
NP_440526.1_3 Reverse -314 -325 7.92465 0.126
NP_441432.1_8 Reverse -312 -321 16.8143 0.00595
NP_441432.1_8 Forward -323 -314 16.8143 0.00595
NP_441432.1_8 Reverse -381 -390 4.22796 0.235
NP_443024.1_3 Forward -11 -1 10.5014 0.289
NP_442320.1_8 Forward -328 -314 3.34284 0.0625
NP_442320.1_8 Reverse -376 -390 1.96621 0.0801
NP_442320.1_8 Reverse -307 -321 -4.81863 0.188
NP_442344.1_7 Forward -143 -124 -8.55534 0.218
NP_441732.1_2 Forward -326 -310 2.02515 0.0253
NP_441732.1_2 Reverse -309 -325 -7.80794 0.0935
NP_441732.1_2 Reverse -101 -117 -15.9694 0.164
NP_440497.1_2 Reverse -94 -113 8.35759 0.223
NP_440760.1_1 Forward -322 -303 -13.0786 0.0976
NP_440199.1_10 Reverse -379 -389 14.9263 0.0861
NP_440199.1_10 Forward -325 -315 7.64985 0.231
NP_440913.1_1 Reverse -91 -109 3.3624 0.299
NP_442489.1_7 Forward -322 -313 20.1576 0.000695
NP_442489.1_7 Reverse -313 -322 20.1576 0.000695
NP_442489.1_7 Forward -391 -382 7.47288 0.0613
NP_442489.1_7 Reverse -382 -391 0.688044 0.152
NP_442489.1_7 Forward -207 -198 -1.6719 0.235
NP_440559.1_1 Forward -321 -312 17.4043 0.00658
NP_440559.1_1 Reverse -314 -323 17.4043 0.00658
NP_440559.1_1 Reverse -383 -392 4.62128 0.24
NP_441659.2_8 Forward -322 -312 18.1713 0.00133
NP_441659.2_8 Reverse -313 -323 18.1713 0.00133
NP_442008.1_2 Reverse -310 -329 7.7676 0.206
NP_442346.1_5 Forward -323 -313 16.6963 0.00248
NP_442346.1_5 Reverse -312 -322 16.6963 0.00248
NP_442346.1_5 Reverse -381 -391 4.20827 0.296
NP_440545.1_3 Reverse -309 -326 11.0519 0.028
NP_440025.1_1 Reverse -309 -328 12.8808 0.147
NP_441126.1_6 Reverse -277 -291 16.3178 0.248
NP_440459.1_2 Forward -146 -129 13.7068 0.126
NP_441653.1_2 Reverse -302 -321 4.39932 0.258
NP_440010.1_4 Reverse -309 -328 2.45694 0.225
NP_442900.1_2 Forward -400 -381 2.75272 0.285
NP_440847.1_3 Reverse -41 -55 14.3553 0.202
NP_442603.1_7 Reverse -313 -327 17.5018 0.0211
NP_442603.1_7 Reverse -382 -396 7.17714 0.211
NP_441888.1_7 Forward -327 -313 3.53951 0.225
NP_441502.1_2 Reverse -273 -292 16.9512 0.244
NP_441833.1_4 Forward -321 -314 15.9687 0.0124
NP_441833.1_4 Reverse -314 -321 15.9687 0.0124
NP_442162.1_9 Forward -321 -314 16.2637 0.0124
NP_442162.1_9 Reverse -314 -321 16.2637 0.0124
NP_442162.1_9 Reverse -136 -143 9.28223 0.0694
NP_440671.1_4 Forward -328 -314 12.3893 0.11
NP_440671.1_4 Reverse -129 -143 8.16106 0.202
NP_440671.1_4 Reverse -307 -321 7.47274 0.217
NP_440224.1_1 Reverse -371 -390 0.687771 0.132
NP_441973.1_1 Forward -202 -187 -0.0201027 0.253
NP_442140.1_3 Forward -321 -311 12.2714 0.0632
NP_442140.1_3 Reverse -320 -330 7.74818 0.13
NP_442140.1_3 Reverse -314 -324 4.40493 0.243
NP_441671.1_1 Reverse -223 -242 11.0125 0.176
NP_441813.1_5 Forward -324 -314 15.9097 0.01
NP_441813.1_5 Reverse -311 -321 8.63316 0.0367
NP_440590.1_4 Reverse -314 -327 -2.93064 0.251
NP_440590.1_4 Forward -321 -308 -5.97891 0.296
NP_440567.1_1 Reverse -314 -328 11.2093 0.0294
NP_442497.1_10 Forward -321 -312 10.4228 0.0087
NP_442497.1_10 Reverse -314 -323 10.4228 0.0087
NP_440821.1_4 Forward -324 -314 18.2696 0.00448
NP_440821.1_4 Reverse -311 -321 9.41981 0.0286
NP_441239.1_9 Reverse -126 -138 4.46387 0.253
NP_441239.1_9 Forward -324 -312 4.36554 0.253
NP_441239.1_9 Forward -110 -98 3.77555 0.276
NP_441239.1_9 Reverse -311 -323 3.38223 0.285
NP_441009.1_4 Reverse -313 -332 14.4541 0.167
NP_441727.1_3 Reverse -306 -325 3.93269 0.275
NP_441727.1_3 Forward -329 -310 3.14605 0.292
NP_441892.1_1 Forward -331 -314 -2.02611 0.217
NP_441892.1_2 Forward -124 -105 -0.787193 0.16
NP_442669.1_1 Reverse -159 -178 8.84924 0.0427
NP_442669.1_1 Forward -284 -265 6.09597 0.0884
NP_440604.1_6 Reverse -313 -332 8.94757 0.0797
NP_442193.1_1 Forward -132 -114 7.09898 0.298
NP_441698.1_2 Forward -288 -269 19.0367 0.137
NP_442216.1_4 Reverse -42 -50 8.08217 0.255
NP_441936.1_3 Reverse -114 -133 15.4366 0.124
NP_440546.1_4 Forward -322 -312 10.046 0.109
NP_440546.1_4 Reverse -313 -323 10.046 0.109
NP_440462.1_6 Forward -324 -314 7.74818 0.0699
NP_440462.1_6 Reverse -311 -321 1.35667 0.294
NP_442340.1_3 Reverse -95 -114 -10.227 0.284
NP_442611.1_1 Forward -137 -118 -0.197208 0.266
NP_440868.1_4 Reverse -309 -321 12.9203 0.0231
NP_440868.1_4 Forward -326 -314 6.1355 0.0878
NP_440868.1_8 Reverse -309 -328 -5.70374 0.293
NP_441497.1_3 Reverse -49 -68 -11.1119 0.294
NP_441474.1_1 Reverse -129 -148 -0.689632 0.255
NP_442402.1_4 Forward -318 -299 3.73524 0.149
NP_442402.1_4 Forward -330 -311 -4.03287 0.22
NP_442402.1_10 Reverse -44 -54 12.3692 0.212
NP_442402.1_10 Forward -289 -279 11.2876 0.264
NP_442402.1_10 Reverse -43 -53 10.206 0.299
NP_439948.1_1 Forward -82 -65 16.9967 0.249
NP_440653.1_10 Forward -143 -124 1.76941 0.299
NP_442039.1_4 Forward -321 -314 15.1821 0.0124
NP_442039.1_4 Reverse -314 -321 15.1821 0.0124
NP_441811.1_1 Reverse -40 -59 20.5506 0.109
NP_441811.1_1 Forward -117 -98 5.30933 0.28
NP_441811.1_8 Forward -397 -383 13.6676 0.178
NP_440825.1_7 Forward -321 -311 12.9096 0.152
NP_440825.1_7 Forward -277 -267 12.0313 0.195
NP_442696.1_6 Reverse -36 -55 -12.7836 0.253
NP_442837.1_3 Forward -321 -314 15.7721 0.0124
NP_442837.1_3 Reverse -314 -321 15.7721 0.0124
NP_442837.1_3 Forward -390 -383 9.87221 0.106
NP_440160.1_9 Reverse -92 -111 10.1275 0.235
NP_442053.1_1 Forward -322 -313 18.3876 0.0007
NP_442053.1_1 Reverse -313 -322 18.3876 0.0007
NP_442053.1_1 Forward -391 -382 6.5879 0.124
NP_440505.1_3 Forward -324 -314 16.303 0.00696
NP_440505.1_3 Reverse -311 -321 9.22315 0.122
NP_441203.1_1 Reverse -314 -333 -1.18052 0.0636
NP_441203.1_1 Forward -390 -371 -12.0953 0.143
NP_440914.1_1 Forward -322 -312 17.5935 0.000537
NP_440914.1_1 Reverse -313 -323 17.5935 0.000537
NP_440914.1_1 Reverse -382 -392 6.07773 0.297
NP_441011.1_8 Forward -321 -312 8.25953 0.144
NP_441011.1_8 Reverse -314 -323 8.25953 0.144
NP_442533.1_6 Forward -322 -313 17.2076 0.00137
NP_442533.1_6 Reverse -313 -322 17.2076 0.00137
NP_442533.1_6 Reverse -382 -391 4.91628 0.165
NP_442322.1_4 Reverse -120 -137 -8.31994 0.286
NP_442322.1_4 Forward -116 -99 -10.1882 0.298
NP_441482.1_7 Forward -328 -314 8.16106 0.0189
NP_441482.1_7 Reverse -307 -321 -1.18038 0.0637
NP_439944.1_9 Reverse -314 -324 19.0562 0.00329
NP_439944.1_9 Forward -321 -311 10.5014 0.0887
NP_442203.1_3 Forward -348 -329 8.04414 0.257
NP_441697.1_5 Reverse -275 -294 -8.64244 0.265
NP_441697.1_5 Forward -292 -273 -9.59736 0.271
NP_441028.1_6 Forward -308 -298 6.76441 0.23
NP_441028.1_6 Forward -63 -53 3.42118 0.296
NP_440116.1_5 Reverse -310 -327 17.1484 0.0499
NP_441527.1_4 Reverse -272 -291 -4.82277 0.189
NP_440115.1_6 Forward -325 -315 9.41981 0.115
NP_440115.1_6 Reverse -310 -320 9.32148 0.115
NP_440115.1_6 Forward -147 -137 6.76487 0.167
NP_440007.1_9 Forward -326 -312 10.0294 0.163
NP_439965.1_1 Forward -331 -312 -7.17871 0.222
NP_441972.1_5 Forward -333 -314 -6.49039 0.231
NP_441106.1_1 Forward -323 -314 9.63616 0.0311
NP_441106.1_1 Reverse -312 -321 9.63616 0.0311
NP_441106.1_1 Forward -138 -129 2.55633 0.28
NP_439903.1_6 Reverse -310 -329 0.195343 0.268
NP_439903.1_6 Forward -325 -306 -1.37794 0.299
NP_442588.1_6 Forward -319 -300 -1.86883 0.28
NP_442306.1_10 Forward -212 -193 -20.7484 0.226
NP_441286.1_1 Reverse -312 -324 21.3768 0.00196
NP_441286.1_1 Forward -323 -311 12.9203 0.00815
NP_441286.1_1 Reverse -381 -393 2.49725 0.06
NP_441286.1_1 Forward -392 -380 1.7106 0.0803
NP_442674.1_2 Forward -220 -201 11.7992 0.208
NP_442674.1_3 Forward -330 -311 7.37347 0.219
NP_440670.1_8 Forward -322 -313 18.3876 0.000699
NP_440670.1_8 Reverse -313 -322 18.3876 0.000699
NP_442683.1_1 Reverse -17 -35 20.807 0.0994
NP_440886.1_7 Forward -323 -313 7.94438 0.0805
NP_440886.1_7 Reverse -312 -322 7.94438 0.0805
NP_440197.1_4 Forward -32 -14 19.079 0.297
NP_442072.1_9 Forward -323 -305 -22.2037 0.225
NP_442022.1_4 Forward -52 -33 5.99764 0.273
NP_440907.2_8 Forward -321 -311 7.64939 0.117
NP_440907.2_8 Reverse -136 -146 4.99446 0.228
NP_442264.1_2 Forward -395 -378 5.9387 0.267
NP_441463.1_2 Forward -277 -259 12.1922 0.138
NP_441463.1_3 Forward -332 -313 -8.45701 0.27
NP_441463.1_6 Forward -324 -310 11.151 0.224
NP_441463.1_6 Reverse -311 -325 7.86544 0.25
NP_441626.1_2 Forward -321 -314 15.7721 0.0124
NP_441626.1_2 Reverse -314 -321 15.7721 0.0124
NP_442365.1_7 Forward -326 -307 -1.96717 0.198
NP_442238.1_7 Forward -292 -273 6.98015 0.257
NP_440107.1_5 Reverse -312 -331 -0.000545616 0.178
NP_442794.1_1 Forward -326 -314 19.7052 0.00523
NP_442794.1_1 Reverse -309 -321 12.232 0.0721
NP_441401.1_1 Reverse -197 -216 11.2092 0.216
NP_442615.1_1 Forward -400 -382 -1.25915 0.127
NP_442615.1_1 Reverse -304 -322 -1.65248 0.131
NP_442615.1_1 Forward -331 -313 -6.76569 0.26
NP_441962.1_4 Forward -327 -308 -11.6036 0.243
NP_441962.1_4 Reverse -308 -327 -14.4552 0.288
NP_441962.1_5 Forward -113 -94 16.7157 0.124
NP_440387.1_1 Reverse -313 -329 13.3332 0.00865
NP_440387.1_1 Forward -322 -306 11.6616 0.0157
NP_441510.2_7 Forward -328 -314 10.3237 0.28
NP_441500.1_2 Forward -189 -170 18.4857 0.188
NP_441720.1_2 Forward -43 -24 5.2102 0.217
NP_440766.1_4 Forward -326 -312 7.9644 0.0871
NP_440422.1_10 Forward -281 -262 18.4397 0.0998
NP_441237.1_9 Forward -321 -311 14.828 0.0242
NP_442743.1_1 Forward -111 -92 9.14342 0.262
NP_442930.1_1 Reverse -337 -347 10.1076 0.278
NP_442930.1_1 Reverse -147 -157 9.41933 0.287
NP_439910.1_2 Reverse -305 -322 -13.7275 0.162
NP_439910.1_2 Reverse -374 -391 -22.6756 0.285
NP_440457.1_1 Forward -326 -314 8.29878 0.101
NP_440457.1_1 Forward -148 -136 0.727295 0.25
NP_440798.1_6 Forward -321 -308 2.96921 0.158
NP_440798.1_6 Forward -143 -130 2.37923 0.177
NP_440942.1_3 Forward -57 -38 5.89931 0.273
NP_442509.1_9 Reverse -197 -207 8.92768 0.192
NP_442509.1_9 Forward -322 -312 8.14104 0.192
NP_442509.1_9 Reverse -313 -323 8.14104 0.192
NP_441489.1_3 Reverse -276 -290 7.84196 0.244
NP_441489.1_3 Reverse -297 -311 7.45999 0.266
NP_441489.1_3 Forward -177 -163 6.98253 0.287
NP_441253.1_8 Reverse -308 -322 15.6928 0.122
NP_442514.1_5 Forward -330 -311 -7.6711 0.279
NP_440554.1_4 Reverse -314 -324 7.05986 0.106
NP_442737.1_9 Forward -321 -302 16.4369 0.211
NP_441885.1_5 Forward -322 -312 20.9245 0.000538
NP_441885.1_5 Reverse -313 -323 20.9245 0.000538
NP_441885.1_5 Reverse -382 -392 2.04498 0.0868
NP_441885.1_5 Forward -391 -381 1.25834 0.11
NP_440420.1_4 Reverse -84 -103 16.2705 0.298
NP_440478.1_4 Reverse -309 -328 11.8975 0.239
NP_442341.1_7 Reverse -312 -326 16.1259 0.0186
NP_442341.1_7 Forward -323 -309 6.3911 0.127
NP_442341.1_7 Reverse -381 -395 5.40779 0.157
NP_442341.1_9 Reverse -311 -325 10.5204 0.133
NP_442341.1_9 Forward -324 -310 9.14375 0.156
NP_441173.1_9 Reverse -45 -53 10.1471 0.261
NP_442395.2_4 Reverse -312 -331 2.06362 0.227
NP_443000.1_7 Forward -324 -314 17.0896 0.00865
NP_443000.1_7 Reverse -311 -321 10.3048 0.0345
NP_443000.1_7 Reverse -380 -390 4.50326 0.188
NP_440507.2_3 Forward -331 -312 13.3716 0.145
NP_441842.1_10 Forward -329 -315 8.35772 0.225
NP_440275.1_3 Forward -324 -314 8.1415 0.0602
NP_440275.1_3 Reverse -311 -321 8.04317 0.0602
NP_440091.1_1 Reverse -378 -390 3.67722 0.15
NP_440091.1_1 Forward -326 -314 -0.452677 0.273
NP_440091.1_1 Reverse -309 -321 -0.452677 0.273
NP_442354.1_7 Forward -325 -306 18.6823 0.0465
NP_441902.1_3 Forward -150 -140 15.7027 0.201
NP_440679.1_10 Reverse -315 -334 -18.1918 0.278
NP_440127.1_5 Forward -191 -173 13.1955 0.222
NP_441389.1_5 Reverse -300 -319 9.83255 0.286
NP_440149.1_8 Reverse -313 -332 6.4893 0.0662
NP_441105.1_3 Reverse -124 -143 -0.0988766 0.132
NP_441105.1_3 Reverse -308 -327 -0.39387 0.136
NP_441105.1_3 Forward -333 -314 -3.14714 0.173
NP_440216.1_1 Forward -322 -308 -2.45868 0.0513
NP_440216.1_1 Reverse -313 -327 -10.4235 0.145
NP_440216.1_1 Forward -391 -377 -11.4068 0.184
NP_440216.1_9 Forward -242 -233 7.57121 0.286
NP_440172.1_1 Forward -322 -312 15.0247 0.00945
NP_440172.1_1 Reverse -313 -323 15.0247 0.00945
NP_440172.1_1 Reverse -135 -145 2.7333 0.268
NP_440172.1_1 Reverse -382 -392 2.43831 0.279
NP_440172.1_1 Forward -207 -197 1.94665 0.29
NP_442418.1_4 Forward -294 -276 11.652 0.259
NP_442015.1_10 Forward -326 -313 18.8988 0.00492
NP_442015.1_10 Reverse -309 -322 10.1474 0.0402
NP_442015.1_10 Reverse -131 -144 0.412608 0.227
NP_441226.1_7 Forward -321 -314 14.4934 0.0123
NP_441226.1_7 Reverse -314 -321 14.4934 0.0123
NP_441757.1_2 Reverse -40 -58 7.19731 0.288
NP_441111.1_7 Forward -321 -313 18.7023 0.00294
NP_441111.1_7 Reverse -314 -322 18.7023 0.00294
NP_442379.1_10 Forward -329 -312 -3.69774 0.265
NP_441766.1_2 Forward -322 -313 17.5026 0.00297
NP_441766.1_2 Reverse -313 -322 17.5026 0.00297
NP_441766.1_2 Reverse -135 -144 3.24465 0.227
NP_442417.1_5 Reverse -313 -327 11.8976 0.0981
NP_440416.1_9 Forward -329 -310 3.34271 0.0375
NP_440416.1_9 Reverse -128 -147 -16.6185 0.218
NP_443052.1_8 Reverse -372 -391 -9.44032 0.19
NP_443052.1_9 Reverse -82 -101 -5.99873 0.276
NP_442116.1_6 Forward -292 -275 7.50051 0.254
NP_442116.1_6 Forward -290 -273 5.68616 0.291
NP_442154.1_1 Forward -131 -113 -9.12563 0.175
NP_440261.1_5 Forward -321 -308 -10.5021 0.201
NP_440261.1_5 Reverse -314 -327 -10.5021 0.201
NP_440261.1_7 Forward -59 -40 -3.54046 0.19
NP_440988.1_10 Forward -324 -310 15.7419 0.112
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

TTTATTTGTGTTGATCGCCATTTGACTTCCAACAACCAAAATCAGATAAGGGTGGTAATTATTTAATTGATTCACCATGGCGATCGCCAAGTTTTTTTCCCATAAGAGATAATTTTTCAGAATTTGTTTGCAGAGTTTTATTCTGTCCTCTAAAACGACCCACGGAAGCTCGGGCAATACTAGGTAAATTTCAGGCGGTTTCCCCTTAACGTTGAGGAGGGGACTTTTCAAACAAACTTTAGAGTGAAAATTGAGGAGCAATCGGAGAGGGCATTAGGGCTGTGGAGGCTCCCACCCTGGCCAATGGTAGAATAGAGGCTGTTTTGAGCCCTGTTATCTGTTCCCCTTGGGGGGAATTGGAGCCCAACTCAAACCTTTCAAACTGCCTTGGAGTAATTGC

CDS

ATGACTGACTCGCCCGATCGCCTGATTGCGACTGACCTCAGAAACGAAATGTCACAGTCATACCTGGAATATGCCATGAGTGTGATTGTTGGGCGGGCGTTACCCGATGCACGGGATGGGTTGAAGCCAGTCCATCGGCGCATTCTCTATGCCATGTACGAGCTGGGGCTGACCCCCGATCGCCCCTTTCGGAAATGTGCCCGGGTGGTGGGGGAAGTGCTGGGGAAATATCATCCCCACGGTGATACGGCGGTGTACGATGCCTTGGTGCGCATGGCCCAGGACTTTTCCATGCGGGAACCGCTTATTGACGGCCACGGGAACTTTGGCTCCGTGGATAATGATCCCCCGGCGGCGATGCGGTACACGGAATCTCGCCTTAGACCCCTTTCCACCAACTCGTTATTGCGGGACATTGAGGCGGAAACCGTAGATTTCATTGATAACTTTGACGGTTCCCAACAGGAACCCACCGTTCTCCCGGCCCGCATTCCCCAACTATTGATTAACGGTTCCTCCGGCATTGCCGTGGGCATGGCCACCAATATCCCCCCCCATAACCTCGGGGAAGTGATCGACGGAGCGATCGCCTTAATTCGTAACCCCGAAATCACCGAACAGGAATTAATGCAGATTATTCCCGGCCCGGACTTTCCCACCGGGGCCCAGATCCTCGGGCGATCGGGCATTCGGGAAGCCTATTTAACCGGCCGGGGCTCCATCACCATGCGGGGGGTGGCCTCCATTGAAACCATGGAACATCCTGGGCGGCCTGACCGGGATGCCATTATCGTCACCGAGCTACCCTACCAAACCAATAAAGCCGCTTTAATTGAACGCATTGCGGATCTGGTTAACGATAAAAAAATTGACGGCATTGCCGACATCCGGGACGAGAGCGATCGAGATGGTATGCGCATTGTCATTGAACTGAAGCGGGATGCCTACGCTCGGGTGGTGCTCAATAATCTTTACAAACAAACTCCCATCCAGAGTAACTTTGGGGCGAATTTGTTGGCGCTGGTTAACGGCACTCCTGAAGTTCTCACCATTAAAAAATTCCTCACTGTCTTTTGGGAATTTCGCATTGAAACCATTACCCGCCGTACCCGCTACGAATTGCGGAAAGCGGAAGAACGGGATCATCTGCTCCAGGGATTGTTGATTGCGCTGGATAACCTGGATGCGGTCATTCGTCTGATTCGGGGAGCGGCGGACACGGCCTCTGCCAAAACGGAACTGGTGGAAGGCTTTTCCCTCTCCGAAGTGCAGGCCGATGCCATTTTGCAAATGCAACTGCGCCGGTTAACGGCTTTGGAAGCGGATAAAATCACCGCTGAACATGATGAACTGCAAACCAAAATCGCCGATTTCCAAGATATTTTGGCCCGCCGGGAAAGGGTTAATGCCATCATCGAAGAAGAATTGGAGCAAATTAAGGCTATTCACGCCACTCCCCGCCGCACCGTCATTGTCCAAGAAGATGGGGAATTAATTGACACGGATTTAATTGCCAATGACCAAGCCCTAATTTTATTGACGGAACAGGGTTACATCAAACGGATGCCCGCCAGCACCTTTGGTACCCAAAACCGTGCCACCAGAGGTAAAGCCGCCGCCAAGATTAAAGATGACGATGGAGTGGAGCATTTCCTTTCCTGCTGTGACCACGATAAAGTGCTGTTCTTTAGCGATCGGGGGGTGGTCTATAGCCTCAACGCTTACCAAATTCCCATTGCTTCCCGCACGGCCCGGGGGGTGCCCATTGTGCAGATGTTGCCCATCCCCAAGGATGAAAAAATTACCTCCCTAGTGTCTGTTTCAGAATTTGACGATGATACCTATTTCATCATGCTGACCAAACAGGGCTACATCAAAAAAACTGCCCTCTCGGCTTTTAGTAATATCCGGGCCAATGGGTTAATCGCCATTTCCTTGGTGGAAGGGGATCAATTGCGTTGGGTTCGTTTAGCCAAAGCGGAAGATAGCGTCATTATCGGTTCCCAAAAGGGTATGGCTATCCATTTCAAAGCGGATCAGGATGAACTGCGGGCCCTCGGTCGGGCCACCAGGGGGGTTAAATCCATGCGGCTCCGGTCTGGGGATGCGCTGATCAGTATGGATATTTTGCCGAGCCAGGTGGTGGCCAATATTGCCGTTGGTTCCGAAGATGAGCCGGATGAGGACTTAGGGGGCGATACCGATGCCATTTTGGAAGAAAGCGACAATCCTGGCCCCTGGTTGCTGGGGGTAACCATGAAGGGTTTCGGCAAACGGGTGCCCATTGGTCAATTCCGCTTGCAACATCGGGCCGGCCTGGGAGTGAAAGCGATCCGCTTTAAATCCAAAGATGACCAGCTAGTGGCCCTCCATGTGGTCAACGCCGATGACGAGTTGATGATTGTCACCAACCGGGGCATTATTATCCGCCAGTCCGTGAACGATATTTCCCCCCAATCCCGTAGTGCCACTGGGGTGCGGGTACAAAGGTTAGATGCCGATGATGCGATCGCCGCTGTGGCCCTAGTGCCTCCTTCTGGGGAAGAAGAATTGGCAGAAATGTCGGAAAGCGAAGAGAGCTGA

Protein

MTDSPDRLIATDLRNEMSQSYLEYAMSVIVGRALPDARDGLKPVHRRILYAMYELGLTPDRPFRKCARVVGEVLGKYHPHGDTAVYDALVRMAQDFSMREPLIDGHGNFGSVDNDPPAAMRYTESRLRPLSTNSLLRDIEAETVDFIDNFDGSQQEPTVLPARIPQLLINGSSGIAVGMATNIPPHNLGEVIDGAIALIRNPEITEQELMQIIPGPDFPTGAQILGRSGIREAYLTGRGSITMRGVASIETMEHPGRPDRDAIIVTELPYQTNKAALIERIADLVNDKKIDGIADIRDESDRDGMRIVIELKRDAYARVVLNNLYKQTPIQSNFGANLLALVNGTPEVLTIKKFLTVFWEFRIETITRRTRYELRKAEERDHLLQGLLIALDNLDAVIRLIRGAADTASAKTELVEGFSLSEVQADAILQMQLRRLTALEADKITAEHDELQTKIADFQDILARRERVNAIIEEELEQIKAIHATPRRTVIVQEDGELIDTDLIANDQALILLTEQGYIKRMPASTFGTQNRATRGKAAAKIKDDDGVEHFLSCCDHDKVLFFSDRGVVYSLNAYQIPIASRTARGVPIVQMLPIPKDEKITSLVSVSEFDDDTYFIMLTKQGYIKKTALSAFSNIRANGLIAISLVEGDQLRWVRLAKAEDSVIIGSQKGMAIHFKADQDELRALGRATRGVKSMRLRSGDALISMDILPSQVVANIAVGSEDEPDEDLGGDTDAILEESDNPGPWLLGVTMKGFGKRVPIGQFRLQHRAGLGVKAIRFKSKDDQLVALHVVNADDELMIVTNRGIIIRQSVNDISPQSRSATGVRVQRLDADDAIAAVALVPPSGEEELAEMSESEES