Your browser is old and dusty. Try Google Chrome!

Details for slr0020

ORF slr0020
Accession NP_442137.1
Symbol recG
Category DNA recombinase
Definition DNA replication, restriction, modification, recombination, and repair
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_441418.1_6 Reverse -241 -260 -1.08219 0.012
NP_441418.1_6 Forward -239 -220 -30.5815 0.286
NP_441453.1_1 Forward -257 -239 3.26332 0.273
NP_441623.1_1 Forward -257 -239 -4.30741 0.274
NP_441818.1_1 Forward -249 -238 10.1862 0.232
NP_442623.1_3 Forward -219 -200 -18.1918 0.263
NP_441816.1_6 Reverse -75 -87 15.7719 0.23
NP_442655.1_10 Reverse -247 -266 -2.75381 0.19
NP_442655.1_10 Reverse -232 -251 -13.4719 0.266
NP_443002.1_5 Reverse -206 -224 11.3264 0.247
NP_442752.1_4 Reverse -241 -248 13.5105 0.0314
NP_442975.1_10 Reverse -8 -22 6.39049 0.178
NP_442975.1_10 Forward -254 -240 1.86729 0.29
NP_442909.1_2 Reverse -15 -34 10.7175 0.255
NP_442909.1_7 Forward -145 -131 6.68548 0.242
NP_440061.1_9 Forward -47 -33 11.9953 0.103
NP_440110.1_8 Reverse -239 -258 3.14605 0.211
NP_442062.1_8 Reverse -241 -251 7.25653 0.104
NP_441859.1_3 Reverse -240 -259 2.9486 0.253
NP_442602.1_3 Forward -358 -339 0.687771 0.197
NP_441352.1_2 Reverse -246 -265 0.982764 0.261
NP_441925.1_4 Reverse -201 -220 -14.0626 0.261
NP_440856.1_7 Reverse -241 -260 -7.08038 0.246
NP_441083.1_5 Forward -250 -240 8.4365 0.0363
NP_442827.1_8 Forward -258 -239 5.01354 0.127
NP_441434.1_1 Forward -174 -160 11.1842 0.233
NP_441571.1_8 Reverse -331 -350 -2.95047 0.275
NP_441738.1_2 Reverse -265 -272 9.77352 0.143
NP_441558.1_5 Reverse -34 -53 6.88262 0.2
NP_441955.1_1 Reverse -227 -246 13.4708 0.173
NP_440209.1_1 Forward -250 -242 5.13263 0.17
NP_440209.1_1 Forward -233 -225 2.08437 0.286
NP_440178.1_7 Forward -251 -232 -13.9635 0.147
NP_441716.1_2 Reverse -166 -185 -2.00377 0.293
NP_442111.1_4 Reverse -240 -254 9.43936 0.0609
NP_442111.1_4 Forward -378 -364 7.27608 0.101
NP_441163.1_1 Reverse -255 -272 4.16803 0.291
NP_441163.1_1 Reverse -216 -233 3.97136 0.297
NP_441495.1_2 Reverse -238 -257 11.6025 0.245
NP_441387.1_8 Forward -175 -156 20.1006 0.175
NP_440747.1_10 Reverse -238 -250 -12.0557 0.199
NP_441486.1_1 Reverse -134 -148 -5.21195 0.226
NP_441486.1_1 Forward -48 -34 -6.39192 0.294
NP_442330.1_4 Forward -145 -126 12.7015 0.286
NP_441667.1_1 Reverse -159 -174 14.1116 0.284
NP_441014.1_8 Reverse -29 -48 -3.63879 0.242
NP_441012.1_4 Reverse -38 -51 6.4108 0.279
NP_441634.1_8 Forward -210 -196 -0.787057 0.268
NP_440376.1_1 Forward -51 -42 1.96635 0.236
NP_440376.1_1 Reverse -241 -250 0.196389 0.283
NP_440376.1_1 Forward -250 -241 -0.0986038 0.285
NP_441588.1_4 Forward -248 -238 6.07655 0.214
NP_442687.1_7 Forward -286 -276 4.79825 0.234
NP_442687.1_7 Forward -273 -263 4.60159 0.243
NP_442485.1_3 Forward -219 -200 4.42435 0.179
NP_441846.1_10 Forward -286 -267 -20.945 0.256
NP_441846.1_10 Forward -285 -266 -22.5183 0.261
NP_441013.1_2 Reverse -271 -289 -4.30741 0.298
NP_440533.1_9 Reverse -224 -243 8.25926 0.168
NP_441950.1_7 Forward -161 -142 -2.65548 0.201
NP_441763.1_10 Reverse -37 -56 5.40686 0.288
NP_442782.1_2 Forward -285 -271 4.71948 0.25
NP_442937.1_5 Forward -255 -236 9.53756 0.187
NP_442937.1_5 Reverse -233 -252 9.3409 0.196
NP_442690.1_1 Forward -178 -159 -16.6185 0.29
NP_442911.1_2 Reverse -231 -250 -5.21209 0.153
NP_442911.1_2 Forward -260 -241 -10.3253 0.276
NP_441580.1_6 Forward -261 -242 -7.08038 0.236
NP_440153.1_5 Forward -226 -212 0.88457 0.288
NP_440153.1_8 Reverse -36 -49 6.70579 0.17
NP_440200.1_4 Reverse -76 -95 16.5191 0.199
NP_443055.1_6 Forward -258 -240 -2.43985 0.295
NP_440138.1_7 Reverse -49 -67 16.4266 0.278
NP_441099.1_5 Forward -260 -241 3.93269 0.0511
NP_441099.1_5 Reverse -231 -250 -11.5053 0.283
NP_442002.1_1 Forward -210 -192 -8.43732 0.269
NP_442002.1_9 Forward -273 -266 13.9038 0.141
NP_442002.1_9 Forward -286 -279 12.2322 0.185
NP_440411.1_10 Reverse -71 -90 17.3859 0.186
NP_441646.1_1 Forward -257 -238 -0.0988766 0.259
NP_441646.1_1 Reverse -35 -54 -1.67217 0.293
NP_442771.1_1 Forward -274 -256 -6.96235 0.169
NP_442771.1_1 Reverse -261 -279 -8.14232 0.182
NP_442771.1_1 Reverse -239 -257 -10.4039 0.258
NP_440147.1_4 Forward -252 -239 -0.0790467 0.271
NP_441550.1_8 Reverse -239 -249 4.99446 0.274
NP_440206.1_4 Reverse -37 -56 -0.591301 0.29
NP_441041.1_1 Reverse -244 -263 10.4225 0.211
NP_442004.1_6 Reverse -108 -122 1.17956 0.296
NP_440703.1_9 Reverse -36 -49 9.5568 0.216
NP_439966.1_7 Forward -252 -242 5.68278 0.214
NP_440289.1_2 Forward -386 -373 -1.06236 0.221
NP_440289.1_2 Reverse -27 -40 -3.81562 0.271
NP_440983.1_5 Reverse -205 -224 -5.01543 0.261
NP_441514.1_1 Reverse -156 -166 13.4856 0.284
NP_442281.1_1 Reverse -37 -51 1.67063 0.293
NP_442847.1_3 Forward -49 -30 6.09517 0.24
NP_441087.1_6 Reverse -268 -286 -1.55487 0.269
NP_441860.1_1 Reverse -287 -301 14.9676 0.277
NP_441644.1_6 Forward -220 -210 6.27276 0.163
NP_441644.1_6 Reverse -205 -215 5.48612 0.188
NP_441644.1_6 Forward -250 -240 5.19112 0.204
NP_441644.1_6 Reverse -381 -391 3.32285 0.288
NP_440780.1_1 Reverse -117 -136 8.54611 0.274
NP_442933.1_1 Forward -179 -160 9.31004 0.253
NP_442933.1_10 Forward -250 -241 5.40793 0.19
NP_442933.1_10 Reverse -241 -250 4.32629 0.257
NP_441751.2_8 Forward -249 -235 -1.8687 0.132
NP_442554.1_8 Reverse -37 -47 3.71661 0.215
NP_441762.1_7 Reverse -240 -252 -7.13918 0.285
NP_442313.1_4 Forward -292 -273 7.66927 0.286
NP_440421.1_1 Forward -76 -62 16.1259 0.177
NP_441711.1_4 Forward -259 -240 8.55425 0.144
NP_443009.1_5 Reverse -240 -251 4.97473 0.222
NP_442301.1_2 Forward -260 -241 10.815 0.183
NP_441198.1_10 Reverse -217 -236 16.7157 0.268
NP_440464.1_10 Reverse -112 -122 11.7668 0.282
NP_441020.2_6 Reverse -239 -256 9.87194 0.159
NP_441015.1_10 Forward -219 -200 7.17762 0.0996
NP_441015.1_10 Reverse -236 -255 -5.40875 0.223
NP_441015.1_10 Reverse -31 -50 -6.1954 0.243
NP_441015.1_10 Forward -50 -31 -11.4069 0.296
NP_441673.1_1 Forward -250 -241 1.27803 0.155
NP_441673.1_1 Reverse -241 -250 1.27803 0.155
NP_442253.1_5 Reverse -33 -50 8.20031 0.141
NP_441826.1_2 Reverse -205 -219 -3.44199 0.285
NP_441056.1_1 Forward -51 -32 -8.16202 0.282
NP_441612.1_2 Forward -21 -11 7.29072 0.256
NP_442227.1_2 Reverse -195 -214 -0.197208 0.253
NP_442227.1_2 Forward -257 -238 -1.96717 0.269
NP_442808.1_1 Forward -251 -241 7.64939 0.0729
NP_442808.1_1 Reverse -198 -208 5.09279 0.173
NP_440918.1_2 Forward -47 -28 16.2241 0.233
NP_440869.1_5 Forward -73 -54 10.8159 0.234
NP_441849.1_2 Forward -184 -165 7.78217 0.226
NP_442542.1_2 Forward -385 -372 4.64084 0.299
NP_442050.1_1 Forward -286 -267 8.55425 0.25
NP_442342.1_9 Reverse -190 -206 11.3666 0.12
NP_440558.1_2 Reverse -33 -52 10.4225 0.0976
NP_440558.1_2 Forward -77 -58 -7.17871 0.289
NP_442789.1_4 Reverse -239 -258 3.6377 0.162
NP_440274.1_1 Reverse -222 -241 17.994 0.24
NP_441518.1_3 Forward -260 -241 -12.7836 0.263
NP_441878.1_6 Forward -46 -36 -0.118297 0.167
NP_441557.1_4 Reverse -335 -349 10.226 0.291
NP_441557.1_5 Forward -250 -241 0.393051 0.166
NP_441557.1_5 Reverse -241 -250 0.393051 0.166
NP_441445.1_1 Forward -54 -35 0.786102 0.269
NP_441445.1_8 Reverse -123 -142 -12.3902 0.277
NP_441590.1_1 Forward -254 -235 24.0905 0.0205
NP_440738.1_5 Forward -90 -71 5.30933 0.246
NP_442830.1_5 Reverse -198 -212 5.60385 0.232
NP_442183.1_1 Reverse -241 -255 7.9644 0.127
NP_441574.1_1 Reverse -241 -260 5.40766 0.126
NP_441574.1_1 Forward -220 -201 3.53937 0.142
NP_441549.1_9 Reverse -259 -277 -11.0923 0.299
NP_442347.1_2 Forward -249 -240 5.89959 0.21
NP_442347.1_2 Reverse -242 -251 3.63797 0.284
NP_442645.1_2 Reverse -233 -252 -20.8467 0.289
NP_441037.1_4 Forward -274 -264 7.31769 0.237
NP_441633.1_3 Forward -392 -379 -0.0790467 0.138
NP_441633.1_3 Reverse -239 -252 -0.865694 0.15
NP_441633.1_3 Forward -252 -239 -6.07724 0.236
NP_442590.1_10 Forward -227 -208 4.22769 0.278
NP_442998.1_10 Forward -248 -241 5.84064 0.235
NP_440899.1_1 Forward -219 -200 6.84597 0.267
NP_440299.1_1 Reverse -207 -220 12.8017 0.0348
NP_441007.1_10 Reverse -245 -258 4.8375 0.182
NP_441007.1_10 Reverse -236 -249 2.67422 0.183
NP_442334.1_2 Reverse -33 -50 -7.13932 0.286
NP_441449.1_8 Reverse -216 -235 13.8886 0.285
NP_442333.2_5 Reverse -213 -232 -5.80207 0.214
NP_441559.1_8 Reverse -271 -285 -7.37523 0.291
NP_441866.1_3 Reverse -148 -161 12.999 0.188
NP_442150.1_8 Reverse -292 -311 15.8524 0.265
NP_440677.1_1 Forward -259 -240 9.83255 0.181
NP_442386.1_9 Reverse -198 -207 7.57079 0.219
NP_442386.1_9 Forward -89 -80 6.09583 0.23
NP_441750.1_7 Forward -202 -192 15.3197 0.254
NP_440168.1_9 Reverse -239 -258 -0.000545616 0.273
NP_440161.1_3 Reverse -209 -228 7.47261 0.299
NP_441160.1_5 Reverse -364 -383 -6.1954 0.288
NP_440586.1_1 Forward -162 -143 -5.80207 0.29
NP_442251.1_6 Forward -249 -242 10.4622 0.12
NP_442251.1_6 Reverse -225 -232 9.77388 0.162
NP_440027.1_3 Reverse -36 -54 1.78836 0.295
NP_440027.1_4 Forward -178 -159 1.32848 0.297
NP_439937.1_9 Reverse -262 -279 -15.6947 0.287
NP_439937.1_9 Forward -273 -256 -17.0714 0.291
NP_439943.1_1 Reverse -352 -371 -1.7705 0.202
NP_439943.1_4 Forward -292 -273 3.73603 0.29
NP_441181.1_6 Reverse -242 -260 17.0304 0.0833
NP_441789.1_7 Forward -267 -248 -3.73788 0.278
NP_440316.1_10 Forward -209 -199 5.38824 0.299
NP_441803.1_2 Forward -213 -194 -1.37718 0.298
NP_439977.1_5 Reverse -235 -254 -2.55715 0.284
NP_440262.1_7 Reverse -138 -157 10.8159 0.279
NP_441877.1_5 Forward -140 -121 -1.08219 0.283
NP_441877.1_7 Forward -255 -236 6.48849 0.218
NP_440163.1_10 Forward -211 -201 13.8447 0.112
NP_440163.1_10 Forward -205 -195 8.4365 0.274
NP_440344.1_10 Forward -257 -240 -3.50107 0.0833
NP_440344.1_10 Reverse -192 -209 -12.8425 0.267
NP_440531.1_6 Reverse -129 -148 11.0125 0.0601
NP_440531.1_6 Reverse -66 -85 -2.75381 0.258
NP_442917.1_1 Reverse -159 -178 10.3234 0.181
NP_442917.1_3 Reverse -257 -276 12.8808 0.102
NP_440826.1_5 Forward -286 -268 14.7053 0.233
NP_440297.1_9 Forward -50 -40 -0.511621 0.289
NP_442280.1_10 Reverse -273 -291 7.40243 0.268
NP_440700.1_1 Reverse -68 -87 15.7324 0.275
NP_440894.1_10 Forward -255 -236 3.44104 0.272
NP_440888.1_2 Reverse -241 -255 6.58715 0.228
NP_440491.1_1 Reverse -238 -257 10.328 0.191
NP_442277.1_7 Reverse -163 -179 -1.1391 0.266
NP_441543.1_2 Reverse -242 -251 6.78456 0.138
NP_441543.1_2 Forward -249 -240 4.0313 0.293
NP_442845.1_2 Forward -51 -37 11.5043 0.128
NP_442845.1_2 Forward -214 -200 8.55439 0.193
NP_442710.1_7 Forward -371 -352 -8.08773 0.299
NP_443064.1_6 Forward -250 -240 15.5726 0.0796
NP_442578.1_7 Forward -376 -369 9.38056 0.138
NP_441462.1_5 Forward -32 -13 5.40766 0.254
NP_441621.1_7 Forward -261 -247 -6.49025 0.295
NP_443062.1_1 Reverse -199 -217 8.64343 0.15
NP_443062.1_6 Reverse -123 -142 0.58944 0.292
NP_440504.1_7 Forward -51 -32 4.81767 0.175
NP_440516.1_8 Forward -285 -276 -0.196935 0.185
NP_440783.1_2 Reverse -188 -207 -4.52377 0.243
NP_441443.1_7 Reverse -247 -266 11.2092 0.0937
NP_441267.1_1 Forward -51 -32 1.37609 0.279
NP_442120.1_10 Forward -220 -201 -1.18052 0.167
NP_440673.1_2 Forward -150 -131 11.4627 0.176
NP_440673.1_2 Forward -156 -137 8.73121 0.263
NP_440077.1_4 Forward -274 -255 14.0608 0.223
NP_441052.1_2 Forward -250 -240 7.05986 0.0818
NP_441052.1_2 Reverse -241 -251 4.89658 0.14
NP_441052.1_2 Reverse -12 -22 3.02829 0.185
NP_441884.1_9 Reverse -238 -257 -14.0619 0.138
NP_441733.1_10 Reverse -238 -251 7.59077 0.153
NP_440746.1_1 Reverse -251 -270 18.9773 0.104
NP_441004.1_1 Forward -220 -201 0.491109 0.116
NP_441004.1_1 Forward -290 -271 -7.86702 0.2
NP_441004.1_1 Reverse -244 -263 -8.35868 0.2
NP_441004.1_1 Reverse -235 -254 -16.0285 0.281
NP_441004.1_1 Forward -291 -272 -17.7001 0.294
NP_441004.1_4 Forward -287 -277 8.33817 0.277
NP_442813.1_4 Forward -235 -216 -0.590531 0.23
NP_442873.1_3 Forward -260 -241 18.7798 0.0794
NP_442208.1_5 Forward -286 -267 -6.49039 0.266
NP_442515.1_1 Reverse -338 -352 -0.688726 0.231
NP_442515.1_1 Forward -351 -337 -4.03198 0.298
NP_441683.1_7 Forward -31 -12 -11.0136 0.284
NP_440593.1_3 Reverse -31 -50 -3.44213 0.235
NP_440593.1_3 Reverse -200 -219 -5.80207 0.266
NP_441046.1_2 Reverse -248 -267 13.6675 0.182
NP_441046.1_2 Forward -56 -37 4.22769 0.229
NP_441046.1_2 Reverse -230 -249 1.0811 0.261
NP_441409.1_6 Reverse -218 -237 -9.34199 0.182
NP_441409.1_6 Reverse -368 -387 -15.1435 0.28
NP_442843.1_1 Forward -135 -116 -12.0953 0.298
NP_442944.1_9 Reverse -202 -221 21.7306 0.0365
NP_440396.1_1 Reverse -69 -88 2.94938 0.156
NP_442450.1_5 Reverse -40 -50 5.38824 0.245
NP_439950.1_1 Reverse -298 -307 13.1761 0.277
NP_442006.1_2 Forward -208 -191 -15.7924 0.228
NP_442006.1_2 Forward -285 -268 -16.0874 0.238
NP_441570.1_1 Forward -233 -215 -16.8938 0.257
NP_441570.1_1 Reverse -224 -242 -17.8771 0.295
NP_441078.1_4 Forward -250 -241 0.29472 0.205
NP_441078.1_4 Reverse -241 -250 0.0980582 0.205
NP_442729.1_8 Forward -254 -241 14.5723 0.125
NP_441663.1_8 Reverse -270 -289 -2.36049 0.266
NP_442443.1_1 Reverse -254 -273 11.3075 0.0921
NP_440526.1_3 Forward -249 -238 1.43483 0.267
NP_442320.1_8 Reverse -235 -249 -3.44199 0.122
NP_442320.1_8 Forward -256 -242 -5.11362 0.206
NP_441732.1_2 Reverse -259 -275 -17.2477 0.247
NP_442815.1_2 Forward -219 -201 4.44404 0.243
NP_440760.1_1 Forward -250 -231 -13.7669 0.112
NP_441945.1_10 Reverse -243 -262 13.2741 0.195
NP_441057.1_4 Forward -83 -65 1.29745 0.253
NP_440713.1_4 Forward -37 -18 4.32602 0.231
NP_442489.1_7 Forward -250 -241 7.57121 0.057
NP_442489.1_7 Reverse -241 -250 0.589713 0.17
NP_440386.1_6 Reverse -11 -30 11.6017 0.0996
NP_441040.1_2 Reverse -267 -286 -14.3569 0.285
NP_442849.1_1 Forward -287 -273 10.4227 0.207
NP_442346.1_5 Forward -46 -36 4.69992 0.276
NP_440545.1_3 Forward -276 -259 -3.50107 0.206
NP_441629.1_3 Reverse -29 -48 -1.47628 0.263
NP_440459.1_1 Forward -22 -3 17.8957 0.189
NP_440459.1_2 Forward -54 -37 10.2653 0.204
NP_440459.1_2 Forward -287 -270 7.512 0.288
NP_440459.1_2 Forward -229 -212 7.41366 0.291
NP_440010.1_4 Reverse -201 -220 -1.67294 0.267
NP_440010.1_10 Reverse -125 -144 1.86774 0.292
NP_442137.1_8 Forward -230 -212 17.352 0.227
NP_442551.1_4 Reverse -34 -49 -3.36336 0.287
NP_440847.1_3 Reverse -20 -34 11.2087 0.271
NP_442828.1_7 Forward -287 -268 -4.32711 0.276
NP_442828.1_7 Forward -288 -269 -4.91709 0.276
NP_441888.1_9 Forward -45 -26 14.6533 0.267
NP_441833.1_4 Reverse -225 -232 11.0522 0.0559
NP_441329.1_6 Forward -97 -78 -0.143661 0.266
NP_442060.1_10 Forward -47 -28 8.75091 0.269
NP_440671.1_4 Forward -208 -194 4.91614 0.3
NP_441671.1_10 Reverse -141 -160 1.67108 0.263
NP_440590.1_4 Reverse -242 -255 -5.19226 0.277
NP_440567.1_1 Forward -249 -235 5.40779 0.103
NP_440821.1_4 Forward -252 -242 -0.806614 0.296
NP_441239.1_9 Reverse -197 -209 7.31547 0.165
NP_441892.1_1 Reverse -215 -232 0.432165 0.168
NP_441892.1_1 Forward -210 -193 -2.61609 0.224
NP_440665.1_1 Reverse -244 -263 -12.8819 0.254
NP_440740.1_2 Forward -198 -179 12.1925 0.222
NP_442629.1_3 Forward -212 -193 0.196116 0.294
NP_441541.1_1 Reverse -160 -178 4.29912 0.171
NP_441541.1_1 Reverse -161 -179 -0.475474 0.237
NP_441541.1_1 Forward -189 -171 -1.62138 0.24
NP_440412.1_1 Forward -226 -207 16.2241 0.0792
NP_440546.1_4 Forward -208 -198 8.49468 0.186
NP_441509.1_8 Reverse -112 -126 22.025 0.00263
NP_441474.1_1 Forward -260 -241 -1.96793 0.267
NP_442402.1_4 Reverse -359 -378 -8.94939 0.285
NP_442402.1_4 Reverse -4 -23 -9.83437 0.293
NP_442402.1_10 Reverse -12 -22 10.8943 0.275
NP_440696.1_3 Forward -55 -37 -1.16082 0.251
NP_442923.1_6 Reverse -157 -171 16.3407 0.183
NP_442053.1_1 Forward -250 -241 6.68623 0.12
NP_441959.1_5 Reverse -6 -25 11.2092 0.152
NP_441252.1_6 Forward -288 -281 14.3954 0.168
NP_442844.1_5 Reverse -12 -31 1.37531 0.273
NP_442532.1_7 Reverse -241 -255 4.32615 0.174
NP_440914.1_1 Forward -250 -240 6.66328 0.269
NP_440914.1_7 Forward -182 -163 8.92807 0.251
NP_442533.1_1 Forward -217 -198 -5.11376 0.155
NP_442533.1_1 Reverse -238 -257 -16.8151 0.277
NP_442533.1_6 Forward -45 -36 5.11294 0.155
NP_442533.1_6 Forward -250 -241 5.01461 0.16
NP_442533.1_6 Reverse -36 -45 4.12963 0.191
NP_442533.1_6 Reverse -199 -208 3.04799 0.228
NP_442541.1_10 Forward -45 -31 10.0287 0.198
NP_442541.1_10 Reverse -36 -50 5.40719 0.248
NP_440263.1_3 Forward -38 -19 9.24257 0.22
NP_442322.1_4 Reverse -114 -131 -8.02495 0.286
NP_441482.1_7 Reverse -36 -50 -0.0987402 0.0612
NP_441697.1_5 Forward -184 -165 9.40553 0.135
NP_441697.1_5 Reverse -157 -176 -1.86252 0.206
NP_441028.1_6 Reverse -13 -23 7.45273 0.229
NP_440007.1_9 Reverse -38 -52 3.73617 0.267
NP_441602.1_3 Reverse -236 -255 -0.590531 0.224
NP_441602.1_3 Forward -213 -194 -3.24547 0.243
NP_440429.1_2 Reverse -138 -157 16.1257 0.157
NP_441216.1_5 Reverse -188 -207 14.3549 0.188
NP_441286.1_1 Reverse -240 -252 -4.48425 0.161
NP_441479.1_1 Reverse -245 -264 12.0942 0.172
NP_441479.1_9 Reverse -244 -262 12.7038 0.293
NP_442908.1_1 Forward -238 -219 2.3594 0.277
NP_440886.1_7 Forward -251 -241 7.84605 0.0827
NP_440886.1_7 Reverse -207 -217 5.78111 0.163
NP_440886.1_7 Reverse -198 -208 3.8145 0.265
NP_440767.1_1 Forward -311 -292 14.5524 0.153
NP_442800.1_7 Reverse -126 -145 7.17762 0.219
NP_440028.1_6 Forward -225 -207 10.2456 0.282
NP_440907.2_8 Reverse -242 -252 4.60114 0.257
NP_442264.1_2 Reverse -32 -49 6.92201 0.25
NP_442264.1_5 Forward -51 -37 14.9459 0.222
NP_442459.1_7 Forward -166 -147 1.17943 0.272
NP_441463.1_3 Forward -260 -241 -9.14533 0.277
NP_442211.1_3 Reverse -212 -231 7.66653 0.275
NP_441962.1_4 Reverse -236 -255 0.982764 0.11
NP_440387.1_1 Reverse -241 -257 5.76173 0.031
NP_440855.1_1 Forward -133 -114 3.04771 0.188
NP_441431.1_2 Reverse -273 -287 5.80051 0.288
NP_441431.1_3 Forward -214 -195 5.01433 0.263
NP_441431.1_3 Reverse -247 -266 2.85105 0.281
NP_441836.1_2 Forward -226 -207 -3.83545 0.244
NP_441836.1_2 Reverse -125 -144 -4.32711 0.255
NP_441836.1_2 Forward -287 -268 -6.58872 0.3
NP_441425.1_2 Reverse -158 -177 12.173 0.269
NP_440293.1_9 Forward -50 -36 15.6928 0.159
NP_440293.1_10 Forward -287 -268 1.76941 0.219
NP_440422.1_10 Reverse -352 -371 4.98276 0.279
NP_442743.1_1 Reverse -274 -293 6.39016 0.268
NP_442680.1_7 Forward -338 -319 -6.29373 0.265
NP_440801.1_8 Reverse -214 -233 3.53937 0.226
NP_441332.1_6 Reverse -198 -208 13.0989 0.19
NP_442509.1_9 Forward -285 -275 8.53436 0.192
NP_442509.1_9 Reverse -241 -251 6.56775 0.263
NP_440524.1_3 Reverse -66 -85 10.3242 0.275
NP_442737.1_5 Forward -234 -215 12.6851 0.261
NP_441885.1_5 Forward -250 -240 1.65166 0.106
NP_442310.1_1 Reverse -129 -148 20.2556 0.0678
NP_442341.1_7 Forward -251 -237 17.4042 0.012
NP_442341.1_7 Reverse -240 -254 2.2612 0.263
NP_441173.1_9 Reverse -14 -22 13.1954 0.184
NP_442395.2_4 Forward -221 -202 0.686995 0.262
NP_442534.1_7 Forward -144 -125 9.63589 0.224
NP_442513.1_5 Reverse -28 -47 5.99684 0.284
NP_440275.1_3 Reverse -209 -219 4.10993 0.203
NP_440312.1_8 Forward -189 -170 9.04103 0.271
NP_440866.1_3 Forward -33 -14 14.7491 0.24
NP_439962.1_4 Reverse -268 -287 -7.67036 0.29
NP_440149.1_8 Forward -214 -195 -1.96717 0.162
NP_440149.1_8 Reverse -241 -260 -6.88371 0.265
NP_440172.1_1 Forward -250 -240 2.53664 0.277
NP_440167.1_3 Forward -224 -205 12.1925 0.201
NP_441226.1_7 Reverse -43 -50 8.29857 0.205
NP_441485.1_2 Forward -52 -33 10.9142 0.274
NP_442379.1_10 Forward -279 -262 -2.61609 0.238
NP_443052.1_9 Reverse -201 -220 -3.54046 0.25
NP_443052.1_9 Forward -84 -65 -4.42544 0.258
NP_443052.1_9 Forward -263 -244 -5.70374 0.273
NP_442403.1_9 Reverse -238 -257 3.04771 0.281
NP_442154.1_1 Forward -219 -201 -14.2388 0.217
NP_442154.1_1 Reverse -242 -260 -15.5171 0.22
NP_442154.1_1 Reverse -129 -147 -18.2704 0.279
NP_440988.1_7 Reverse -67 -86 -4.22878 0.296
NP_440988.1_10 Reverse -203 -217 9.15859 0.205
NP_440988.1_10 Reverse -34 -48 3.34982 0.296
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

ACCTAATACTTGTAACGGCCGCTTGCGATAAAACTCCATGATCAAATCTGGGTGATATTCCCAACTTTCCGGGAACATATCACTAACAGGTCCTAAATCCTCCAGATGACTTTTGGGCAAACGGGGGGGGCGAACTTCCTCCACCACTGCGTCGATCACCACTACATCGCGATCTTGTTCGGCGGTGGTAACGGGCATGGGGGCTGGAGACATATTAATGGTTTTAATAATTACTTAATTTTGCTGGCTGGTTCAGCGGGAGCCAACATTGGCAAGGATTGAGGAGGAACCCGTTAATGGATGACTAAATACTGCCAAGCCTAGGCTTCCAGTGGCATTCTAACGAGAATGGGTTGGCCCTGGCTACCTGGGTTAGGATGGGGAAAACCGTCTTTAGCTG

CDS

GTGCAATGTAGCTTGGTTGAGGTGTCTGTGTCCGTTGATTGGCCTCGTTTACAAAAGGCTTTGACCGTGGAAGTGGAGCGGGGTTTTCAGAATTTGCAGGGTAAACAGCACCGCTTTGGCGACTTCCTCTGTTTAAGTTTTGGCAGTCCTCCCCCCCCTGGTAGTTCCCCCGGCGATCGCCAGAAATGGCGGGAGTTTGCCCAAAGATTTGCCCAGTATGACCAACTGGAGGAAGCTGAAAGAAAAAGTTTGGTGGCCAGTACCCGTCGTTTTTTACATCAATTACGTCGCAGTTTGGAATCTCCTCCTAGGGATTCTGTACCAAAAAAGGATTTACTAGCCCAGGTTAATCGTCCCCAAGTTTCCGAACCCCGTTATCCTAAATCGGGTCAAATTGAACTCCATACCCCTTTAGCAACGGTAGTTTCCCAGAGTCAACATCAAACTAAACTGCTCAAAAACTTGGGTTTAGCAACGGTGGAAGATTTGTTGTTCTATTTCCCCAGGGATTATTTGGACTATGCCCAACAGGTAACTATTGCTGAATTAACAGCGGGGGAAACGGTAACCATTGTGGGGCGGGTGGTAAATTGCACTTGCTTTACCAGTCCCAAAAATCAGAATTTAAATATTTTGCAAATCCAGTTGCGGGATCAAACAGGGCGGATCAAACTATCCCGTTTTTATGCCGGTAAACGGTTTGCCCATCGGGGTTGGCAAGAGAAAATCAAAAAACTTTACCCTCCCCAGGCAGTGGTGGCGGCCTCTGGCTTGGTGAAATCTAGTAAATTTGGTCTGACTCTGGATAATCCGGAAATTGAGGTGCTAGATCGCCATAGTCCCAGCATTGACTCTTTCAAAGTGGGTCGGGTGCTGCCCGTTTACCCCCTCACTGAAGGCATAACAGCGGATTTTTTACGGAAATTAGTTCTAGCCTGTCAAACGGCGATCGCCAAGTTGTCTGATCCTCTGCCCCAAGAGATTAGGGAAAAATATGAATTAATTGATTTGCAAACCGCCATTGCCCAAATTCACTTCCCTGAGAATACGGAAAAGTTAAGTTTAGCCAGGAGAAGATTAGTATTTGATGAATTTTTCTATTTACAGTTAGGATTTTTGCAAAGACGTTACGAACAAAAACAGCAGCAACAAAGCGCTATTTTTACTCCCCATGGCGAATTATTAGAAAAATTTAGTGACTTATTGCCCTTCCGGTTAACCCAAGCTCAACAACGGGTAGTAAATGAAATTTTGCAAGACTTAAATAAACCAAGTCCTATGAATCGTCTAGTACAAGGGGATGTGGGATCCGGGAAAACGGTGGTGGGGGTTTTTGCAATTTTAGCCGCTCTCCAGGGAGGTTACCAAGCGGCTCTAATGGCCCCTACGGAAGTGTTAGCAGAACAGCATTATCAAAAATTAGTAAGTTGGTTTAATTTGCTTTATTTGCCAGTGGAATTGTTAACGGGGTCCACTAAAACTGCCAAAAGAAGGGAAATTCATGCCCAATTATCTACGGGTCAATTACCGTTACTAGTGGGAACTCATGCCCTAATTCAAGAAACAGTTAACTTTCAACGGTTGGGTTTAGTGGTTATTGATGAACAACATCGTTTTGGGGTACAACAGCGGGCTAAGCTTTTGGCCAAAGGTAATGCGCCCCATGTTTTAAGCATGACCGCCACTCCCATTCCCCGCACCCTTGCTTTAACCCTCCATGGGGACCTAGAAGTGAGCCAAATTGACGAATTGCCCCCCGGCCGTCAGCCCATTCACACCAGTGTCATCACTGCCAAGGAAAGGCCACAAATGTACGAACTGATTCGGCGGGAAGTGGCCCAGGGTCGTCAAGTCTACATCATTTTTCCGGCGATCGAAGAATCGGAAAAATTAGACATTAAAGCAGCAGTGGAAGAGCATAAGTATTTAACTGAAAAAATCTTTCCCAACTTTAATATCGGCCTGTTACATGGCCGATTAAAAAGTGCTGAAAAAGAGGCCGCTCTAACAGCTTTTCGAGAAAAGCAAACAGAAATTATTGTTTCCACTACCGTGATCGAAGTGGGGGTCGATGTTCCCAATGCCACAGTGATGGTGATTGAAAATGCAGAGCGTTTTGGTCTTTCCCAACTGCATCAATTGCGAGGGCGAGTCGGTCGAGGTAGTCACCAGTCCTATTGCTTATTGGTCACCAACAGTAAAAGTAATGATGCCCGGCAAAGATTGGGAGTAATGGAACAGTCCCAAGATGGTTTCTTTATTGCAGAAATGGATTTACGTTTGCGGGGCCCAGGGGAATTTTTAGGCACTAAACAATCAGGATTACCGGATTTTGCTTTGGCTAGTTTGGTGGAAGATCAAGAGGTTCTATTGTTGGCGAGGGAAGCAGCGGAAACCATGATGGTAGAGGATCCTAATTTAGAGGCGCATCCTGATTTAAAAATAAAATTAGTCCAAAGATATGAAAAGTTATTAGGGGGAGAAATATTGACCTAA

Protein

MQCSLVEVSVSVDWPRLQKALTVEVERGFQNLQGKQHRFGDFLCLSFGSPPPPGSSPGDRQKWREFAQRFAQYDQLEEAERKSLVASTRRFLHQLRRSLESPPRDSVPKKDLLAQVNRPQVSEPRYPKSGQIELHTPLATVVSQSQHQTKLLKNLGLATVEDLLFYFPRDYLDYAQQVTIAELTAGETVTIVGRVVNCTCFTSPKNQNLNILQIQLRDQTGRIKLSRFYAGKRFAHRGWQEKIKKLYPPQAVVAASGLVKSSKFGLTLDNPEIEVLDRHSPSIDSFKVGRVLPVYPLTEGITADFLRKLVLACQTAIAKLSDPLPQEIREKYELIDLQTAIAQIHFPENTEKLSLARRRLVFDEFFYLQLGFLQRRYEQKQQQQSAIFTPHGELLEKFSDLLPFRLTQAQQRVVNEILQDLNKPSPMNRLVQGDVGSGKTVVGVFAILAALQGGYQAALMAPTEVLAEQHYQKLVSWFNLLYLPVELLTGSTKTAKRREIHAQLSTGQLPLLVGTHALIQETVNFQRLGLVVIDEQHRFGVQQRAKLLAKGNAPHVLSMTATPIPRTLALTLHGDLEVSQIDELPPGRQPIHTSVITAKERPQMYELIRREVAQGRQVYIIFPAIEESEKLDIKAAVEEHKYLTEKIFPNFNIGLLHGRLKSAEKEAALTAFREKQTEIIVSTTVIEVGVDVPNATVMVIENAERFGLSQLHQLRGRVGRGSHQSYCLLVTNSKSNDARQRLGVMEQSQDGFFIAEMDLRLRGPGEFLGTKQSGLPDFALASLVEDQEVLLLAREAAETMMVEDPNLEAHPDLKIKLVQRYEKLLGGEILT