Your browser is old and dusty. Try Google Chrome!

Details for sll8048

ORF sll8048
Accession NP_942442.1
Symbol
Category
Definition
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_441061.1_2 Forward -211 -197 5.01447 0.142
NP_440557.1_1 Reverse -204 -223 8.84924 0.125
NP_440795.1_7 Forward -114 -107 11.3472 0.0978
NP_441418.1_6 Reverse -203 -222 -19.7651 0.0955
NP_442291.1_5 Forward -213 -197 -3.57971 0.245
NP_441453.1_1 Forward -219 -201 11.8181 0.109
NP_441453.1_4 Reverse -106 -114 13.6874 0.0221
NP_441453.1_4 Forward -115 -107 7.29591 0.0589
NP_441453.1_4 Reverse -203 -211 7.09925 0.0962
NP_441453.1_4 Forward -212 -204 6.80426 0.121
NP_442151.1_6 Reverse -203 -217 7.66941 0.192
NP_442169.1_1 Reverse -184 -203 9.43923 0.26
NP_442173.1_1 Forward -114 -106 7.8859 0.134
NP_442173.1_1 Reverse -107 -115 7.49257 0.171
NP_442173.1_1 Forward -211 -203 5.82095 0.2
NP_442173.1_1 Reverse -204 -212 5.72262 0.203
NP_442752.1_4 Forward -212 -205 13.8055 0.0199
NP_443027.1_4 Forward -117 -107 13.943 0.0452
NP_443027.1_4 Reverse -104 -114 13.943 0.0452
NP_443027.1_4 Forward -214 -204 12.3697 0.079
NP_442975.1_10 Forward -216 -202 3.34225 0.259
NP_442975.1_10 Reverse -102 -116 1.5723 0.296
NP_440784.1_7 Reverse -107 -114 12.4288 0.0475
NP_440784.1_7 Forward -211 -204 6.23397 0.241
NP_440784.1_7 Forward -114 -107 6.23397 0.241
NP_440784.1_7 Reverse -204 -211 6.13563 0.241
NP_440110.1_8 Reverse -201 -220 8.45592 0.0916
NP_442062.1_8 Forward -212 -202 14.9263 0.0108
NP_442062.1_8 Reverse -106 -116 4.20827 0.228
NP_440761.1_4 Forward -120 -101 5.99764 0.0718
NP_440761.1_4 Reverse -198 -217 -4.13045 0.132
NP_441859.1_3 Forward -213 -194 2.85027 0.254
NP_441859.1_5 Forward -223 -204 5.60432 0.295
NP_440304.1_4 Forward -214 -204 10.2065 0.051
NP_440304.1_4 Forward -117 -107 8.53483 0.0756
NP_442242.1_4 Reverse -204 -211 10.8555 0.127
NP_440044.1_8 Forward -114 -95 3.44104 0.13
NP_440044.1_8 Forward -211 -192 -3.44213 0.284
NP_441352.1_4 Forward -283 -264 12.9791 0.238
NP_441200.1_4 Forward -365 -346 7.07928 0.272
NP_441619.1_8 Reverse -197 -211 10.1271 0.189
NP_441208.1_9 Reverse -200 -214 5.99778 0.254
NP_441594.1_6 Reverse -194 -213 2.16274 0.255
NP_442196.1_4 Forward -206 -187 12.5858 0.287
NP_442196.1_10 Forward -117 -98 12.3892 0.222
NP_442110.1_7 Reverse -203 -217 11.6026 0.0595
NP_442110.1_7 Forward -115 -101 4.32615 0.203
NP_441083.1_5 Forward -212 -202 10.7964 0.0182
NP_441083.1_5 Reverse -203 -213 1.94665 0.197
NP_442827.1_8 Reverse -195 -214 0.981987 0.191
NP_441434.1_7 Forward -210 -196 5.70279 0.225
NP_441738.1_2 Reverse -205 -212 15.28 0.0102
NP_441558.1_5 Reverse -201 -220 7.86593 0.167
NP_440209.1_1 Reverse -203 -211 14.8674 0.012
NP_440209.1_1 Forward -212 -204 8.57422 0.0425
NP_441713.1_3 Reverse -187 -206 3.83436 0.258
NP_442461.1_4 Reverse -162 -181 9.73422 0.214
NP_442111.1_4 Reverse -202 -216 11.111 0.0515
NP_440906.1_5 Forward -211 -204 6.23397 0.234
NP_440906.1_5 Forward -114 -107 6.23397 0.234
NP_440906.1_5 Reverse -204 -211 6.13563 0.241
NP_440906.1_5 Reverse -107 -114 6.0373 0.262
NP_440747.1_10 Forward -215 -203 -1.92764 0.0192
NP_440747.1_10 Reverse -200 -212 -2.32097 0.0331
NP_441486.1_1 Reverse -103 -117 0.687908 0.129
NP_441486.1_1 Reverse -200 -214 -5.50694 0.242
NP_441486.1_1 Forward -118 -104 -6.39192 0.294
NP_442634.1_4 Reverse -201 -215 5.80112 0.051
NP_442634.1_4 Forward -117 -103 -3.44199 0.161
NP_440403.1_10 Reverse -194 -213 1.76941 0.288
NP_442848.1_1 Reverse -197 -211 3.04785 0.146
NP_442848.1_1 Reverse -254 -268 -2.16369 0.263
NP_442848.1_1 Forward -115 -101 -3.04867 0.263
NP_441012.1_4 Reverse -102 -115 6.90245 0.276
NP_443018.1_3 Forward -114 -107 13.8055 0.024
NP_443018.1_3 Reverse -107 -114 13.6088 0.0352
NP_443018.1_3 Forward -211 -204 12.6255 0.0471
NP_443018.1_3 Reverse -204 -211 5.25066 0.214
NP_441634.1_8 Forward -214 -200 -0.295402 0.252
NP_441634.1_8 Reverse -327 -341 -2.16369 0.295
NP_440376.1_1 Forward -212 -203 9.83282 0.0339
NP_440376.1_1 Reverse -203 -212 9.63616 0.0385
NP_442485.1_3 Reverse -192 -211 -5.40875 0.291
NP_440042.1_2 Reverse -90 -109 -3.73712 0.289
NP_441950.1_7 Reverse -191 -210 -3.73712 0.211
NP_442658.1_1 Forward -117 -107 11.2876 0.0874
NP_441855.2_4 Reverse -225 -244 11.4512 0.213
NP_442205.1_9 Forward -121 -105 2.71347 0.206
NP_442205.1_9 Reverse -197 -213 -1.61309 0.264
NP_440656.1_8 Reverse -95 -114 0.0977854 0.141
NP_441414.1_9 Forward -109 -90 -1.96717 0.108
NP_441487.1_6 Forward -310 -291 -1.27885 0.285
NP_441958.1_5 Forward -213 -203 11.7798 0.00293
NP_441958.1_5 Reverse -202 -212 2.43831 0.0422
NP_441958.1_5 Forward -116 -106 0.471689 0.143
NP_441958.1_5 Reverse -105 -115 0.373358 0.154
NP_441958.1_5 Reverse -292 -302 -2.37991 0.272
NP_440203.1_5 Reverse -206 -216 14.9258 0.0886
NP_440203.1_5 Forward -299 -289 11.2876 0.2
NP_440203.1_5 Reverse -94 -104 9.321 0.263
NP_441338.2_5 Forward -109 -90 2.16274 0.299
NP_442376.1_2 Reverse -198 -217 -12.2919 0.286
NP_441580.1_6 Forward -223 -204 -8.16202 0.254
NP_442536.1_7 Forward -268 -249 8.55425 0.273
NP_443055.1_6 Forward -226 -208 -0.178247 0.254
NP_440993.1_2 Forward -217 -201 17.7581 0.0447
NP_440993.1_2 Forward -307 -291 6.45005 0.218
NP_440993.1_3 Forward -222 -203 -1.57461 0.288
NP_440827.1_3 Reverse -198 -217 11.1109 0.275
NP_441099.1_6 Reverse -343 -362 11.9958 0.282
NP_442002.1_9 Forward -101 -94 12.4288 0.185
NP_442438.1_10 Reverse -198 -212 9.83269 0.0602
NP_442438.1_10 Forward -217 -203 1.17956 0.204
NP_441000.1_5 Reverse -380 -399 5.11187 0.27
NP_442771.1_1 Reverse -215 -233 -1.75081 0.142
NP_440147.1_4 Forward -214 -201 3.75586 0.181
NP_441550.1_8 Reverse -201 -211 7.55106 0.154
NP_441550.1_8 Reverse -104 -114 5.09279 0.267
NP_441916.1_7 Reverse -203 -213 15.713 0.00774
NP_441916.1_7 Forward -115 -105 14.828 0.0115
NP_441916.1_7 Reverse -106 -116 7.74818 0.0608
NP_441041.1_4 Reverse -197 -216 -13.9635 0.299
NP_443063.1_5 Reverse -36 -55 12.29 0.287
NP_442004.1_6 Forward -115 -101 6.58777 0.171
NP_442004.1_6 Reverse -203 -217 3.34284 0.242
NP_441725.1_5 Reverse -204 -214 1.35667 0.137
NP_441725.1_5 Reverse -107 -117 -0.41329 0.251
NP_441725.1_5 Forward -211 -201 -0.708283 0.267
NP_439966.1_7 Reverse -201 -211 12.5659 0.0396
NP_439966.1_7 Forward -214 -204 5.09279 0.243
NP_442941.1_3 Reverse -204 -214 10.1081 0.024
NP_442941.1_3 Forward -114 -104 7.64985 0.0628
NP_442941.1_3 Reverse -107 -117 7.55152 0.0711
NP_442941.1_3 Forward -211 -201 1.25834 0.15
NP_440289.1_2 Reverse -200 -213 -4.9956 0.294
NP_440983.1_5 Reverse -94 -113 -2.65548 0.231
NP_440260.1_8 Reverse -194 -212 -2.93078 0.246
NP_442281.1_1 Forward -217 -203 12.6836 0.035
NP_442281.1_1 Forward -120 -106 8.84875 0.075
NP_442281.1_1 Reverse -101 -115 2.35894 0.269
NP_441334.1_7 Forward -117 -98 -5.80207 0.12
NP_441334.1_7 Reverse -201 -220 -12.1936 0.142
NP_440437.1_1 Forward -218 -199 -2.55715 0.219
NP_441457.1_7 Forward -214 -195 -0.983855 0.293
NP_442982.1_5 Forward -222 -203 -2.36049 0.286
NP_443030.1_4 Forward -230 -211 -5.9004 0.272
NP_441644.1_6 Reverse -203 -213 10.1076 0.0628
NP_441644.1_6 Forward -212 -202 7.74772 0.117
NP_441644.1_6 Forward -115 -105 5.58445 0.184
NP_441644.1_6 Reverse -106 -116 5.48612 0.188
NP_442215.1_2 Reverse -201 -217 3.50012 0.0955
NP_442177.1_5 Reverse -206 -220 9.63603 0.239
NP_441810.1_9 Reverse -93 -112 3.14605 0.269
NP_442029.1_6 Reverse -198 -217 3.93269 0.274
NP_440929.1_8 Reverse -203 -212 9.63616 0.0262
NP_440929.1_8 Forward -212 -203 9.53783 0.0296
NP_442933.1_10 Reverse -203 -212 15.1427 0.00958
NP_442933.1_10 Forward -115 -106 14.2577 0.0126
NP_442933.1_10 Forward -212 -203 7.96454 0.0937
NP_442933.1_10 Reverse -106 -115 7.76787 0.11
NP_441751.2_8 Forward -211 -197 12.3893 0.0193
NP_441751.2_8 Reverse -204 -218 -3.04867 0.134
NP_442554.1_8 Forward -211 -201 8.63316 0.0712
NP_442554.1_8 Reverse -204 -214 7.15819 0.0975
NP_442554.1_8 Forward -114 -104 6.27322 0.123
NP_442554.1_8 Reverse -107 -117 6.27322 0.123
NP_442167.1_6 Reverse -96 -112 11.3659 0.256
NP_441762.1_7 Forward -213 -201 -6.94252 0.284
NP_442142.1_4 Forward -215 -202 10.8351 0.0662
NP_442142.1_4 Forward -118 -105 4.44361 0.222
NP_442142.1_4 Reverse -200 -213 4.24695 0.227
NP_442292.1_1 Forward -211 -202 8.75118 0.0306
NP_442292.1_1 Reverse -204 -213 7.66954 0.0634
NP_442292.1_1 Reverse -107 -116 5.60459 0.14
NP_443009.1_5 Reverse -105 -116 8.71129 0.102
NP_443009.1_5 Reverse -202 -213 4.8764 0.226
NP_441715.1_4 Reverse -204 -214 4.40493 0.281
NP_441448.1_1 Forward -49 -30 5.60432 0.261
NP_441198.1_8 Reverse -104 -114 12.1971 0.15
NP_441198.1_8 Forward -117 -107 10.4392 0.271
NP_441468.1_1 Forward -114 -107 13.8055 0.0242
NP_441468.1_1 Forward -211 -204 6.13563 0.209
NP_441468.1_1 Reverse -204 -211 6.0373 0.223
NP_441468.1_1 Reverse -107 -114 6.0373 0.223
NP_441015.1_10 Forward -46 -27 -10.1286 0.283
NP_441015.1_10 Reverse -198 -217 -11.3086 0.294
NP_441673.1_1 Forward -212 -203 11.1111 0.0121
NP_441673.1_1 Reverse -203 -212 11.0128 0.018
NP_441826.1_2 Reverse -197 -211 4.42448 0.103
NP_441826.1_2 Forward -218 -204 -2.95034 0.28
NP_441826.1_2 Reverse -100 -114 -4.13031 0.292
NP_442490.1_9 Reverse -79 -98 -4.42544 0.266
NP_442490.1_9 Forward -224 -205 -7.86702 0.279
NP_442868.1_6 Reverse -201 -211 7.64985 0.0726
NP_442719.1_2 Reverse -379 -397 -11.2896 0.291
NP_441612.1_2 Forward -212 -202 10.1951 0.21
NP_442361.1_3 Forward -218 -205 9.36073 0.276
NP_442808.1_1 Reverse -99 -109 16.5975 0.01
NP_442808.1_1 Reverse -202 -212 7.35439 0.0814
NP_442808.1_1 Forward -227 -217 3.22451 0.247
NP_441101.1_10 Forward -156 -137 -5.31042 0.281
NP_440145.1_3 Reverse -193 -212 -1.7705 0.156
NP_442050.1_5 Reverse -201 -211 11.5826 0.0915
NP_442050.1_5 Forward -304 -294 8.43603 0.234
NP_442050.1_5 Forward -214 -204 8.3377 0.234
NP_442050.1_5 Reverse -104 -114 7.74772 0.243
NP_442050.1_5 Forward -117 -107 7.45273 0.256
NP_442342.1_9 Reverse -201 -217 4.3851 0.25
NP_440558.1_2 Forward -221 -202 -2.45882 0.227
NP_441518.1_3 Reverse -193 -212 -7.96535 0.176
NP_441878.1_6 Forward -213 -203 0.766681 0.134
NP_441878.1_6 Reverse -202 -212 0.57002 0.14
NP_441036.1_8 Forward -213 -203 14.6313 0.0205
NP_441557.1_5 Forward -212 -203 10.2261 0.0144
NP_441557.1_5 Reverse -203 -212 10.1278 0.0188
NP_441557.1_5 Forward -115 -106 -0.491928 0.193
NP_441557.1_5 Reverse -106 -115 -0.590259 0.219
NP_442795.1_3 Forward -97 -78 14.2574 0.0788
NP_440101.1_10 Reverse -197 -216 4.42435 0.212
NP_442183.1_1 Forward -109 -95 5.01447 0.234
NP_442183.1_1 Forward -212 -198 4.12949 0.277
NP_441116.1_8 Forward -32 -13 15.9291 0.212
NP_441549.1_9 Reverse -199 -217 -6.4707 0.2
NP_442347.1_2 Reverse -204 -213 3.14632 0.286
NP_442645.1_2 Reverse -195 -214 -13.5702 0.158
NP_440932.1_5 Reverse -89 -108 11.6025 0.162
NP_440136.1_2 Forward -114 -107 6.52896 0.116
NP_440136.1_2 Forward -211 -204 6.23397 0.171
NP_440136.1_2 Reverse -204 -211 6.13563 0.193
NP_440136.1_2 Reverse -107 -114 6.13563 0.193
NP_442998.1_10 Reverse -205 -212 15.5754 0.0102
NP_442998.1_10 Forward -210 -203 5.84064 0.235
NP_440899.1_2 Forward -223 -204 16.2232 0.0666
NP_440899.1_2 Reverse -95 -114 13.5683 0.103
NP_440299.1_1 Forward -216 -203 9.36014 0.0728
NP_440299.1_1 Reverse -102 -115 6.21356 0.149
NP_441799.1_1 Reverse -102 -116 7.86545 0.13
NP_441799.1_4 Forward -211 -192 -4.13045 0.203
NP_441007.1_10 Forward -120 -107 4.44418 0.182
NP_441007.1_10 Reverse -198 -211 2.67422 0.183
NP_440256.1_1 Forward -118 -99 12.4875 0.0121
NP_440256.1_1 Reverse -103 -122 -0.0988766 0.0893
NP_440256.1_1 Reverse -200 -219 -0.39387 0.0928
NP_440256.1_1 Forward -215 -196 -8.94866 0.27
NP_440709.1_1 Forward -25 -6 1.86696 0.229
NP_440915.1_6 Reverse -199 -213 10.521 0.0311
NP_442452.1_8 Forward -218 -204 16.1252 0.273
NP_442866.1_1 Reverse -198 -217 -6.98204 0.263
NP_441464.1_8 Forward -234 -220 5.01447 0.26
NP_441199.1_6 Forward -216 -197 3.53937 0.179
NP_442993.1_1 Reverse -106 -122 -12.2328 0.268
NP_442386.1_9 Reverse -105 -114 5.89917 0.233
NP_442386.1_9 Forward -116 -107 5.30919 0.257
NP_442386.1_9 Forward -219 -210 5.0142 0.27
NP_441340.1_5 Reverse -107 -114 13.5105 0.0314
NP_441340.1_5 Forward -211 -204 6.23397 0.132
NP_441340.1_5 Forward -114 -107 6.23397 0.132
NP_441340.1_5 Reverse -204 -211 5.84064 0.208
NP_441340.1_9 Forward -88 -78 8.93007 0.256
NP_441947.1_4 Reverse -95 -114 10.5209 0.296
NP_442484.1_2 Reverse -204 -223 -1.96717 0.3
NP_442240.1_2 Reverse -204 -223 3.34271 0.0551
NP_440586.1_8 Forward -211 -204 14.69 0.026
NP_440586.1_8 Reverse -107 -114 11.3468 0.0736
NP_440586.1_8 Forward -114 -107 9.47853 0.146
NP_442251.1_6 Reverse -204 -211 12.0355 0.0627
NP_441262.1_3 Forward -212 -205 14.7888 0.0223
NP_440027.1_3 Forward -212 -194 2.67334 0.289
NP_443051.1_1 Forward -213 -204 10.0295 0.0139
NP_443051.1_1 Reverse -202 -211 0.589713 0.143
NP_443051.1_1 Forward -116 -107 0.491382 0.151
NP_443051.1_1 Reverse -105 -114 0.393051 0.169
NP_439937.1_9 Reverse -90 -107 -17.268 0.296
NP_440439.1_1 Forward -215 -202 -0.37404 0.215
NP_440439.1_1 Reverse -103 -116 -0.669033 0.229
NP_440372.1_2 Forward -211 -204 6.82395 0.0854
NP_440372.1_2 Forward -114 -107 6.62729 0.151
NP_440372.1_2 Reverse -204 -211 6.52896 0.188
NP_440372.1_2 Reverse -107 -114 6.52896 0.188
NP_440819.1_5 Forward -398 -390 7.8859 0.266
NP_440819.1_5 Forward -399 -391 6.41093 0.285
NP_441803.1_2 Forward -217 -198 10.3242 0.0865
NP_439977.1_5 Reverse -197 -216 0.392778 0.21
NP_439977.1_5 Forward -344 -325 -2.45882 0.282
NP_441572.1_7 Forward -218 -199 -2.26216 0.193
NP_440267.1_2 Forward -217 -203 7.07881 0.21
NP_442384.1_10 Reverse -203 -216 5.91914 0.116
NP_442384.1_10 Forward -115 -102 5.91914 0.116
NP_442384.1_10 Forward -302 -289 1.69091 0.249
NP_441877.1_9 Forward -25 -8 2.39878 0.29
NP_441018.1_3 Reverse -229 -248 10.7167 0.286
NP_441018.1_7 Reverse -193 -212 10.8159 0.194
NP_442262.1_10 Forward -114 -107 13.0188 0.0314
NP_442262.1_10 Forward -211 -204 12.9205 0.0422
NP_442262.1_10 Reverse -107 -114 11.6422 0.092
NP_441689.1_5 Reverse -104 -114 10.501 0.132
NP_441689.1_5 Forward -117 -107 10.4026 0.132
NP_441689.1_5 Forward -214 -204 8.3377 0.132
NP_441689.1_5 Forward -304 -294 5.87944 0.197
NP_440344.1_10 Forward -219 -202 -7.53264 0.118
NP_441965.1_10 Reverse -103 -119 2.91013 0.28
NP_442693.1_6 Reverse -100 -119 0.392778 0.278
NP_440297.1_9 Reverse -107 -117 0.963343 0.282
NP_440297.1_9 Forward -114 -104 0.373358 0.282
NP_440297.1_9 Reverse -204 -214 -0.609952 0.292
NP_441592.1_4 Forward -212 -193 0.196116 0.235
NP_440894.1_10 Reverse -95 -114 3.34271 0.274
NP_440888.1_2 Forward -212 -198 9.53707 0.123
NP_440888.1_2 Reverse -203 -217 7.07881 0.208
NP_440888.1_2 Reverse -106 -120 6.68548 0.223
NP_440600.1_4 Reverse -98 -116 -2.93078 0.213
NP_442948.1_2 Reverse -202 -221 4.52268 0.26
NP_442277.1_4 Reverse -97 -116 11.5033 0.0759
NP_442033.1_10 Reverse -89 -108 -13.1769 0.283
NP_441543.1_2 Forward -211 -202 15.0444 0.0111
NP_441543.1_2 Reverse -107 -116 10.6195 0.0691
NP_441543.1_2 Reverse -204 -213 6.09625 0.153
NP_442845.1_2 Forward -121 -107 8.94771 0.183
NP_442845.1_2 Reverse -197 -211 7.37441 0.195
NP_442845.1_2 Reverse -100 -114 5.70279 0.225
NP_442845.1_2 Forward -218 -204 4.62115 0.256
NP_442845.1_2 Reverse -203 -217 3.93283 0.272
NP_441551.1_5 Reverse -199 -215 9.98926 0.2
NP_442315.1_1 Forward -48 -30 3.06741 0.294
NP_443064.1_6 Reverse -203 -213 9.94905 0.187
NP_442578.1_7 Forward -211 -204 14.6904 0.026
NP_440220.1_4 Reverse -357 -376 2.55527 0.227
NP_441462.1_2 Reverse -203 -213 10.4031 0.011
NP_441462.1_2 Forward -212 -202 2.24165 0.0801
NP_441462.1_2 Forward -115 -105 -0.216628 0.192
NP_441462.1_2 Reverse -106 -116 -0.314959 0.206
NP_441621.1_7 Reverse -201 -215 -5.31028 0.25
NP_443062.1_1 Reverse -106 -124 3.76806 0.285
NP_440519.1_8 Forward -115 -99 10.8749 0.193
NP_442204.1_1 Forward -216 -205 19.2332 0.0136
NP_442204.1_1 Reverse -283 -294 3.30359 0.266
NP_442204.1_1 Reverse -325 -336 1.7303 0.266
NP_440516.1_8 Forward -212 -203 8.45619 0.0364
NP_440516.1_8 Reverse -203 -212 7.37455 0.0648
NP_440516.1_8 Forward -109 -100 -0.393597 0.255
NP_442428.1_5 Forward -114 -107 14.1988 0.0242
NP_442428.1_5 Forward -211 -204 6.13563 0.209
NP_442428.1_5 Reverse -204 -211 6.0373 0.212
NP_442428.1_5 Reverse -107 -114 6.0373 0.212
NP_442120.1_10 Reverse -197 -216 -7.37537 0.219
NP_440673.1_2 Reverse -193 -212 14.5843 0.0986
NP_440673.1_2 Reverse -96 -115 13.2186 0.123
NP_440673.1_3 Reverse -108 -115 13.2155 0.0426
NP_440673.1_3 Reverse -205 -212 12.4288 0.0426
NP_440673.1_3 Reverse -93 -100 7.51227 0.252
NP_441052.1_2 Forward -212 -202 16.598 0.00889
NP_441052.1_2 Reverse -203 -213 0.57002 0.256
NP_442219.1_8 Reverse -193 -212 15.7045 0.103
NP_442219.1_9 Forward -211 -202 8.06287 0.0696
NP_440436.1_4 Forward -211 -202 7.66912 0.124
NP_440436.1_4 Reverse -107 -116 5.0142 0.227
NP_441884.1_9 Reverse -200 -219 -22.715 0.284
NP_442086.1_4 Forward -211 -192 15.0585 0.268
NP_441321.1_5 Forward -397 -378 6.98095 0.265
NP_442907.1_9 Forward -217 -198 -1.18052 0.233
NP_441719.1_4 Forward -211 -204 13.5105 0.026
NP_441719.1_4 Forward -114 -107 6.62729 0.151
NP_441719.1_4 Reverse -204 -211 6.52896 0.188
NP_441719.1_4 Reverse -107 -114 6.52896 0.188
NP_441004.1_1 Reverse -190 -209 -13.4719 0.257
NP_443054.1_2 Forward -214 -200 2.5562 0.244
NP_441851.1_10 Reverse -202 -212 5.97822 0.19
NP_441851.1_10 Forward -213 -203 4.60159 0.259
NP_442515.1_1 Forward -101 -87 2.85119 0.129
NP_441409.1_6 Forward -218 -199 -1.18052 0.0754
NP_442843.1_1 Reverse -179 -198 -11.0136 0.285
NP_439960.1_10 Forward -219 -201 1.29745 0.199
NP_442450.1_5 Forward -214 -204 6.17489 0.197
NP_442006.1_2 Reverse -338 -355 -17.8574 0.283
NP_442243.1_1 Forward -218 -200 3.8533 0.2
NP_441570.1_1 Reverse -203 -221 -8.83064 0.122
NP_441570.1_1 Forward -212 -194 -9.91228 0.153
NP_441570.1_1 Forward -115 -97 -17.5821 0.283
NP_441078.1_4 Forward -212 -203 9.93116 0.0203
NP_441078.1_4 Reverse -203 -212 9.83282 0.0226
NP_440526.1_3 Forward -211 -200 10.7762 0.0646
NP_441432.1_8 Forward -110 -101 10.0295 0.0681
NP_441432.1_8 Forward -213 -204 7.27622 0.101
NP_441432.1_8 Reverse -202 -211 6.98123 0.112
NP_441432.1_8 Forward -116 -107 4.32629 0.223
NP_442320.1_8 Reverse -197 -211 -3.04867 0.105
NP_442320.1_8 Forward -218 -204 -4.4253 0.168
NP_441732.1_2 Forward -216 -200 11.4649 0.00863
NP_440760.1_1 Forward -212 -193 -15.8318 0.157
NP_442797.1_7 Reverse -195 -213 1.10079 0.265
NP_440199.1_10 Forward -112 -102 7.64985 0.231
NP_441072.1_2 Reverse -192 -211 7.47261 0.257
NP_442489.1_7 Reverse -203 -212 17.306 0.00302
NP_442489.1_7 Forward -212 -203 10.4228 0.0151
NP_442489.1_7 Forward -115 -106 -1.6719 0.235
NP_442079.1_7 Reverse -204 -223 12.7825 0.0838
NP_440559.1_1 Forward -211 -202 14.356 0.0209
NP_441659.2_8 Reverse -203 -213 11.2881 0.0189
NP_441659.2_8 Forward -212 -202 8.63316 0.0405
NP_441659.2_8 Reverse -106 -116 6.96153 0.0645
NP_440426.1_7 Forward -222 -203 2.65439 0.207
NP_442776.1_1 Forward -223 -204 6.58763 0.225
NP_442346.1_5 Forward -116 -106 12.8614 0.0349
NP_442346.1_5 Reverse -105 -115 12.4681 0.0421
NP_442346.1_5 Forward -213 -203 7.15819 0.178
NP_442346.1_5 Reverse -202 -212 6.8632 0.188
NP_440545.1_3 Reverse -199 -216 6.03703 0.0578
NP_442603.1_7 Reverse -203 -217 7.66879 0.198
NP_440449.1_6 Reverse -83 -101 6.31057 0.255
NP_441833.1_4 Reverse -204 -211 6.52896 0.0924
NP_441833.1_4 Forward -211 -204 6.23397 0.163
NP_441833.1_4 Forward -114 -107 6.23397 0.163
NP_441833.1_4 Reverse -107 -114 6.13563 0.198
NP_441895.1_10 Forward -392 -373 -18.2901 0.282
NP_441112.1_6 Reverse -96 -115 5.80098 0.172
NP_442162.1_9 Forward -211 -204 6.62729 0.142
NP_442162.1_9 Forward -114 -107 6.62729 0.142
NP_442162.1_9 Reverse -204 -211 6.52896 0.178
NP_442162.1_9 Reverse -107 -114 6.43063 0.208
NP_440671.1_4 Forward -218 -204 14.4542 0.0611
NP_440224.1_1 Forward -223 -204 24.6805 0.0111
NP_442943.1_1 Reverse -12 -27 2.81851 0.291
NP_440204.1_7 Reverse -90 -108 14.5721 0.239
NP_442140.1_3 Forward -211 -201 4.3066 0.248
NP_442021.1_3 Reverse -197 -216 -7.86702 0.284
NP_441671.1_10 Reverse -192 -211 10.2259 0.18
NP_440875.1_9 Reverse -205 -215 8.27469 0.233
NP_441813.1_5 Forward -214 -204 6.17489 0.1
NP_441813.1_5 Forward -117 -107 5.38824 0.13
NP_441813.1_5 Reverse -104 -114 5.28991 0.138
NP_440590.1_4 Forward -211 -198 2.2809 0.0939
NP_440567.1_1 Reverse -204 -218 11.2093 0.0294
NP_440567.1_1 Forward -211 -197 9.43936 0.0442
NP_440567.1_1 Forward -114 -100 4.91614 0.109
NP_442497.1_1 Forward -302 -283 9.43841 0.273
NP_442497.1_10 Reverse -204 -213 7.76787 0.0731
NP_442497.1_10 Forward -114 -105 5.99792 0.095
NP_442497.1_10 Reverse -107 -116 5.89959 0.109
NP_442497.1_10 Forward -211 -202 0.688044 0.141
NP_440821.1_4 Reverse -201 -211 8.1415 0.055
NP_440821.1_4 Forward -214 -204 1.35667 0.137
NP_440227.1_6 Reverse -10 -24 14.1444 0.28
NP_441239.1_9 Reverse -104 -116 7.02048 0.173
NP_441239.1_9 Forward -117 -105 5.93884 0.202
NP_440624.1_5 Reverse -12 -30 6.41411 0.298
NP_441892.1_1 Reverse -97 -114 0.727158 0.163
NP_441892.1_1 Forward -124 -107 -3.79607 0.249
NP_440863.1_1 Forward -389 -375 16.1291 0.203
NP_441541.1_1 Forward -24 -6 0.670429 0.228
NP_441541.1_1 Reverse -6 -24 -0.952934 0.237
NP_440354.1_7 Reverse -100 -118 5.82068 0.297
NP_440546.1_4 Forward -115 -105 15.3787 0.0459
NP_440546.1_4 Reverse -106 -116 14.3121 0.0459
NP_440462.1_6 Forward -214 -204 13.648 0.0266
NP_440462.1_6 Forward -117 -107 6.46988 0.115
NP_440462.1_6 Reverse -104 -114 6.37155 0.118
NP_440868.1_4 Reverse -199 -211 5.93884 0.0879
NP_440341.1_7 Forward -269 -255 11.8976 0.226
NP_441084.1_6 Forward -214 -200 11.1863 0.214
NP_442039.1_4 Forward -268 -261 8.39725 0.202
NP_442039.1_4 Forward -114 -107 6.3323 0.289
NP_441811.1_8 Reverse -197 -211 7.47274 0.243
NP_442679.1_1 Forward -102 -83 -4.32711 0.276
NP_442380.1_10 Reverse -193 -211 7.4923 0.282
NP_442837.1_3 Reverse -204 -211 12.1338 0.0702
NP_442837.1_3 Forward -211 -204 6.0373 0.25
NP_442837.1_3 Forward -114 -107 6.0373 0.25
NP_442837.1_3 Reverse -107 -114 5.93897 0.265
NP_442053.1_1 Reverse -203 -212 16.3227 0.00389
NP_442053.1_1 Forward -212 -203 8.65285 0.0741
NP_440505.1_3 Reverse -201 -211 6.76487 0.169
NP_440505.1_3 Forward -214 -204 6.27322 0.187
NP_441102.1_1 Reverse -204 -223 11.2092 0.131
NP_441203.1_1 Reverse -204 -223 -4.42544 0.0774
NP_440914.1_1 Forward -212 -202 7.93196 0.214
NP_440914.1_1 Reverse -203 -213 7.24882 0.242
NP_441011.1_8 Forward -114 -105 14.356 0.0249
NP_441011.1_8 Reverse -107 -116 8.25953 0.144
NP_441011.1_8 Reverse -204 -213 6.78456 0.184
NP_442533.1_6 Reverse -203 -212 7.57121 0.0898
NP_442533.1_6 Forward -212 -203 7.47288 0.0898
NP_442533.1_6 Reverse -106 -115 5.70292 0.132
NP_442533.1_6 Forward -115 -106 4.42462 0.179
NP_442322.1_4 Forward -200 -183 -3.60008 0.249
NP_442322.1_4 Reverse -98 -115 -3.69841 0.251
NP_441482.1_7 Forward -218 -204 -1.5737 0.0755
NP_441482.1_7 Forward -121 -107 -11.5051 0.268
NP_439944.1_9 Forward -114 -104 13.5497 0.056
NP_439944.1_9 Forward -211 -201 9.81313 0.098
NP_439944.1_9 Reverse -204 -214 7.84651 0.127
NP_439944.1_9 Reverse -107 -117 6.37155 0.184
NP_442269.1_10 Reverse -198 -217 1.67108 0.287
NP_441697.1_5 Reverse -11 -30 -11.6982 0.298
NP_442664.1_3 Reverse -85 -99 11.406 0.249
NP_440115.1_6 Forward -103 -93 14.3364 0.0615
NP_440115.1_6 Forward -215 -205 7.45319 0.147
NP_440007.1_9 Forward -216 -202 2.5562 0.277
NP_440007.1_9 Forward -119 -105 1.17956 0.29
NP_441972.1_5 Reverse -204 -223 -1.7705 0.178
NP_441106.1_1 Forward -116 -107 14.4544 0.0233
NP_441106.1_1 Forward -213 -204 8.75118 0.0469
NP_441106.1_1 Reverse -105 -114 7.76787 0.0764
NP_439903.1_6 Reverse -103 -122 3.44025 0.21
NP_441286.1_1 Reverse -202 -214 4.5622 0.032
NP_441286.1_1 Forward -213 -201 2.79224 0.0532
NP_440670.1_8 Forward -212 -203 9.53783 0.0559
NP_440670.1_8 Reverse -203 -212 9.14451 0.0583
NP_441886.1_1 Reverse -88 -107 4.42435 0.164
NP_442072.1_9 Forward -213 -195 -20.532 0.204
NP_442072.1_9 Reverse -202 -220 -22.4986 0.241
NP_442072.1_9 Reverse -292 -310 -22.892 0.266
NP_440907.2_8 Forward -211 -201 7.64939 0.117
NP_440664.1_4 Reverse -48 -67 5.89931 0.218
NP_441626.1_2 Forward -114 -107 6.52896 0.137
NP_441626.1_2 Forward -211 -204 6.13563 0.177
NP_441626.1_2 Reverse -204 -211 5.93897 0.231
NP_441626.1_2 Reverse -107 -114 5.93897 0.231
NP_442365.1_7 Forward -216 -197 -4.81876 0.25
NP_442615.1_1 Reverse -194 -212 -2.73412 0.148
NP_440130.1_5 Reverse -8 -27 15.8307 0.0749
NP_441962.1_4 Forward -114 -95 -12.2919 0.255
NP_441962.1_4 Reverse -198 -217 -13.2752 0.271
NP_440387.1_1 Forward -212 -196 5.56507 0.0315
NP_440855.1_5 Forward -111 -92 3.34192 0.287
NP_441431.1_3 Forward -395 -376 6.88262 0.25
NP_441836.1_2 Forward -103 -84 -5.60541 0.284
NP_440114.1_10 Reverse -106 -120 14.3559 0.0418
NP_442323.1_1 Forward -89 -70 16.5191 0.236
NP_442323.1_7 Reverse -101 -120 14.5516 0.076
NP_441552.1_3 Reverse -196 -215 12.585 0.292
NP_440766.1_4 Forward -113 -99 2.2612 0.191
NP_441237.1_9 Forward -211 -201 12.8614 0.102
NP_440457.1_1 Forward -216 -204 8.10212 0.101
NP_441801.1_4 Forward -221 -211 2.63497 0.29
NP_440801.1_10 Forward -113 -94 5.50599 0.289
NP_440554.1_4 Reverse -107 -117 15.2213 0.02
NP_440554.1_4 Forward -114 -104 8.4365 0.0749
NP_440554.1_4 Reverse -204 -214 6.46988 0.123
NP_441885.1_5 Forward -212 -202 11.4848 0.00668
NP_441885.1_5 Reverse -203 -213 1.55333 0.109
NP_441275.1_1 Forward -24 -6 1.29745 0.253
NP_442703.1_9 Forward -132 -114 3.95239 0.266
NP_442341.1_7 Reverse -202 -216 10.226 0.0678
NP_441756.1_5 Reverse -222 -241 -1.08219 0.253
NP_443000.1_7 Forward -214 -204 7.74818 0.0666
NP_443000.1_7 Forward -117 -107 7.05986 0.102
NP_443000.1_7 Reverse -104 -114 6.96153 0.109
NP_443000.1_7 Reverse -201 -211 0.57002 0.294
NP_441842.1_10 Forward -219 -205 6.29277 0.296
NP_442122.1_8 Forward -283 -265 19.7837 0.177
NP_440275.1_3 Reverse -201 -211 8.04317 0.0602
NP_440091.1_1 Reverse -199 -211 10.7571 0.0429
NP_440149.1_8 Forward -115 -96 -0.0988766 0.144
NP_441105.1_3 Forward -354 -335 -2.36049 0.159
NP_440216.1_1 Reverse -203 -217 -2.26202 0.0484
NP_440216.1_1 Forward -212 -198 -10.3252 0.145
NP_440216.1_9 Forward -90 -81 15.536 0.128
NP_440172.1_1 Reverse -203 -213 7.94484 0.0705
NP_440172.1_1 Forward -115 -105 7.35486 0.0819
NP_440172.1_1 Reverse -260 -270 5.28991 0.146
NP_440172.1_1 Forward -212 -202 5.28991 0.146
NP_440167.1_3 Reverse -193 -212 10.9142 0.233
NP_442015.1_10 Forward -216 -203 1.69091 0.204
NP_441226.1_7 Reverse -107 -114 14.1984 0.024
NP_441111.1_7 Forward -211 -203 8.96754 0.0463
NP_441111.1_7 Reverse -204 -212 8.86921 0.0589
NP_442379.1_10 Reverse -196 -213 6.13536 0.118
NP_441766.1_2 Reverse -203 -212 7.76787 0.0714
NP_441766.1_2 Forward -212 -203 7.76787 0.0714
NP_442417.1_5 Reverse -203 -217 7.47274 0.188
NP_440261.1_5 Reverse -92 -105 -3.4223 0.132
NP_440261.1_5 Reverse -204 -217 -10.9938 0.23
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

ACCGGGAAAACTGGGAAGCAGGTTGATGTAAAAAGCTTCAGGTACTAAATTGGCCCCTGAGCTTCCATCCTCTTGGATGAGATTATTCGTCAGCGTAAACAGAACGCCCTCAACTATGAAGCCTATCTACAAGAGCTTGCCACTCTGGTCAGAAAAGTAGCAACAGGGCAGTCCGACGATACTCCCAAGGCGATCGACACTCCCGCCAAGCGTGCCCTTTACAATAACCTAGGACAGGACGAAATCTTGACCCTCAAAGTACACCAGGCAGTAATGAGTAGTAAAAGCGATGGCTTTCGGGGCAATCAAGCCAAGGAAAACCTGATCAAACAAGCTCTATACCAAGTTCTGAATGATGTGGACAGAGTGGAGCAGATTTTTAACATTGTTAAACAGCAGG

CDS

ATGAATACTAGCATCACCACCACTCTGCACTTGGGAGAACTGACCGTTGCCATTACCTACAAAGGGATTAAAAATGTGCATCTAACAGTTCATCCTCCCCAAGGAGAAGTGCGAGTATCGGCACCCTTGACCATGAACCCTGATACAGTGCGAGTCTTTATCATTTCTAAGCTTGCTTGGATCAGACAACAACGCCGTAGGATCCTAGCCCAGGAAAGGGAAGCCCCTAGGGAGTATGTAAACCGGGAAAGTCATCTTGTCTGGGGTCAACGTTACCTGTTGAAAGTGGTGGAGCACCAAGCACCACCAAAAGTAAACCTTGCTCCCAAGACTTTGGATCTTTATGTTCGTCCCCACACCCCCCAGGAGAAGCGCCACCAAGTGATCAGTGAATGGTACCGTCAACAAATCAAAGATGTAGTCCCTGGTCTCATTGCTAAGTATGAGACCGTTATGGGAGTCGAAGTGCGTGAATTTGGAGTTAAACGAATGAAGACCCGCTGGGGCACCTGTAACCCCAGGGCTCAGCGTATTTGGCTCAACCTAGAGTTAGCAAAAAAGCCCCCAGCCTGCCTAGAGTACGTCGTAGTTCACGAGATGACCCATCTACTAGAACCTAAGCATAATGACCGCTTCTGGGGATTCATAGATAGCTTTTACCCGCAGTGGCAACACTATAGAGATGAGCTTAACCGCTTACCCCTAGGGTGA

Protein

No sequence available