Your browser is old and dusty. Try Google Chrome!

Details for sll8035

ORF sll8035
Accession NP_942429.1
Symbol
Category
Definition
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_441061.1_2 Forward -148 -134 -1.77037 0.272
NP_440795.1_7 Reverse -135 -142 8.8889 0.188
NP_441418.1_1 Forward -90 -71 8.35512 0.258
NP_441453.1_1 Forward -205 -187 4.04996 0.263
NP_441818.1_1 Forward -290 -279 9.00628 0.267
NP_441818.1_9 Forward -167 -148 -10.227 0.292
NP_440226.1_1 Reverse -42 -61 2.45773 0.263
NP_440150.1_6 Forward -343 -324 3.53937 0.248
NP_442173.1_1 Reverse -195 -203 5.13263 0.226
NP_439997.1_3 Forward -41 -22 16.3224 0.13
NP_441812.1_3 Reverse -57 -71 6.98109 0.287
NP_440061.1_9 Reverse -138 -152 6.29216 0.251
NP_442062.1_8 Reverse -140 -150 3.02829 0.289
NP_440761.1_4 Reverse -129 -148 -19.2734 0.28
NP_440304.1_4 Reverse -88 -98 2.24165 0.299
NP_442602.1_3 Reverse -131 -150 7.7676 0.111
NP_441161.1_1 Reverse -23 -42 16.7149 0.176
NP_441208.1_9 Reverse -211 -225 6.88276 0.229
NP_440132.1_1 Forward -339 -321 11.6222 0.206
NP_442110.1_7 Reverse -134 -148 3.24451 0.213
NP_441083.1_5 Forward -198 -188 5.5849 0.112
NP_441083.1_5 Forward -301 -291 2.14332 0.195
NP_442827.1_8 Forward -75 -56 0.195343 0.214
NP_440209.1_1 Reverse -375 -383 2.08437 0.286
NP_440178.1_7 Forward -150 -131 -23.1083 0.294
NP_442570.1_3 Reverse -132 -151 -9.24366 0.296
NP_441163.1_1 Forward -156 -139 8.69123 0.226
NP_440747.1_10 Reverse -279 -291 -12.3507 0.27
NP_441130.1_7 Reverse -252 -266 14.8469 0.287
NP_440403.1_4 Reverse -258 -277 -1.37718 0.174
NP_440403.1_4 Reverse -283 -302 -3.44213 0.197
NP_440842.1_10 Reverse -95 -109 3.8345 0.254
NP_441012.1_4 Reverse -70 -83 10.4424 0.262
NP_443018.1_3 Reverse -313 -320 5.34899 0.212
NP_443018.1_3 Forward -142 -135 4.56234 0.241
NP_443018.1_3 Reverse -135 -142 4.46401 0.244
NP_441634.1_8 Reverse -280 -294 -2.95034 0.295
NP_440376.1_1 Reverse -140 -149 4.42462 0.159
NP_440376.1_1 Reverse -282 -291 3.93297 0.188
NP_442687.1_7 Forward -150 -140 6.46988 0.165
NP_442191.1_4 Reverse -283 -297 12.2535 0.221
NP_442485.1_3 Forward -154 -135 -3.24547 0.272
NP_440642.1_10 Forward -41 -27 7.47213 0.221
NP_442296.1_9 Reverse -147 -166 6.19431 0.127
NP_441763.1_10 Forward -154 -135 9.83173 0.176
NP_441763.1_10 Forward -302 -283 6.39016 0.269
NP_440360.1_10 Reverse -142 -156 2.75286 0.261
NP_442658.1_1 Forward -293 -283 7.94438 0.199
NP_442658.1_1 Reverse -388 -398 5.28945 0.274
NP_442658.1_1 Reverse -132 -142 4.7978 0.297
NP_442205.1_9 Forward -73 -57 -3.97304 0.3
NP_442544.1_2 Forward -268 -254 -0.000409212 0.217
NP_441487.1_9 Reverse -284 -303 1.86774 0.196
NP_441162.1_3 Forward -379 -360 9.43923 0.242
NP_440369.1_6 Forward -215 -196 10.6192 0.25
NP_440062.1_6 Forward -379 -360 8.55425 0.235
NP_442002.1_9 Forward -150 -143 11.1505 0.185
NP_442002.1_9 Reverse -103 -110 11.1505 0.185
NP_441000.1_6 Reverse -327 -341 -0.000409212 0.2
NP_441550.1_8 Reverse -187 -197 7.84605 0.144
NP_441550.1_8 Forward -200 -190 5.19112 0.26
NP_441041.1_1 Forward -381 -362 13.7658 0.181
NP_441041.1_4 Reverse -134 -153 -8.16202 0.197
NP_441041.1_7 Forward -294 -282 12.4708 0.0611
NP_441041.1_7 Forward -387 -375 6.25147 0.216
NP_439966.1_7 Forward -293 -283 4.30615 0.279
NP_439966.1_9 Reverse -373 -382 9.83282 0.215
NP_440289.1_2 Forward -294 -281 -0.570702 0.202
NP_440260.1_8 Reverse -137 -155 -7.15901 0.295
NP_440375.1_8 Reverse -99 -118 -1.96717 0.298
NP_441644.1_6 Reverse -134 -144 3.12618 0.297
NP_442215.1_2 Reverse -144 -160 -6.92296 0.281
NP_440253.1_2 Reverse -194 -212 4.44404 0.104
NP_440253.1_2 Forward -291 -273 -0.570838 0.216
NP_442554.1_8 Reverse -135 -145 3.32329 0.23
NP_442554.1_8 Forward -240 -230 2.92996 0.249
NP_442554.1_9 Forward -34 -15 13.2644 0.279
NP_441762.1_7 Forward -385 -373 -3.30428 0.1
NP_442142.1_4 Reverse -279 -292 4.73861 0.212
NP_442142.1_4 Reverse -18 -31 4.14862 0.231
NP_440279.1_2 Reverse -364 -383 13.6675 0.0895
NP_441448.1_1 Forward -269 -250 4.03102 0.28
NP_440183.1_9 Reverse -314 -333 -20.7484 0.292
NP_441198.1_8 Reverse -132 -142 10.7322 0.247
NP_440379.1_5 Reverse -285 -304 -9.53865 0.264
NP_440379.1_5 Reverse -312 -331 -11.0136 0.288
NP_441468.1_1 Reverse -135 -142 3.97235 0.277
NP_441618.1_3 Reverse -357 -376 2.3594 0.228
NP_441673.1_1 Forward -291 -282 -8.06341 0.254
NP_441731.1_5 Reverse -268 -285 18.2301 0.151
NP_441339.1_4 Reverse -133 -152 -2.95047 0.227
NP_441826.1_2 Reverse -360 -374 -4.62196 0.298
NP_442868.1_6 Reverse -280 -290 9.7148 0.0411
NP_442542.1_2 Forward -293 -280 15.9489 0.0762
NP_442542.1_2 Forward -151 -138 5.91914 0.244
NP_442739.1_4 Reverse -310 -323 19.3905 0.281
NP_442789.1_4 Reverse -321 -340 -7.67036 0.299
NP_441878.1_6 Reverse -57 -67 -0.0199663 0.163
NP_441878.1_6 Forward -150 -140 -6.60814 0.193
NP_440614.1_1 Reverse -34 -53 13.6675 0.179
NP_441445.1_1 Reverse -360 -379 2.45773 0.233
NP_442777.1_1 Forward -37 -18 6.48849 0.266
NP_442419.1_2 Forward -377 -358 0.196116 0.243
NP_442397.1_9 Forward -258 -239 0.982764 0.299
NP_442444.1_8 Forward -301 -282 17.6982 0.277
NP_442347.1_2 Forward -197 -188 6.19458 0.182
NP_442645.1_2 Forward -238 -219 -14.9469 0.185
NP_442645.1_2 Reverse -132 -151 -16.6185 0.237
NP_441633.1_3 Reverse -280 -293 -6.2739 0.242
NP_441633.1_3 Reverse -290 -303 -6.47056 0.253
NP_441633.1_3 Forward -386 -373 -6.56889 0.259
NP_442590.1_10 Forward -37 -18 5.211 0.267
NP_442998.1_5 Reverse -102 -112 13.943 0.155
NP_442283.1_2 Forward -42 -23 7.66927 0.279
NP_440748.1_5 Forward -207 -188 -1.37718 0.267
NP_441464.1_8 Forward -203 -189 3.8345 0.287
NP_439985.1_7 Reverse -86 -105 6.68596 0.192
NP_442993.1_1 Reverse -134 -150 -10.7579 0.226
NP_441340.1_5 Forward -142 -135 11.0522 0.0749
NP_441340.1_9 Reverse -34 -44 8.93007 0.256
NP_441271.1_1 Reverse -188 -206 12.5064 0.236
NP_441947.1_4 Forward -78 -59 17.7974 0.0763
NP_440161.1_3 Reverse -19 -38 13.6675 0.132
NP_442251.1_6 Forward -383 -376 9.77388 0.162
NP_439937.1_8 Forward -377 -358 -1.08219 0.248
NP_440408.1_3 Reverse -258 -277 -2.65548 0.253
NP_440439.1_1 Forward -70 -57 0.510939 0.188
NP_440439.1_1 Reverse -289 -302 -0.964025 0.244
NP_440316.1_10 Forward -292 -282 9.91146 0.235
NP_442114.1_4 Reverse -282 -293 8.51513 0.197
NP_442262.1_10 Forward -142 -135 7.90559 0.266
NP_442262.1_10 Reverse -313 -320 7.6106 0.274
NP_441689.1_5 Forward -53 -43 5.19112 0.282
NP_442165.1_2 Reverse -138 -151 16.2439 0.281
NP_440531.1_6 Forward -75 -56 -4.6221 0.284
NP_441060.1_1 Forward -260 -241 11.7915 0.294
NP_441060.1_3 Reverse -100 -119 7.27595 0.297
NP_440297.1_9 Reverse -135 -145 6.96153 0.161
NP_440894.1_10 Reverse -287 -306 7.57094 0.202
NP_440999.1_9 Forward -295 -281 2.94952 0.14
NP_440888.1_2 Reverse -282 -296 12.2903 0.0476
NP_439969.1_3 Forward -296 -277 -2.16383 0.297
NP_442948.1_2 Reverse -368 -387 5.30933 0.256
NP_442277.1_2 Forward -41 -27 10.4227 0.287
NP_442033.1_10 Reverse -280 -299 -14.5535 0.299
NP_441543.1_2 Forward -142 -133 7.57121 0.113
NP_441834.1_10 Reverse -135 -154 4.42435 0.26
NP_441469.1_8 Forward -292 -283 11.7994 0.145
NP_442578.1_5 Reverse -362 -381 -0.0988766 0.283
NP_440710.1_1 Reverse -234 -252 -6.56903 0.225
NP_441621.1_7 Reverse -364 -378 -6.29359 0.283
NP_443062.1_6 Forward -38 -19 2.26107 0.258
NP_442204.1_5 Forward -233 -214 3.24438 0.193
NP_440516.1_8 Forward -291 -282 -0.196935 0.185
NP_440516.1_8 Reverse -189 -198 -0.590259 0.283
NP_442428.1_4 Forward -338 -319 8.75091 0.17
NP_442428.1_5 Reverse -135 -142 4.36568 0.271
NP_442120.1_10 Forward -155 -136 -15.0452 0.289
NP_440673.1_3 Reverse -23 -30 9.67555 0.179
NP_440673.1_3 Reverse -44 -51 9.08556 0.202
NP_441052.1_2 Forward -198 -188 5.38824 0.12
NP_440436.1_4 Reverse -283 -292 5.40752 0.204
NP_442412.1_4 Reverse -62 -81 17.994 0.166
NP_440648.1_1 Reverse -189 -208 3.6377 0.242
NP_442907.1_9 Forward -98 -79 -2.45882 0.255
NP_442873.1_2 Forward -305 -286 16.8132 0.178
NP_441115.1_4 Forward -68 -50 11.0314 0.154
NP_442694.1_3 Reverse -88 -106 -4.8974 0.276
NP_443054.1_2 Reverse -280 -294 -0.295402 0.293
NP_442308.1_7 Reverse -138 -157 16.464 0.212
NP_442515.1_1 Forward -102 -88 0.0979218 0.203
NP_442515.1_1 Reverse -139 -153 -0.492064 0.224
NP_440940.1_7 Forward -301 -283 3.8533 0.271
NP_441003.1_9 Reverse -217 -236 4.32602 0.281
NP_443047.1_7 Forward -50 -31 5.99764 0.228
NP_441432.1_8 Reverse -139 -148 5.40793 0.158
NP_441432.1_8 Reverse -133 -142 3.04799 0.268
NP_441432.1_9 Reverse -206 -219 7.91967 0.298
NP_441732.1_2 Forward -147 -131 -17.0511 0.231
NP_442003.1_9 Reverse -90 -109 12.3892 0.17
NP_440760.1_1 Forward -149 -130 -22.5183 0.261
NP_442353.1_4 Forward -232 -213 0.195343 0.28
NP_442489.1_7 Forward -149 -140 -1.57357 0.213
NP_442489.1_7 Reverse -140 -149 -1.6719 0.235
NP_442489.1_7 Reverse -282 -291 -1.77023 0.247
NP_442489.1_7 Forward -67 -58 -1.86856 0.259
NP_440565.1_3 Forward -39 -20 14.516 0.264
NP_440860.1_8 Reverse -364 -383 19.0757 0.0989
NP_440779.1_5 Forward -101 -84 -15.0058 0.3
NP_442346.1_1 Forward -375 -356 12.9791 0.27
NP_442346.1_5 Reverse -133 -143 8.33817 0.14
NP_440545.1_3 Reverse -130 -147 -4.38605 0.224
NP_440831.1_3 Reverse -283 -302 4.83391 0.298
NP_440459.1_2 Reverse -290 -307 8.10198 0.27
NP_440459.1_8 Forward -308 -290 6.80398 0.291
NP_440010.1_4 Reverse -356 -375 -2.65624 0.288
NP_440010.1_10 Reverse -309 -328 4.42435 0.244
NP_440010.1_10 Reverse -316 -335 2.94938 0.267
NP_442551.1_4 Forward -254 -239 -3.36336 0.287
NP_442603.1_7 Forward -198 -184 6.98048 0.221
NP_443022.1_1 Forward -59 -40 10.0292 0.231
NP_441948.1_4 Forward -391 -373 7.00065 0.063
NP_441158.1_2 Reverse -212 -231 14.3558 0.135
NP_441833.1_4 Forward -383 -376 11.0522 0.0559
NP_440671.1_4 Reverse -36 -50 8.65272 0.193
NP_442045.1_5 Reverse -248 -267 0.884433 0.266
NP_442140.1_3 Reverse -376 -386 5.87989 0.194
NP_441813.1_3 Forward -347 -328 16.4673 0.238
NP_439901.1_1 Reverse -362 -381 4.42435 0.235
NP_440590.1_4 Reverse -283 -296 4.34585 0.0614
NP_440821.1_4 Forward -293 -283 -0.41329 0.257
NP_441239.1_9 Reverse -192 -204 3.08724 0.296
NP_440156.1_2 Forward -71 -52 15.1424 0.2
NP_441892.1_1 Forward -152 -135 -4.87771 0.269
NP_442044.1_1 Forward -203 -184 -5.21209 0.187
NP_440796.1_5 Forward -324 -311 20.6688 0.151
NP_442629.1_3 Reverse -76 -95 -0.688862 0.298
NP_440354.1_7 Reverse -251 -269 10.7372 0.224
NP_442340.1_3 Reverse -23 -42 -7.96535 0.241
NP_442499.1_1 Forward -106 -87 6.58763 0.203
NP_441249.1_8 Forward -24 -5 4.12936 0.259
NP_442402.1_4 Reverse -340 -359 -8.94939 0.285
NP_442402.1_10 Reverse -214 -224 12.0743 0.224
NP_440696.1_3 Reverse -130 -148 -2.43913 0.274
NP_442039.1_7 Forward -264 -254 7.84651 0.271
NP_440753.1_5 Reverse -131 -150 14.2574 0.122
NP_439994.1_3 Reverse -57 -76 7.85324 0.298
NP_442053.1_1 Forward -67 -58 5.60459 0.176
NP_440505.1_3 Forward -293 -283 9.41981 0.122
NP_442532.1_7 Forward -384 -370 10.0294 0.171
NP_440914.1_1 Reverse -390 -400 8.51751 0.186
NP_442533.1_6 Forward -67 -58 2.35967 0.259
NP_441482.1_7 Reverse -134 -148 -11.4068 0.262
NP_439944.1_9 Reverse -135 -145 10.2065 0.0917
NP_441106.1_1 Reverse -133 -142 4.62128 0.213
NP_440646.1_1 Reverse -22 -41 3.24438 0.17
NP_441825.1_4 Reverse -77 -87 15.123 0.218
NP_440670.1_8 Forward -203 -194 3.24465 0.29
NP_440886.1_7 Forward -292 -282 4.50281 0.232
NP_440205.1_6 Forward -107 -88 21.828 0.0519
NP_440513.1_4 Forward -301 -282 10.5209 0.271
NP_440028.1_6 Forward -167 -149 13.2938 0.24
NP_439967.1_7 Forward -88 -70 14.5721 0.136
NP_441463.1_6 Forward -254 -240 6.70583 0.267
NP_442221.1_4 Forward -267 -248 11.0125 0.282
NP_441962.1_4 Reverse -361 -380 -6.39206 0.176
NP_441962.1_4 Reverse -277 -296 -7.4737 0.189
NP_441962.1_4 Reverse -57 -76 -12.3902 0.256
NP_441962.1_4 Forward -203 -184 -14.7502 0.293
NP_441993.1_1 Forward -375 -356 0.777198 0.292
NP_442352.1_1 Reverse -369 -382 14.3903 0.252
NP_440114.1_10 Reverse -134 -148 6.98109 0.25
NP_440114.1_10 Forward -51 -37 6.88276 0.253
NP_440293.1_3 Reverse -132 -151 -5.50708 0.279
NP_439988.1_9 Reverse -28 -47 12.8808 0.241
NP_440422.1_10 Reverse -363 -382 4.69232 0.281
NP_442103.1_2 Reverse -161 -179 12.0147 0.246
NP_442940.1_2 Reverse -140 -159 -0.0988766 0.296
NP_442509.1_9 Forward -384 -374 7.74772 0.205
NP_440524.1_2 Reverse -23 -42 -4.81876 0.283
NP_440554.1_4 Forward -142 -132 4.79825 0.175
NP_441845.1_6 Reverse -363 -381 13.3922 0.0973
NP_442737.1_7 Reverse -212 -231 23.1072 0.0232
NP_442341.1_7 Reverse -291 -305 4.32615 0.194
NP_442395.2_4 Forward -204 -185 1.47364 0.24
NP_441307.1_4 Reverse -65 -84 2.55606 0.221
NP_443010.1_10 Forward -294 -277 3.06069 0.265
NP_440149.1_8 Forward -149 -130 -2.0655 0.164
NP_441105.1_3 Forward -160 -141 -3.14714 0.173
NP_441105.1_3 Forward -112 -93 -7.67036 0.258
NP_441105.1_3 Forward -154 -135 -8.45701 0.272
NP_440216.1_1 Forward -291 -277 -9.83351 0.145
NP_440172.1_1 Forward -291 -281 3.32329 0.232
NP_441226.1_7 Reverse -258 -265 9.47853 0.147
NP_441111.1_7 Reverse -283 -291 -0.668896 0.274
NP_440416.1_9 Forward -332 -313 -21.4367 0.294
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

TCGCCTTTGTCTGCTCTAAGATCGCGGCAGTCAAGCCGGTCTGGTCTAAACAAGTGAGAAACCGTTGAGCGGCCTGCCGCTCAATGGGAAGTAACCAGGGCAGATCAGCGGCAGTCGCGAGTCGAATTGTATCCCCCGTTGGCAGTATGGGCATTATCCTGACATGGTCTGACCAGCGGTGAAAAGCCAGCTTAAACGGCGACCTGATCACCACAATGTTAGGGCATAACACTTGTATTGAGAATGGTGCGGGCAAATGCCATAGCTTCCCATAGACGGATATTCCATAGATTTGCCCTAGAGACAGCACCCTAGAAAACCCCTACCGTTGAAGTCGAGCACCCAAGAAAGCAATCAGGTTTTCCTTACCCGCAATGGTTCTGTTTTAGAGGTATTTCTG

CDS

ATGTTTGCCAACGTGATCGCCACCCTATTTCGCATGGATGATCAGACTTGGCGGGGCCACGCTAATCCCTGGTGTGTCTGGACTCGTTTAACTGTTGCTCCCTTACTACTTCTATCAGTCTGGAGCAGAGTCTGGTTGGGCTGGTGGTCACTGATTCCCATTGCAATAGCCCTACTCTGGAACTGGTACAACGCCCGTCTATTTTCGCCTCCCCAATCTACCGACAACTGGGCATCTAAAGGCGTCCTGGGTGAGCGGGTATGGATCAACCGCCATCAAGTTTCTATTCCAACCCATCACTATACCTTTCCCCATTTCCTGGCAGGACTTGCCGCCGTCGGCTCCGTCATAGCCATTTGCGGACTTTGGGCATTGAACCTGCCTTTGACGCTACTGGGGCTGTTGCTACTCTACATGGGCAAACTTTGGTTTTTTGATCGCATGGTATGGCTTTACGAAGACATGAAAACTGCCACTCCTGAATACACAAGCTGGCTCTACTAA

Protein

No sequence available