Your browser is old and dusty. Try Google Chrome!

Details for sll8034

ORF sll8034
Accession NP_942428.1
Symbol
Category Other
Definition 2-nitropropane dioxygenase
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_441061.1_2 Forward -214 -200 3.34284 0.165
NP_441061.1_2 Forward -391 -377 -1.37704 0.258
NP_440795.1_7 Reverse -195 -202 8.39725 0.213
NP_440897.1_6 Reverse -214 -233 1.27698 0.171
NP_441453.1_8 Reverse -228 -245 12.2319 0.205
NP_442151.1_6 Forward -203 -189 8.84938 0.164
NP_440226.1_1 Forward -115 -96 3.04771 0.241
NP_442287.1_3 Forward -336 -319 14.3944 0.282
NP_442752.1_4 Forward -298 -291 10.8555 0.0846
NP_442752.1_4 Reverse -334 -341 6.52896 0.154
NP_443027.1_4 Reverse -104 -114 9.41981 0.163
NP_441225.1_4 Forward -216 -197 -5.11376 0.27
NP_440878.1_9 Forward -225 -206 5.30933 0.174
NP_442062.1_8 Forward -180 -170 6.17489 0.136
NP_442062.1_8 Reverse -377 -387 5.28991 0.176
NP_442062.1_8 Reverse -274 -284 3.91327 0.243
NP_441641.1_4 Reverse -105 -124 8.35759 0.296
NP_440304.1_4 Reverse -375 -385 7.55152 0.109
NP_440304.1_4 Reverse -204 -214 4.50326 0.261
NP_441594.1_6 Reverse -197 -216 -0.39387 0.299
NP_442110.1_7 Reverse -377 -391 8.25939 0.0953
NP_440273.1_2 Forward -282 -263 13.3716 0.288
NP_441083.1_5 Reverse -289 -299 4.69992 0.134
NP_440109.1_8 Reverse -222 -241 10.3242 0.246
NP_442889.1_8 Reverse -374 -388 7.07881 0.163
NP_442889.1_8 Reverse -103 -117 5.21053 0.235
NP_441327.1_5 Reverse -338 -347 13.9627 0.261
NP_442111.1_4 Forward -387 -373 5.40779 0.166
NP_442111.1_4 Reverse -288 -302 4.71948 0.194
NP_440747.1_10 Forward -389 -377 -12.0557 0.199
NP_441014.1_5 Reverse -195 -213 9.16393 0.286
NP_441014.1_8 Forward -331 -312 -8.85033 0.288
NP_442848.1_5 Forward -84 -66 -0.865831 0.276
NP_441012.1_4 Reverse -368 -381 8.37742 0.272
NP_443018.1_3 Forward -391 -384 7.6106 0.156
NP_442730.1_8 Forward -394 -375 4.52188 0.273
NP_442687.1_7 Forward -204 -194 7.45319 0.132
NP_442687.1_7 Reverse -157 -167 5.38824 0.206
NP_442687.1_7 Forward -131 -121 3.71661 0.292
NP_441846.1_10 Forward -308 -289 -13.2752 0.201
NP_442958.1_3 Reverse -195 -214 4.12936 0.253
NP_440642.1_10 Forward -247 -233 3.93223 0.264
NP_440141.1_8 Reverse -150 -169 5.01433 0.278
NP_441855.2_4 Forward -344 -325 11.9332 0.204
NP_441580.1_6 Reverse -148 -167 -1.18052 0.186
NP_440153.1_5 Forward -214 -200 0.687908 0.291
NP_441591.1_10 Forward -170 -151 5.30933 0.297
NP_442064.1_4 Forward -396 -377 9.24175 0.209
NP_443055.1_6 Reverse -274 -292 -1.9482 0.285
NP_440496.1_9 Forward -239 -220 -4.03212 0.263
NP_442002.1_9 Forward -131 -124 12.2322 0.185
NP_440809.1_5 Forward -301 -282 6.29264 0.228
NP_440809.1_8 Forward -118 -99 11.3075 0.21
NP_441646.1_1 Reverse -376 -395 2.45773 0.218
NP_441295.1_4 Forward -166 -147 4.22769 0.29
NP_441916.1_7 Reverse -141 -151 3.32329 0.22
NP_441916.1_10 Forward -91 -72 3.6377 0.227
NP_441041.1_4 Reverse -194 -213 -9.53865 0.218
NP_441041.1_4 Reverse -377 -396 -12.6852 0.272
NP_441725.1_5 Forward -385 -375 2.24165 0.115
NP_441725.1_5 Reverse -378 -388 -1.19994 0.294
NP_440177.1_1 Reverse -201 -219 3.06741 0.295
NP_442215.1_2 Forward -205 -189 -4.66135 0.237
NP_442215.1_7 Reverse -156 -175 18.7807 0.159
NP_441310.1_10 Reverse -19 -29 16.0827 0.115
NP_441751.2_8 Forward -385 -371 -2.55701 0.132
NP_442926.1_3 Reverse -195 -214 11.6025 0.119
NP_442554.1_8 Forward -214 -204 6.27322 0.123
NP_442554.1_9 Forward -156 -137 14.1224 0.269
NP_442142.1_4 Forward -280 -267 7.59019 0.135
NP_441448.1_1 Reverse -317 -336 5.50599 0.261
NP_441015.1_10 Reverse -201 -220 -9.34199 0.282
NP_441826.1_2 Reverse -371 -385 -0.983719 0.23
NP_442808.1_1 Forward -204 -194 5.09279 0.173
NP_442542.1_2 Forward -152 -139 7.78743 0.17
NP_440385.1_5 Forward -298 -279 17.2074 0.255
NP_441114.1_3 Reverse -172 -181 8.25953 0.231
NP_440558.1_2 Reverse -211 -230 -6.29373 0.273
NP_440558.1_2 Forward -227 -208 -7.17871 0.289
NP_442792.1_5 Forward -201 -184 11.7402 0.285
NP_441878.1_6 Reverse -376 -386 -7.00147 0.201
NP_441878.1_6 Reverse -352 -362 -7.29646 0.217
NP_441557.1_8 Forward -221 -211 12.5659 0.236
NP_441445.1_1 Reverse -265 -284 0.687771 0.27
NP_442170.1_5 Forward -298 -279 2.3594 0.178
NP_442347.1_2 Forward -397 -388 5.99792 0.201
NP_442347.1_2 Forward -114 -105 3.04799 0.289
NP_442645.1_2 Forward -226 -207 -22.42 0.291
NP_441037.1_4 Reverse -204 -214 9.26684 0.225
NP_442594.1_8 Reverse -227 -246 7.7676 0.213
NP_441633.1_3 Forward -388 -375 -5.48725 0.236
NP_442590.1_10 Forward -221 -202 9.53756 0.196
NP_442590.1_10 Forward -230 -211 4.42435 0.276
NP_440299.1_1 Forward -390 -377 8.77016 0.0851
NP_441799.1_1 Forward -260 -246 7.17714 0.149
NP_440256.1_1 Forward -200 -181 -2.85214 0.123
NP_441559.1_8 Forward -228 -214 -6.88358 0.281
NP_441296.1_5 Forward -241 -222 12.1925 0.291
NP_440319.1_5 Reverse -165 -184 16.6165 0.265
NP_442866.1_1 Forward -220 -201 -0.885524 0.202
NP_442386.1_5 Reverse -137 -156 7.27514 0.211
NP_440146.1_8 Forward -179 -161 15.2777 0.255
NP_440161.1_3 Forward -327 -308 8.16093 0.276
NP_440586.1_8 Reverse -107 -114 12.6251 0.0546
NP_440586.1_8 Forward -276 -269 10.7568 0.128
NP_441262.1_3 Reverse -106 -113 5.15232 0.265
NP_439937.1_8 Reverse -201 -220 2.26107 0.217
NP_439937.1_9 Reverse -166 -183 -11.4665 0.256
NP_441595.1_5 Reverse -275 -293 5.13236 0.262
NP_440408.1_7 Reverse -377 -396 9.83255 0.255
NP_440626.1_1 Forward -214 -195 8.94676 0.28
NP_442239.1_8 Forward -227 -208 7.7676 0.255
NP_440316.1_10 Reverse -228 -238 5.78156 0.281
NP_441803.1_2 Reverse -207 -226 -0.885524 0.291
NP_440139.1_1 Reverse -371 -390 8.25844 0.115
NP_440210.1_10 Forward -248 -229 8.84842 0.262
NP_442262.1_10 Forward -391 -384 8.8889 0.219
NP_440531.1_6 Reverse -186 -205 5.70265 0.112
NP_441965.1_10 Reverse -244 -260 3.10679 0.274
NP_440297.1_9 Reverse -378 -388 4.79825 0.22
NP_440297.1_9 Forward -385 -375 1.84832 0.27
NP_440350.1_2 Reverse -67 -86 9.3409 0.248
NP_440999.1_2 Reverse -378 -397 8.55425 0.288
NP_440888.1_2 Forward -398 -384 8.84875 0.145
NP_441123.1_6 Forward -370 -352 11.8189 0.159
NP_443064.1_6 Reverse -289 -299 11.1125 0.13
NP_442578.1_7 Reverse -107 -114 12.6255 0.0418
NP_440668.1_3 Forward -369 -350 9.24257 0.213
NP_443062.1_1 Forward -115 -97 4.84065 0.247
NP_443062.1_6 Reverse -266 -285 9.83255 0.12
NP_440939.1_5 Reverse -225 -241 13.3332 0.204
NP_442204.1_1 Forward -302 -291 4.2869 0.254
NP_442204.1_1 Reverse -225 -236 -0.236322 0.289
NP_440544.1_7 Forward -136 -118 18.8242 0.152
NP_440516.1_8 Forward -298 -289 -0.295266 0.232
NP_442428.1_4 Forward -223 -204 2.0644 0.271
NP_441052.1_2 Forward -203 -193 5.68323 0.107
NP_440314.1_9 Reverse -142 -161 -9.63698 0.273
NP_441719.1_4 Reverse -107 -114 3.77569 0.285
NP_441577.1_2 Forward -194 -175 4.42435 0.265
NP_442366.1_3 Reverse -326 -344 -0.865831 0.201
NP_440094.1_9 Reverse -376 -395 2.45773 0.173
NP_442430.1_2 Forward -396 -377 1.47442 0.271
NP_441851.1_10 Reverse -376 -386 5.78156 0.2
NP_442208.1_5 Reverse -200 -219 -6.09707 0.266
NP_441668.1_4 Forward -189 -170 -0.39387 0.252
NP_442515.1_1 Reverse -140 -154 3.14618 0.124
NP_442515.1_1 Forward -387 -373 0.491246 0.19
NP_442515.1_1 Forward -284 -270 -4.81863 0.298
NP_441396.1_5 Reverse -269 -278 8.35786 0.224
NP_441683.1_7 Reverse -327 -346 -10.6203 0.284
NP_440593.1_3 Reverse -284 -303 5.211 0.125
NP_440463.1_8 Forward -225 -206 5.66045 0.277
NP_442689.1_3 Reverse -227 -246 15.8307 0.123
NP_442843.1_1 Forward -232 -213 -9.44032 0.266
NP_442843.1_1 Forward -196 -177 -9.63698 0.267
NP_439960.1_4 Forward -168 -149 16.2232 0.153
NP_440431.1_3 Reverse -376 -395 -10.817 0.278
NP_442006.1_2 Reverse -314 -331 -13.7275 0.197
NP_441570.1_1 Forward -115 -97 -11.6822 0.201
NP_441078.1_4 Reverse -377 -386 -0.983583 0.213
NP_441078.1_4 Forward -386 -377 -1.96689 0.282
NP_442443.1_4 Reverse -336 -346 13.6475 0.233
NP_441432.1_8 Reverse -193 -202 9.73449 0.0754
NP_441432.1_8 Reverse -228 -237 2.55633 0.298
NP_440760.1_1 Reverse -141 -160 -23.2067 0.288
NP_442797.1_1 Reverse -142 -161 9.14423 0.137
NP_440199.1_10 Reverse -191 -201 13.8447 0.0988
NP_443011.1_4 Forward -168 -149 6.98095 0.275
NP_442489.1_7 Reverse -377 -386 -1.96689 0.28
NP_441830.1_10 Reverse -242 -261 20.7473 0.0652
NP_440559.1_1 Forward -385 -376 4.32629 0.288
NP_441040.1_2 Forward -219 -200 -10.7186 0.248
NP_440545.1_3 Reverse -202 -219 -6.451 0.28
NP_440025.1_3 Forward -241 -227 12.6438 0.264
NP_441629.1_3 Forward -339 -320 -4.42619 0.29
NP_440772.1_7 Forward -229 -210 11.7992 0.212
NP_442199.1_5 Forward -176 -157 -4.03212 0.219
NP_442140.1_3 Reverse -207 -217 6.66654 0.159
NP_440875.1_9 Forward -113 -103 10.9028 0.19
NP_442547.1_7 Reverse -199 -218 13.8238 0.177
NP_442497.1_10 Forward -385 -376 0.393051 0.175
NP_440821.1_4 Reverse -375 -385 0.176696 0.198
NP_441951.1_9 Forward -232 -213 3.44104 0.254
NP_441727.1_3 Forward -157 -138 7.27595 0.226
NP_440391.1_7 Forward -251 -232 8.84842 0.252
NP_440546.1_4 Reverse -247 -257 6.65249 0.288
NP_442787.1_5 Reverse -4 -23 7.7676 0.27
NP_441474.1_1 Forward -278 -259 -0.984623 0.256
NP_440653.1_10 Reverse -378 -397 4.916 0.238
NP_440753.1_5 Reverse -74 -93 10.3242 0.221
NP_442679.1_1 Reverse -222 -241 -1.18052 0.226
NP_442679.1_1 Reverse -9 -28 -2.26216 0.24
NP_440825.1_4 Forward -160 -141 9.3409 0.266
NP_440825.1_6 Forward -129 -110 9.43923 0.285
NP_442837.1_3 Forward -114 -107 9.87221 0.106
NP_441011.1_1 Reverse -194 -213 12.5858 0.27
NP_441011.1_8 Reverse -248 -257 8.06287 0.16
NP_442322.1_4 Reverse -289 -306 -8.02495 0.286
NP_441028.1_6 Forward -30 -20 7.74772 0.218
NP_441028.1_6 Forward -243 -233 5.09279 0.267
NP_442202.1_10 Reverse -177 -191 4.03116 0.278
NP_440007.1_4 Forward -179 -160 12.7825 0.204
NP_441602.1_3 Forward -220 -201 -3.83545 0.253
NP_441972.1_5 Reverse -142 -161 -9.44032 0.285
NP_441106.1_1 Reverse -205 -214 2.94966 0.248
NP_441420.1_1 Reverse -273 -292 3.34271 0.166
NP_442306.1_10 Forward -219 -200 -12.9802 0.195
NP_441286.1_1 Forward -387 -375 3.18557 0.0485
NP_440670.1_8 Reverse -377 -386 3.24465 0.29
NP_440886.1_7 Forward -278 -268 5.97777 0.151
NP_440828.1_4 Reverse -198 -217 -1.96793 0.208
NP_442072.1_9 Forward -299 -281 -23.3836 0.292
NP_441808.1_8 Reverse -200 -219 6.98095 0.283
NP_442264.1_2 Reverse -373 -390 11.0519 0.185
NP_442264.1_2 Forward -396 -379 5.34871 0.277
NP_441021.1_1 Forward -179 -160 -1.96717 0.128
NP_441021.1_1 Forward -214 -195 -9.53865 0.217
NP_441463.1_3 Forward -213 -194 -4.6221 0.209
NP_441463.1_3 Forward -396 -377 -9.44032 0.28
NP_442365.1_7 Forward -390 -371 0.0977854 0.177
NP_442365.1_7 Forward -396 -377 -6.39206 0.292
NP_441589.1_5 Forward -157 -138 14.8181 0.298
NP_440107.1_5 Reverse -199 -218 1.67108 0.178
NP_442794.1_1 Forward -390 -378 6.33216 0.185
NP_441962.1_4 Reverse -136 -155 -4.52377 0.158
NP_441962.1_4 Reverse -201 -220 -13.6686 0.277
NP_440387.1_1 Forward -386 -370 -3.67804 0.164
NP_440855.1_5 Reverse -201 -220 1.57197 0.3
NP_441431.1_2 Reverse -203 -217 6.0955 0.28
NP_441174.1_2 Forward -227 -213 13.4709 0.201
NP_441174.1_2 Reverse -212 -226 12.1926 0.261
NP_442323.1_7 Forward -397 -378 3.24359 0.245
NP_441237.1_9 Forward -179 -169 10.8948 0.214
NP_440502.1_3 Forward -242 -232 14.3743 0.244
NP_440457.1_1 Reverse -373 -385 -0.0593532 0.25
NP_442680.1_5 Reverse -19 -38 3.97985 0.227
NP_441332.1_4 Reverse -227 -246 4.32602 0.293
NP_441332.1_6 Forward -216 -206 13.0989 0.19
NP_441885.1_5 Reverse -377 -387 0.668351 0.133
NP_441885.1_5 Forward -150 -140 -0.904945 0.241
NP_442341.1_9 Reverse -287 -301 8.55376 0.168
NP_440191.1_4 Forward -241 -231 15.4751 0.254
NP_442513.1_5 Reverse -186 -205 6.09517 0.282
NP_440679.1_10 Reverse -196 -215 -14.4552 0.234
NP_440679.1_10 Reverse -190 -209 -20.8467 0.286
NP_439962.1_4 Forward -232 -213 -3.93378 0.262
NP_439962.1_4 Forward -223 -204 -7.27704 0.288
NP_440149.1_8 Reverse -188 -207 8.75091 0.0586
NP_440216.1_9 Forward -390 -381 5.89959 0.289
NP_440167.1_3 Reverse -212 -231 9.83255 0.247
NP_442015.1_10 Forward -390 -377 1.88757 0.204
NP_441226.1_7 Forward -214 -207 9.77352 0.131
NP_441226.1_7 Reverse -206 -213 6.82361 0.246
NP_442222.1_1 Forward -204 -187 18.8193 0.236
NP_442252.1_3 Forward -175 -157 7.4923 0.299
NP_440416.1_9 Forward -393 -374 -15.0452 0.184
NP_440416.1_9 Forward -343 -324 -20.945 0.289
NP_443052.1_9 Forward -216 -197 -3.93378 0.253
NP_443052.1_9 Forward -213 -194 -6.49039 0.283
NP_442154.1_1 Forward -307 -289 -18.7621 0.285
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

TCACTGATTCCCATTGCAATAGCCCTACTCTGGAACTGGTACAACGCCCGTCTATTTTCGCCTCCCCAATCTACCGACAACTGGGCATCTAAAGGCGTCCTGGGTGAGCGGGTATGGATCAACCGCCATCAAGTTTCTATTCCAACCCATCACTATACCTTTCCCCATTTCCTGGCAGGACTTGCCGCCGTCGGCTCCGTCATAGCCATTTGCGGACTTTGGGCATTGAACCTGCCTTTGACGCTACTGGGGCTGTTGCTACTCTACATGGGCAAACTTTGGTTTTTTGATCGCATGGTATGGCTTTACGAAGACATGAAAACTGCCACTCCTGAATACACAAGCTGGCTCTACTAAACCCTATTTGCTCTTTTACCCCGTCTATTCATCCTTTCCTGTC

CDS

ATGCTAACCACCCAAATCACCCAAACCTACCATCTCACAACGCCGATCATCTCTGCTGGTATGGCCTTTGTCGCTACTCCTAAACTCGCCGCTGCTGTCAGCAATGCCGGTGGCATGGGCACCTTTAGTGCCTTTATGTCTCCCCCGGAGGAACTGCGCGCATTGATTCGGCAAACGCGGAGCCTCAGCGATCGCCCCTTTGGCATCGACTTCATTACCGCAGCCGCCAACGACGACCACATCGCCATCTGCATGGCCGAACGGGTGCCGGTGGTTATCTTCTTCTGGTCATTTCCGCCACTGGACTGGGTGACCCAGCTCCAGAATGCTGGTGTCAAGGTCTGGATGCAGGTGGGGTCTCTGGCAGAAGCGACCCAGGCCAAAGCCCAGGGCTTTGATGCGATCATCGCCCAAGGGCAGGAAGGGGGCGGCCACAACCGCTCGGAAGCCAGCATCTTTAGCCTGCTGCCCGCCATCTGTCGCGAAGTAGCCCCAATTCCCGTAATTGCCGCCGGGGGCATTATCGACGGCCGGGGGCTGGTGGCGGCCCTAGCCCTGGGAGCTGAGGCGGTGTGGTGCGGCACCCGATTTCTCGCCAGTGAAGAAGCTTACGCCCACCCGGAGTACAAGGCGCGGGTGGTGACGGCAACCGTCGGCGATACCACTCGAACCACCCTGTTTGGTCCGGAAATGCCGGGGCAGTTAATGCGGGTACTACGCAACCTTGCCGTCAACCAGTGGGGCGATCGCGTGGCAGACGCAACTAAGCATGGCCCCACTCAACCGGCGATCGGCTCCACCATCCTGGGCGGTCAGGCCCTGCCCATGCCTAAGTTCTCAGCCATTCTGCCCACCCCCGACACCTCCGGTGATTTTGAGGAAATGTGCCTGACGGCAGGGGAAAGCAGCGGCAATATCACCGCTATCAAATCCGCCAGAGACATCCTGTGGGAAATGGAGAATGAAGCGCTCGATTTACTCACCTACCGCTTGCAGGCGATCACGAAGGAACAAAATCTCATGGCTGCTGGCTAA

Protein

No sequence available