Your browser is old and dusty. Try Google Chrome!

Details for sll8033

ORF sll8033
Accession NP_942427.1
Symbol
Category
Definition
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_441061.1_2 Forward -335 -321 11.8976 0.0505
NP_441061.1_2 Reverse -372 -386 -1.96703 0.278
NP_440795.1_7 Forward -379 -372 14.6904 0.0123
NP_440795.1_7 Reverse -372 -379 14.6904 0.0123
NP_440795.1_7 Forward -125 -118 14.1988 0.0267
NP_441418.1_6 Reverse -371 -390 5.70265 0.00794
NP_441418.1_6 Forward -65 -46 -22.3217 0.175
NP_441418.1_6 Reverse -255 -274 -28.3199 0.204
NP_441418.1_6 Reverse -327 -346 -28.6149 0.206
NP_441453.1_1 Forward -387 -369 2.37835 0.294
NP_441453.1_4 Forward -380 -372 16.539 0.00633
NP_441453.1_4 Reverse -327 -335 14.7691 0.0119
NP_441453.1_4 Reverse -371 -379 7.8859 0.0536
NP_441453.1_4 Forward -336 -328 6.80426 0.121
NP_441453.1_4 Forward -126 -118 6.80426 0.121
NP_441960.1_3 Reverse -327 -346 13.8918 0.243
NP_442151.1_6 Forward -126 -112 16.9125 0.013
NP_442151.1_6 Forward -336 -322 8.65272 0.167
NP_442151.1_6 Reverse -56 -70 8.16106 0.182
NP_442151.1_6 Forward -314 -300 7.9644 0.184
NP_441818.1_1 Reverse -372 -383 11.4645 0.177
NP_441818.1_9 Forward -68 -49 -10.4236 0.293
NP_440226.1_1 Reverse -327 -346 13.0775 0.0391
NP_440226.1_1 Reverse -117 -136 8.75091 0.0823
NP_440226.1_1 Reverse -371 -390 8.06259 0.0944
NP_440226.1_1 Forward -380 -361 5.60432 0.151
NP_442169.1_1 Reverse -270 -289 0.58944 0.261
NP_441630.1_3 Forward -344 -325 -0.0988766 0.285
NP_442623.1_3 Forward -379 -360 -18.7818 0.263
NP_440150.1_6 Reverse -261 -280 2.75272 0.268
NP_442173.1_1 Reverse -372 -380 15.4574 0.00633
NP_442173.1_1 Forward -335 -327 12.0158 0.0316
NP_442173.1_1 Reverse -328 -336 12.0158 0.0316
NP_442173.1_1 Forward -379 -371 8.27922 0.101
NP_442173.1_1 Reverse -118 -126 5.72262 0.203
NP_442752.1_4 Forward -380 -373 13.8055 0.0199
NP_442752.1_4 Forward -336 -329 13.8055 0.0199
NP_442752.1_4 Forward -126 -119 4.26735 0.293
NP_443027.1_4 Forward -128 -118 12.2714 0.0797
NP_443027.1_4 Forward -382 -372 6.46988 0.275
NP_443027.1_4 Reverse -369 -379 6.17489 0.289
NP_441812.1_3 Reverse -116 -130 9.2427 0.245
NP_442975.1_10 Forward -340 -326 3.73557 0.252
NP_440784.1_7 Forward -379 -372 15.9687 0.0123
NP_440784.1_7 Reverse -372 -379 15.9687 0.0123
NP_440784.1_7 Reverse -118 -125 13.2155 0.0365
NP_440784.1_7 Forward -125 -118 12.1338 0.0604
NP_440784.1_7 Forward -39 -32 10.2655 0.0801
NP_440784.1_7 Forward -335 -328 6.23397 0.241
NP_440784.1_7 Reverse -328 -335 6.13563 0.241
NP_442909.1_7 Forward -335 -321 10.8154 0.131
NP_440061.1_9 Reverse -369 -383 9.43874 0.145
NP_440061.1_9 Forward -48 -34 5.01387 0.298
NP_440878.1_4 Reverse -282 -300 12.3105 0.288
NP_440878.1_9 Reverse -107 -126 1.67108 0.177
NP_442062.1_8 Reverse -327 -337 9.61647 0.0587
NP_442062.1_8 Reverse -371 -381 8.1415 0.0801
NP_441859.1_3 Reverse -370 -389 8.06178 0.146
NP_441859.1_3 Forward -337 -318 4.03023 0.228
NP_440304.1_4 Forward -382 -372 17.9746 0.00654
NP_440304.1_4 Reverse -325 -335 9.12481 0.0626
NP_442242.1_1 Reverse -261 -280 15.4341 0.29
NP_442242.1_4 Forward -379 -372 14.3954 0.0124
NP_442242.1_4 Reverse -372 -379 14.3954 0.0124
NP_442242.1_4 Forward -125 -118 12.0355 0.0521
NP_442242.1_4 Reverse -118 -125 11.5438 0.089
NP_439918.1_3 Forward -383 -364 10.3242 0.249
NP_441210.1_8 Reverse -280 -299 15.9291 0.1
NP_440893.1_3 Forward -137 -118 2.6536 0.273
NP_441208.1_9 Reverse -324 -338 16.2242 0.0671
NP_441208.1_9 Reverse -114 -128 6.78443 0.229
NP_441594.1_6 Forward -231 -212 9.93088 0.134
NP_441594.1_6 Reverse -318 -337 9.14423 0.146
NP_442110.1_7 Forward -336 -322 5.99778 0.157
NP_442110.1_7 Reverse -31 -45 4.22782 0.205
NP_442110.1_7 Reverse -121 -135 -0.000409212 0.27
NP_442726.1_4 Forward -229 -210 6.68596 0.269
NP_442726.1_7 Forward -280 -262 9.36059 0.187
NP_441925.1_4 Forward -273 -254 -14.8492 0.263
NP_440856.1_4 Reverse -364 -383 20.944 0.0211
NP_441083.1_5 Reverse -371 -381 18.0729 0.00245
NP_441083.1_5 Reverse -327 -337 10.1081 0.0208
NP_441083.1_5 Forward -336 -326 8.73149 0.0307
NP_441083.1_5 Forward -126 -116 8.04317 0.046
NP_441083.1_5 Forward -380 -370 1.55333 0.204
NP_441083.1_5 Reverse -117 -127 0.373358 0.231
NP_442827.1_8 Forward -344 -325 -2.16459 0.27
NP_441434.1_7 Reverse -329 -343 12.586 0.108
NP_441434.1_7 Reverse -373 -387 5.60446 0.225
NP_441738.1_2 Reverse -373 -380 15.28 0.0102
NP_441738.1_2 Reverse -329 -336 15.28 0.0102
NP_441558.1_5 Reverse -325 -344 15.2408 0.0438
NP_441558.1_5 Reverse -369 -388 9.93088 0.11
NP_441955.1_6 Forward -381 -362 20.059 0.13
NP_441955.1_8 Reverse -305 -322 5.64371 0.297
NP_440209.1_1 Forward -380 -372 18.1123 0.00295
NP_440209.1_1 Reverse -371 -379 15.1624 0.00583
NP_440209.1_1 Forward -336 -328 8.57422 0.0425
NP_440209.1_1 Reverse -327 -335 8.47588 0.0457
NP_440209.1_1 Forward -126 -118 8.37755 0.0576
NP_440209.1_1 Reverse -117 -125 5.32929 0.139
NP_440870.1_4 Forward -317 -299 1.88744 0.217
NP_440447.1_6 Forward -388 -370 3.65739 0.189
NP_441713.1_1 Forward -386 -367 -6.78538 0.121
NP_441713.1_1 Reverse -111 -130 -7.76869 0.137
NP_441713.1_1 Reverse -209 -228 -9.73531 0.185
NP_441770.1_10 Reverse -325 -344 12.7825 0.216
NP_442570.1_3 Reverse -289 -308 -1.37718 0.212
NP_441716.1_1 Forward -380 -366 9.43936 0.116
NP_441716.1_1 Forward -126 -112 8.75105 0.133
NP_441716.1_1 Forward -306 -292 5.70279 0.22
NP_441598.1_5 Reverse -198 -217 15.7324 0.192
NP_442111.1_4 Reverse -370 -384 17.6008 0.00983
NP_442111.1_4 Forward -381 -367 9.04604 0.0655
NP_442111.1_4 Reverse -116 -130 2.16287 0.286
NP_440343.1_9 Forward -75 -56 8.94757 0.251
NP_440906.1_5 Forward -379 -372 15.8704 0.0124
NP_440906.1_5 Reverse -372 -379 15.8704 0.0124
NP_440906.1_5 Reverse -118 -125 13.3138 0.0268
NP_440906.1_5 Forward -335 -328 6.23397 0.234
NP_440906.1_5 Reverse -328 -335 6.13563 0.241
NP_440906.1_5 Forward -125 -118 6.13563 0.241
NP_440747.1_10 Reverse -368 -380 7.31547 0.00577
NP_440747.1_10 Reverse -114 -126 5.05386 0.019
NP_440747.1_10 Forward -339 -327 -2.4193 0.0434
NP_440747.1_10 Forward -383 -371 -11.7607 0.142
NP_440747.1_10 Reverse -324 -336 -11.7607 0.142
NP_440747.1_10 Forward -129 -117 -12.0557 0.199
NP_441130.1_7 Forward -279 -265 14.7486 0.287
NP_441130.1_10 Reverse -325 -339 7.86607 0.146
NP_441130.1_10 Forward -338 -324 7.66941 0.153
NP_441130.1_10 Reverse -115 -129 5.30946 0.236
NP_441486.1_1 Forward -43 -29 0.589577 0.132
NP_442634.1_4 Forward -382 -368 6.6861 0.0489
NP_442634.1_4 Forward -338 -324 -3.63866 0.161
NP_442634.1_4 Reverse -369 -383 -4.03198 0.179
NP_441265.1_3 Reverse -365 -379 6.98109 0.181
NP_441265.1_3 Forward -386 -372 6.6861 0.181
NP_441695.1_8 Reverse -297 -311 17.8958 0.159
NP_441014.1_8 Forward -139 -120 -5.9004 0.275
NP_441014.1_8 Reverse -380 -399 -9.047 0.289
NP_442848.1_1 Forward -386 -372 -3.93365 0.275
NP_442848.1_9 Reverse -298 -317 -0.0988766 0.278
NP_443018.1_3 Forward -379 -372 14.8871 0.0123
NP_443018.1_3 Reverse -372 -379 14.8871 0.0123
NP_443018.1_3 Reverse -328 -335 11.7405 0.0655
NP_443018.1_3 Forward -335 -328 5.44732 0.193
NP_443018.1_3 Forward -125 -118 5.15232 0.226
NP_443018.1_3 Reverse -118 -125 5.05399 0.238
NP_443018.1_3 Reverse -32 -39 4.26735 0.267
NP_443018.1_3 Forward -39 -32 4.16902 0.278
NP_441316.1_7 Forward -382 -367 -2.8717 0.273
NP_441316.1_7 Forward -338 -323 -3.46169 0.277
NP_441634.1_8 Forward -317 -303 -3.04867 0.295
NP_441634.1_8 Forward -338 -324 -3.63866 0.295
NP_441634.1_9 Reverse -292 -311 11.995 0.224
NP_440376.1_1 Forward -336 -327 15.7327 0.00625
NP_440376.1_1 Forward -380 -371 9.73449 0.0365
NP_440376.1_1 Reverse -371 -380 9.63616 0.0385
NP_440376.1_1 Reverse -327 -336 9.63616 0.0385
NP_440376.1_1 Reverse -360 -369 2.06468 0.236
NP_440376.1_1 Reverse -264 -273 0.786375 0.26
NP_440376.1_1 Forward -126 -117 -0.000272808 0.285
NP_440376.1_1 Reverse -117 -126 -0.000272808 0.285
NP_440376.1_1 Reverse -226 -235 -0.0986038 0.285
NP_441588.1_4 Reverse -329 -339 7.05986 0.178
NP_442687.1_7 Forward -337 -327 13.5497 0.0466
NP_442687.1_7 Forward -381 -371 9.51814 0.0994
NP_442687.1_7 Reverse -370 -380 6.27322 0.175
NP_442687.1_7 Reverse -116 -126 5.19158 0.217
NP_442191.1_4 Forward -379 -365 13.417 0.15
NP_441797.1_7 Forward -50 -32 9.85225 0.292
NP_441846.1_10 Reverse -254 -273 -21.24 0.256
NP_441846.1_10 Reverse -257 -276 -23.2067 0.279
NP_440642.1_8 Reverse -373 -392 18.7781 0.0742
NP_440642.1_10 Forward -48 -34 2.35894 0.277
NP_440042.1_2 Forward -390 -371 -5.31042 0.296
NP_442770.1_4 Reverse -27 -46 10.1275 0.149
NP_441422.1_7 Forward -338 -321 12.0352 0.0565
NP_440533.1_9 Reverse -117 -136 12.6841 0.0871
NP_440533.1_9 Forward -380 -361 2.65439 0.269
NP_441763.1_10 Forward -223 -204 12.29 0.131
NP_440360.1_10 Forward -334 -320 7.27608 0.227
NP_442720.1_1 Forward -277 -258 16.8132 0.262
NP_442658.1_1 Forward -382 -372 17.6791 0.00565
NP_442658.1_1 Reverse -369 -379 12.0743 0.0643
NP_442658.1_1 Reverse -29 -39 11.8776 0.0697
NP_442658.1_1 Forward -338 -328 7.35439 0.214
NP_442658.1_1 Reverse -325 -335 6.27276 0.234
NP_441855.2_4 Forward -388 -369 9.61947 0.275
NP_442782.1_2 Forward -380 -366 10.816 0.173
NP_442782.1_2 Reverse -292 -306 2.85119 0.271
NP_442205.1_9 Reverse -321 -337 8.31834 0.103
NP_441414.1_9 Forward -380 -361 1.0811 0.0762
NP_440607.1_3 Reverse -201 -220 13.47 0.24
NP_441256.1_1 Forward -333 -314 -6.98204 0.239
NP_441256.1_1 Reverse -368 -387 -7.4737 0.239
NP_441256.1_8 Reverse -266 -285 8.06259 0.235
NP_441958.1_5 Forward -381 -371 11.3864 0.0074
NP_441958.1_5 Reverse -370 -380 11.3864 0.0074
NP_441958.1_5 Reverse -326 -336 11.3864 0.0074
NP_441958.1_5 Forward -337 -327 10.0098 0.0167
NP_441958.1_5 Forward -127 -117 2.33998 0.0455
NP_440651.1_1 Reverse -246 -265 7.07928 0.282
NP_442486.1_6 Reverse -50 -69 -2.55715 0.266
NP_442486.1_6 Forward -219 -200 -6.58872 0.296
NP_442836.1_5 Reverse -321 -340 8.06259 0.147
NP_439905.1_1 Reverse -118 -131 14.9656 0.106
NP_439905.1_1 Forward -335 -322 9.55739 0.216
NP_440984.1_7 Reverse -322 -336 11.7993 0.122
NP_440984.1_7 Forward -341 -327 5.89945 0.235
NP_439990.1_5 Reverse -112 -125 9.55739 0.14
NP_442376.1_2 Forward -385 -366 -2.55715 0.202
NP_442911.1_2 Reverse -361 -380 4.22769 0.0392
NP_442911.1_2 Forward -390 -371 -0.983855 0.0804
NP_442911.1_2 Reverse -317 -336 -4.52377 0.136
NP_441580.1_6 Forward -347 -328 1.37609 0.119
NP_440153.1_5 Forward -335 -321 4.81781 0.196
NP_440153.1_5 Reverse -216 -230 3.44117 0.212
NP_442064.1_1 Reverse -112 -131 -6.39206 0.221
NP_443055.1_6 Forward -314 -296 2.57501 0.206
NP_443055.1_6 Forward -281 -263 1.29671 0.233
NP_443055.1_6 Forward -388 -370 0.706727 0.24
NP_440993.1_4 Forward -306 -289 13.8052 0.171
NP_440827.1_3 Reverse -26 -45 10.3242 0.299
NP_440602.1_8 Forward -53 -39 14.4542 0.152
NP_441099.1_5 Forward -390 -371 -4.81876 0.147
NP_441099.1_5 Reverse -361 -380 -7.57203 0.177
NP_441099.1_10 Reverse -241 -251 17.1874 0.254
NP_442002.1_9 Forward -381 -374 14.1004 0.074
NP_442002.1_9 Forward -337 -330 10.7572 0.185
NP_440809.1_9 Reverse -318 -336 3.06741 0.118
NP_440809.1_9 Reverse -362 -380 -6.66736 0.225
NP_442567.1_4 Forward -217 -198 11.7992 0.29
NP_441294.1_7 Forward -340 -326 11.9383 0.12
NP_440411.1_10 Forward -314 -295 9.48095 0.286
NP_441646.1_1 Reverse -208 -227 6.09597 0.174
NP_441646.1_1 Reverse -30 -49 0.58944 0.247
NP_442438.1_10 Reverse -210 -224 -0.295402 0.256
NP_442431.1_10 Reverse -198 -216 11.6222 0.0962
NP_442431.1_10 Reverse -252 -270 7.4923 0.167
NP_442431.1_10 Reverse -1 -19 2.47742 0.237
NP_441000.1_6 Reverse -326 -340 12.6843 0.0408
NP_441000.1_6 Forward -381 -367 -2.45868 0.216
NP_440484.1_3 Forward -128 -114 14.1593 0.242
NP_440147.1_4 Forward -338 -325 17.0305 0.00838
NP_440147.1_4 Reverse -369 -382 10.5407 0.0355
NP_440147.1_4 Forward -382 -369 1.69091 0.222
NP_440147.1_4 Reverse -325 -338 0.215946 0.261
NP_440147.1_4 Forward -316 -303 -0.669033 0.294
NP_441550.1_8 Forward -382 -372 19.8424 0.00352
NP_441550.1_8 Reverse -325 -335 16.4991 0.0123
NP_441550.1_8 Reverse -369 -379 12.1726 0.0361
NP_441550.1_8 Forward -128 -118 10.6976 0.0648
NP_441550.1_8 Reverse -115 -125 8.43603 0.124
NP_441550.1_8 Forward -338 -328 7.55106 0.154
NP_441916.1_7 Forward -380 -370 9.61647 0.0333
NP_441916.1_7 Forward -336 -326 9.22315 0.0383
NP_441916.1_7 Reverse -327 -337 8.82982 0.0409
NP_441916.1_7 Reverse -371 -381 8.63316 0.0437
NP_441916.1_7 Reverse -147 -157 5.28991 0.138
NP_440206.1_4 Forward -310 -291 1.6703 0.289
NP_440465.1_10 Reverse -324 -343 -0.590531 0.29
NP_441041.1_4 Reverse -327 -346 -9.34199 0.215
NP_441041.1_4 Forward -380 -361 -10.6203 0.235
NP_441041.1_4 Forward -126 -107 -12.9802 0.278
NP_441041.1_7 Forward -339 -327 14.3172 0.0361
NP_441041.1_7 Forward -383 -371 11.4991 0.0783
NP_441041.1_7 Reverse -368 -380 10.7216 0.0888
NP_442004.1_6 Forward -336 -322 6.19444 0.181
NP_441725.1_5 Reverse -372 -382 18.7612 0.0119
NP_441725.1_5 Forward -379 -369 -0.0199663 0.223
NP_441725.1_5 Forward -335 -325 -0.806614 0.271
NP_439966.1_7 Reverse -369 -379 15.0242 0.0177
NP_439966.1_7 Reverse -325 -335 12.8609 0.0347
NP_439966.1_7 Forward -338 -328 8.23937 0.14
NP_439966.1_7 Forward -382 -372 8.14104 0.14
NP_439966.1_7 Forward -128 -118 4.7978 0.258
NP_439966.1_9 Forward -382 -373 0.983037 0.253
NP_439966.1_9 Forward -338 -329 0.884706 0.253
NP_442941.1_3 Forward -379 -369 9.81313 0.0263
NP_442941.1_3 Reverse -118 -128 9.7148 0.0286
NP_442941.1_3 Reverse -372 -382 2.43831 0.14
NP_442941.1_3 Forward -335 -325 1.25834 0.15
NP_442941.1_3 Reverse -328 -338 0.963343 0.16
NP_442941.1_3 Forward -125 -115 -0.904945 0.274
NP_440289.1_2 Reverse -368 -381 5.62415 0.0623
NP_440289.1_2 Forward -339 -326 4.14919 0.0706
NP_440289.1_2 Forward -383 -370 3.36254 0.0799
NP_440260.1_8 Forward -315 -297 -3.32411 0.251
NP_440260.1_8 Reverse -185 -203 -5.78238 0.279
NP_440260.1_8 Reverse -344 -362 -6.86402 0.295
NP_441678.1_9 Reverse -280 -299 -2.85214 0.272
NP_442281.1_1 Forward -341 -327 10.0287 0.0639
NP_442281.1_1 Reverse -26 -40 5.89884 0.142
NP_442281.1_1 Reverse -322 -336 2.75226 0.257
NP_442281.1_1 Reverse -39 -53 2.45727 0.266
NP_441334.1_7 Reverse -369 -388 -19.6667 0.275
NP_441334.1_7 Forward -382 -363 -20.7484 0.28
NP_442256.1_2 Reverse -115 -133 -8.14232 0.217
NP_001035871.2_7 Reverse -129 -139 11.8781 0.275
NP_440437.1_1 Reverse -365 -384 5.50599 0.0868
NP_441457.1_7 Reverse -325 -344 5.70265 0.186
NP_441457.1_9 Forward -322 -303 11.6025 0.251
NP_440498.1_1 Reverse -362 -380 -3.22577 0.259
NP_441644.1_6 Forward -380 -370 15.3192 0.00663
NP_441644.1_6 Reverse -371 -381 13.0576 0.0244
NP_441644.1_6 Forward -126 -116 10.4026 0.0628
NP_441644.1_6 Reverse -327 -337 9.81266 0.0678
NP_441644.1_6 Forward -336 -326 9.41933 0.0767
NP_441644.1_6 Reverse -117 -127 6.56775 0.154
NP_443049.1_6 Forward -381 -371 13.9832 0.139
NP_440867.1_10 Forward -321 -302 12.4875 0.242
NP_442215.1_2 Forward -49 -33 -5.448 0.25
NP_442215.1_2 Reverse -29 -45 -5.64466 0.254
NP_442215.1_2 Forward -309 -293 -6.13632 0.264
NP_442215.1_2 Reverse -358 -374 -6.62797 0.277
NP_442247.1_8 Reverse -369 -383 12.9793 0.247
NP_440253.1_2 Reverse -327 -345 3.46073 0.116
NP_440253.1_2 Reverse -371 -389 1.59244 0.157
NP_440929.1_8 Reverse -327 -336 16.5193 0.00413
NP_440929.1_8 Forward -380 -371 9.93116 0.0249
NP_440929.1_8 Reverse -371 -380 9.83282 0.0254
NP_440929.1_8 Forward -336 -327 9.53783 0.0296
NP_442933.1_10 Forward -380 -371 9.04618 0.063
NP_442933.1_10 Reverse -371 -380 8.94785 0.0643
NP_442933.1_10 Reverse -327 -336 8.06287 0.0885
NP_442933.1_10 Forward -336 -327 7.96454 0.0937
NP_442933.1_10 Forward -156 -147 6.09625 0.14
NP_442933.1_10 Reverse -147 -156 5.70292 0.165
NP_442933.1_10 Reverse -117 -126 5.3096 0.203
NP_442933.1_10 Reverse -31 -40 3.83464 0.283
NP_441751.2_8 Reverse -372 -386 5.80112 0.0408
NP_441751.2_8 Forward -379 -365 4.71948 0.047
NP_441751.2_8 Forward -335 -321 2.85119 0.0759
NP_442554.1_8 Reverse -372 -382 16.9913 0.0065
NP_442554.1_8 Forward -335 -325 16.7946 0.0065
NP_442554.1_8 Forward -379 -369 7.74818 0.0846
NP_442554.1_8 Reverse -118 -128 7.74818 0.0846
NP_442554.1_8 Reverse -328 -338 4.3066 0.189
NP_442554.1_8 Reverse -292 -302 2.24165 0.276
NP_441762.1_7 Forward -381 -369 3.77555 0.0676
NP_441762.1_7 Forward -337 -325 2.0056 0.0705
NP_441762.1_7 Reverse -370 -382 -4.77924 0.182
NP_441762.1_7 Reverse -326 -338 -6.74586 0.284
NP_441762.1_7 Forward -127 -115 -7.13918 0.285
NP_442313.1_6 Forward -54 -35 7.17762 0.251
NP_442142.1_4 Reverse -368 -381 8.86849 0.106
NP_442142.1_4 Reverse -114 -127 5.62358 0.187
NP_442142.1_4 Forward -339 -326 4.83694 0.209
NP_442142.1_4 Forward -43 -30 4.83694 0.209
NP_442142.1_4 Reverse -294 -307 3.65697 0.248
NP_442292.1_1 Reverse -372 -381 9.53783 0.0183
NP_442292.1_1 Forward -379 -370 8.65285 0.0335
NP_442292.1_1 Reverse -118 -127 8.06287 0.0554
NP_442292.1_1 Forward -335 -326 7.76787 0.0615
NP_442292.1_1 Forward -125 -116 -0.0986038 0.239
NP_442292.1_1 Reverse -328 -337 -0.196935 0.239
NP_442292.1_5 Reverse -323 -342 0.0977854 0.257
NP_442476.1_6 Reverse -372 -386 7.86607 0.112
NP_440895.1_6 Reverse -111 -124 8.67241 0.251
NP_442381.1_8 Reverse -360 -379 -5.9004 0.151
NP_443009.1_5 Reverse -326 -337 9.98959 0.0841
NP_443009.1_5 Forward -381 -370 8.12131 0.117
NP_443009.1_5 Reverse -370 -381 7.33466 0.132
NP_441715.1_4 Reverse -328 -338 9.02648 0.105
NP_441715.1_4 Forward -379 -369 7.64985 0.108
NP_441715.1_4 Reverse -118 -128 7.55152 0.108
NP_440357.1_3 Forward -338 -319 4.62101 0.242
NP_441448.1_1 Reverse -262 -281 10.0292 0.191
NP_441448.1_1 Reverse -316 -335 4.03102 0.28
NP_442076.1_8 Forward -221 -202 6.58763 0.262
NP_441198.1_8 Forward -382 -372 15.2245 0.0427
NP_441468.1_1 Forward -379 -372 15.8704 0.0124
NP_441468.1_1 Reverse -372 -379 15.8704 0.0124
NP_441468.1_1 Reverse -32 -39 10.2655 0.0906
NP_441468.1_1 Reverse -118 -125 6.3323 0.202
NP_441468.1_1 Forward -335 -328 6.13563 0.209
NP_441468.1_1 Forward -125 -118 6.13563 0.209
NP_441468.1_1 Reverse -328 -335 6.0373 0.223
NP_441020.2_6 Reverse -369 -386 9.97027 0.156
NP_441020.2_6 Forward -382 -365 8.59364 0.195
NP_441015.1_10 Reverse -256 -275 -0.590531 0.169
NP_441015.1_10 Reverse -253 -272 -0.590531 0.169
NP_441015.1_10 Reverse -322 -341 -2.55715 0.178
NP_441673.1_1 Forward -380 -371 11.1111 0.0121
NP_441673.1_1 Forward -336 -327 11.1111 0.0121
NP_441673.1_1 Reverse -371 -380 11.0128 0.018
NP_441673.1_1 Reverse -327 -336 11.0128 0.018
NP_441673.1_1 Forward -126 -117 1.37636 0.114
NP_441673.1_1 Reverse -117 -126 1.1797 0.163
NP_441339.1_4 Reverse -30 -49 5.30933 0.166
NP_441956.1_9 Forward -307 -288 14.7491 0.166
NP_441826.1_2 Forward -386 -372 1.76955 0.142
NP_441826.1_2 Forward -46 -32 -2.45868 0.271
NP_441826.1_5 Reverse -328 -347 1.17943 0.295
NP_441637.1_9 Reverse -205 -223 -3.02911 0.293
NP_442490.1_9 Forward -392 -373 -7.96535 0.282
NP_442868.1_6 Forward -382 -372 16.7946 0.0131
NP_442868.1_6 Reverse -369 -379 10.1081 0.038
NP_442868.1_6 Forward -128 -118 0.865012 0.205
NP_442868.1_6 Forward -338 -328 0.57002 0.217
NP_442868.1_6 Reverse -115 -125 -0.314959 0.284
NP_442719.1_2 Reverse -236 -254 -11.9779 0.299
NP_442808.1_1 Reverse -326 -336 9.321 0.0481
NP_442808.1_1 Reverse -370 -380 9.12434 0.0481
NP_442808.1_1 Forward -337 -327 8.73102 0.0481
NP_440031.1_10 Reverse -379 -398 -0.688862 0.288
NP_440145.1_3 Reverse -107 -126 -4.32711 0.228
NP_442718.1_1 Reverse -90 -109 1.47442 0.299
NP_442542.1_2 Forward -382 -369 10.7374 0.122
NP_442542.1_9 Forward -343 -329 14.0603 0.108
NP_442542.1_9 Forward -235 -221 5.89884 0.256
NP_442050.1_5 Reverse -325 -335 15.0242 0.0169
NP_442050.1_5 Reverse -369 -379 14.9258 0.0175
NP_442050.1_5 Forward -382 -372 14.9258 0.0175
NP_442050.1_8 Forward -317 -298 14.474 0.272
NP_442342.1_9 Reverse -303 -319 10.3833 0.137
NP_441114.1_3 Reverse -164 -173 7.27622 0.247
NP_440558.1_2 Forward -315 -296 -1.18052 0.211
NP_440558.1_2 Forward -49 -30 -5.21209 0.254
NP_440558.1_2 Forward -216 -197 -5.60541 0.262
NP_440558.1_2 Forward -310 -291 -5.70374 0.264
NP_440558.1_2 Reverse -33 -52 -6.09707 0.271
NP_441878.1_6 Forward -381 -371 10.5014 0.0176
NP_441878.1_6 Reverse -370 -380 0.668351 0.139
NP_441878.1_6 Forward -337 -327 0.668351 0.139
NP_441878.1_6 Reverse -326 -336 0.668351 0.139
NP_441878.1_6 Forward -307 -297 -0.0199663 0.163
NP_441036.1_8 Forward -337 -327 16.4996 0.00407
NP_441036.1_8 Reverse -370 -380 13.353 0.0482
NP_441036.1_8 Reverse -326 -336 6.37155 0.234
NP_441557.1_5 Forward -380 -371 10.8161 0.00464
NP_441557.1_5 Reverse -371 -380 10.4228 0.00915
NP_441557.1_5 Forward -336 -327 10.2261 0.0144
NP_441557.1_5 Reverse -327 -336 10.1278 0.0188
NP_441557.1_5 Forward -126 -117 1.08137 0.0794
NP_441557.1_5 Reverse -117 -126 0.589713 0.134
NP_441557.1_8 Forward -273 -263 11.4843 0.246
NP_441445.1_1 Reverse -318 -337 5.30933 0.172
NP_442066.2_9 Reverse -323 -336 11.0324 0.154
NP_442066.2_9 Forward -130 -117 9.06573 0.181
NP_442066.2_9 Forward -277 -264 7.19745 0.243
NP_441433.1_8 Forward -257 -238 -0.983855 0.256
NP_442777.1_3 Reverse -364 -382 2.47668 0.274
NP_441308.1_8 Reverse -325 -335 9.02648 0.236
NP_440101.1_3 Reverse -322 -341 3.04771 0.239
NP_440101.1_3 Forward -131 -112 1.27776 0.281
NP_441458.1_10 Reverse -22 -41 5.50599 0.216
NP_442183.1_1 Forward -336 -322 13.2743 0.0451
NP_442166.1_7 Forward -379 -365 12.291 0.175
NP_442397.1_9 Forward -53 -34 5.30933 0.246
NP_440356.1_1 Forward -203 -184 12.0933 0.275
NP_440979.1_3 Reverse -372 -390 12.2122 0.234
NP_442135.1_3 Forward -348 -329 8.35759 0.218
NP_441574.1_1 Reverse -279 -298 -7.27704 0.286
NP_442347.1_2 Reverse -328 -337 8.94785 0.0718
NP_442347.1_2 Reverse -118 -127 5.60459 0.229
NP_442347.1_2 Reverse -372 -381 3.34298 0.284
NP_442888.1_6 Forward -367 -348 7.57094 0.204
NP_441037.1_4 Forward -382 -372 18.9151 0.00351
NP_441037.1_4 Reverse -325 -335 12.5804 0.0967
NP_442594.1_8 Reverse -315 -334 16.4207 0.146
NP_441633.1_3 Reverse -369 -382 7.98409 0.0408
NP_441633.1_3 Forward -338 -325 5.62415 0.0481
NP_442764.1_5 Forward -154 -135 10.3242 0.212
NP_440136.1_2 Forward -379 -372 15.9687 0.0123
NP_440136.1_2 Reverse -372 -379 15.9687 0.0123
NP_440136.1_2 Reverse -118 -125 6.43063 0.154
NP_440136.1_2 Forward -335 -328 6.23397 0.171
NP_440136.1_2 Forward -125 -118 6.23397 0.171
NP_440136.1_2 Reverse -328 -335 6.13563 0.193
NP_442590.1_10 Reverse -305 -324 9.53756 0.196
NP_442998.1_5 Reverse -269 -279 11.6814 0.179
NP_442998.1_5 Forward -93 -83 8.73149 0.261
NP_442998.1_10 Reverse -373 -380 15.5754 0.0102
NP_442998.1_10 Reverse -329 -336 15.5754 0.0102
NP_442998.1_10 Reverse -205 -212 7.21728 0.144
NP_442998.1_10 Reverse -119 -126 5.93897 0.206
NP_442998.1_10 Forward -378 -371 5.84064 0.235
NP_442998.1_10 Forward -334 -327 5.84064 0.235
NP_440899.1_1 Reverse -280 -299 11.3352 0.164
NP_440299.1_1 Forward -44 -31 10.3434 0.0573
NP_440299.1_1 Forward -384 -371 6.70522 0.133
NP_440299.1_1 Reverse -113 -126 3.26365 0.251
NP_441799.1_1 Reverse -323 -337 16.2235 0.0153
NP_441799.1_1 Forward -130 -116 12.5853 0.0421
NP_441799.1_1 Forward -384 -370 11.7987 0.0524
NP_441799.1_1 Reverse -367 -381 5.89884 0.19
NP_441799.1_4 Forward -281 -262 -4.52377 0.216
NP_440640.1_6 Reverse -306 -325 0.884433 0.266
NP_441007.1_10 Reverse -322 -335 12.8023 0.0499
NP_441007.1_10 Forward -385 -372 8.9674 0.108
NP_440256.1_1 Reverse -324 -343 0.294447 0.085
NP_440256.1_1 Reverse -368 -387 0.0977854 0.087
NP_441229.1_10 Forward -55 -36 -1.47551 0.288
NP_441512.1_4 Reverse -367 -386 7.37428 0.274
NP_441559.1_8 Reverse -366 -380 8.35772 0.0676
NP_441559.1_8 Forward -131 -117 -5.9986 0.271
NP_440915.1_6 Forward -384 -370 19.6658 0.00738
NP_440915.1_6 Forward -340 -326 12.6843 0.0208
NP_440915.1_6 Reverse -367 -381 6.19444 0.0849
NP_442069.1_4 Forward -331 -312 8.84924 0.245
NP_442866.1_4 Forward -335 -316 8.84924 0.178
NP_441464.1_8 Forward -336 -322 7.9644 0.204
NP_441464.1_8 Forward -212 -198 5.50613 0.253
NP_441464.1_8 Reverse -371 -385 4.91614 0.26
NP_441464.1_10 Reverse -262 -276 9.5377 0.262
NP_441939.1_3 Forward -335 -316 8.25926 0.177
NP_441199.1_6 Reverse -367 -386 3.93269 0.175
NP_441494.1_6 Reverse -322 -335 8.67241 0.23
NP_439985.1_7 Forward -53 -34 2.3594 0.29
NP_442993.1_1 Forward -336 -320 -4.75968 0.141
NP_440677.1_6 Reverse -288 -307 12.6841 0.196
NP_442386.1_9 Reverse -370 -379 8.35743 0.201
NP_442386.1_9 Forward -381 -372 6.39082 0.219
NP_442386.1_9 Reverse -116 -125 6.39082 0.219
NP_442386.1_9 Forward -337 -328 5.9975 0.23
NP_442386.1_9 Reverse -30 -39 5.11253 0.266
NP_441340.1_5 Forward -379 -372 15.6737 0.0124
NP_441340.1_5 Reverse -372 -379 15.6737 0.0124
NP_441340.1_5 Forward -335 -328 13.5105 0.0314
NP_441340.1_5 Forward -125 -118 5.93897 0.198
NP_441340.1_5 Reverse -328 -335 5.84064 0.208
NP_441340.1_5 Reverse -118 -125 5.84064 0.208
NP_441340.1_5 Forward -39 -32 4.07068 0.239
NP_442484.1_2 Forward -347 -328 5.80098 0.161
NP_440168.1_8 Forward -52 -33 1.67108 0.289
NP_440168.1_9 Reverse -369 -388 -1.7705 0.279
NP_440586.1_8 Forward -379 -372 13.2151 0.026
NP_440586.1_8 Reverse -372 -379 13.2151 0.026
NP_440586.1_8 Forward -125 -118 11.1501 0.0845
NP_440586.1_8 Reverse -328 -335 9.47853 0.146
NP_440586.1_8 Forward -335 -328 5.74197 0.283
NP_440586.1_9 Forward -271 -252 10.6192 0.258
NP_442251.1_6 Forward -379 -372 15.2804 0.0124
NP_442251.1_6 Reverse -372 -379 15.2804 0.0124
NP_442251.1_6 Forward -125 -118 13.7071 0.0268
NP_440192.1_4 Forward -382 -363 10.4648 0.237
NP_441262.1_3 Forward -380 -373 14.7888 0.0223
NP_441262.1_3 Forward -336 -329 14.7888 0.0223
NP_441262.1_3 Reverse -371 -378 6.52896 0.0809
NP_440027.1_3 Forward -136 -118 3.06666 0.28
NP_440027.1_8 Reverse -288 -307 8.65176 0.246
NP_440027.1_8 Forward -339 -320 4.52188 0.287
NP_443051.1_1 Forward -381 -372 18.0926 0.00402
NP_443051.1_1 Reverse -370 -379 10.1278 0.0112
NP_443051.1_1 Forward -127 -118 9.83282 0.0203
NP_443051.1_1 Reverse -326 -335 9.73449 0.0265
NP_443051.1_1 Forward -337 -328 7.47288 0.0571
NP_443051.1_5 Reverse -71 -90 5.11266 0.257
NP_441232.1_10 Forward -391 -372 13.2741 0.0698
NP_439984.1_2 Reverse -328 -341 12.704 0.252
NP_439937.1_8 Forward -203 -184 9.14423 0.19
NP_439937.1_9 Forward -381 -364 -15.1047 0.287
NP_439937.1_9 Reverse -370 -387 -16.0881 0.287
NP_439937.1_9 Forward -337 -320 -16.1864 0.287
NP_442294.1_3 Reverse -210 -224 12.6836 0.279
NP_440408.1_7 Reverse -31 -50 9.73422 0.255
NP_440408.1_7 Forward -336 -317 9.14423 0.264
NP_440439.1_1 Reverse -324 -337 17.5222 0.0105
NP_440439.1_1 Reverse -368 -381 10.2457 0.0372
NP_440439.1_1 Forward -339 -326 7.6891 0.0624
NP_442239.1_8 Reverse -254 -273 7.7676 0.255
NP_440372.1_2 Forward -379 -372 16.3621 0.0124
NP_440372.1_2 Reverse -372 -379 16.3621 0.0124
NP_440372.1_2 Forward -335 -328 13.8055 0.0214
NP_440372.1_2 Forward -125 -118 6.62729 0.151
NP_440372.1_2 Reverse -328 -335 6.52896 0.188
NP_440372.1_2 Reverse -118 -125 6.52896 0.188
NP_441789.1_7 Forward -274 -255 -4.32786 0.28
NP_440316.1_10 Forward -381 -371 13.648 0.208
NP_439977.1_5 Reverse -365 -384 10.1275 0.0879
NP_441572.1_7 Forward -342 -323 -5.11376 0.25
NP_442384.1_10 Reverse -117 -130 8.57408 0.0641
NP_442384.1_10 Forward -380 -367 8.18076 0.0685
NP_442384.1_10 Forward -126 -113 4.44418 0.157
NP_442384.1_10 Reverse -371 -384 2.2809 0.23
NP_442114.1_4 Reverse -371 -382 11.1701 0.142
NP_441018.1_7 Reverse -288 -307 7.66927 0.268
NP_442790.1_4 Forward -389 -370 3.34271 0.0729
NP_442262.1_10 Forward -379 -372 14.1988 0.0123
NP_442262.1_10 Reverse -372 -379 14.1988 0.0123
NP_442262.1_10 Reverse -328 -335 13.2155 0.0213
NP_441689.1_5 Reverse -145 -155 8.14104 0.151
NP_441689.1_5 Reverse -325 -335 6.17443 0.197
NP_440282.1_10 Reverse -317 -336 0.884433 0.182
NP_440282.1_10 Reverse -293 -312 -5.99873 0.25
NP_440531.1_6 Forward -134 -115 6.39097 0.106
NP_440562.1_1 Reverse -295 -314 10.6184 0.276
NP_441965.1_10 Forward -309 -293 3.50012 0.263
NP_441965.1_10 Reverse -9 -25 3.40179 0.265
NP_442065.1_7 Forward -281 -263 2.77242 0.215
NP_440297.1_9 Reverse -372 -382 9.51814 0.0917
NP_442280.1_10 Forward -310 -292 8.18164 0.267
NP_442280.1_10 Forward -50 -32 6.42843 0.275
NP_442280.1_10 Reverse -211 -229 5.94143 0.28
NP_441103.1_9 Reverse -217 -227 14.5404 0.216
NP_440894.1_10 Reverse -208 -227 12.5858 0.123
NP_442553.1_4 Reverse -279 -298 15.9291 0.102
NP_440999.1_9 Reverse -113 -127 1.96621 0.156
NP_440999.1_9 Forward -340 -326 -0.885388 0.22
NP_440999.1_9 Reverse -367 -381 -1.5737 0.242
NP_440999.1_9 Forward -268 -254 -1.8687 0.252
NP_440999.1_9 Forward -216 -202 -2.65535 0.273
NP_440999.1_9 Forward -189 -175 -3.54032 0.296
NP_440888.1_2 Reverse -327 -341 14.5519 0.0168
NP_440888.1_2 Forward -46 -32 12.0937 0.0516
NP_440888.1_2 Reverse -117 -131 8.25877 0.167
NP_440888.1_2 Reverse -371 -385 8.06211 0.172
NP_440888.1_2 Forward -264 -250 5.40719 0.28
NP_440888.1_2 Reverse -12 -26 5.30886 0.284
NP_442892.1_6 Forward -333 -314 1.76941 0.294
NP_440822.1_1 Forward -274 -255 16.9499 0.13
NP_440179.1_6 Reverse -372 -391 7.17762 0.209
NP_442225.1_10 Forward -334 -315 5.60352 0.287
NP_439969.1_1 Forward -397 -378 -5.01543 0.288
NP_442948.1_2 Reverse -326 -345 3.34271 0.287
NP_442948.1_2 Forward -127 -108 3.14605 0.294
NP_442277.1_4 Reverse -362 -381 6.78348 0.156
NP_442033.1_10 Forward -382 -363 -12.1936 0.264
NP_442033.1_10 Reverse -115 -134 -13.2752 0.284
NP_441543.1_2 Reverse -372 -381 9.34117 0.0818
NP_441543.1_2 Reverse -328 -337 8.65285 0.0968
NP_441543.1_2 Forward -335 -326 6.5879 0.143
NP_441543.1_2 Forward -379 -370 6.39124 0.153
NP_441543.1_2 Reverse -118 -127 6.09625 0.153
NP_441543.1_2 Forward -125 -116 4.32629 0.26
NP_442845.1_2 Reverse -285 -299 11.5043 0.128
NP_442845.1_2 Reverse -321 -335 7.86607 0.195
NP_441469.1_8 Forward -381 -372 13.3727 0.073
NP_441469.1_8 Forward -337 -328 6.39124 0.227
NP_441469.1_8 Reverse -370 -379 5.89959 0.246
NP_442315.1_1 Reverse -256 -274 4.44404 0.271
NP_442315.1_1 Reverse -178 -196 3.3624 0.291
NP_443064.1_6 Reverse -371 -381 10.7247 0.136
NP_443064.1_6 Forward -336 -326 9.65817 0.205
NP_442337.1_8 Reverse -169 -188 -2.16383 0.295
NP_440257.1_7 Reverse -192 -211 20.8695 0.0858
NP_442578.1_7 Forward -379 -372 14.5921 0.026
NP_442578.1_7 Reverse -372 -379 14.5921 0.026
NP_442578.1_7 Forward -125 -118 12.5271 0.0544
NP_442578.1_7 Forward -335 -328 6.0373 0.18
NP_442578.1_7 Forward -155 -148 5.34899 0.2
NP_440710.1_1 Forward -314 -296 -8.24065 0.261
NP_441462.1_2 Forward -336 -326 18.4663 0.00326
NP_441462.1_2 Forward -380 -370 17.9746 0.00406
NP_441462.1_2 Reverse -371 -381 10.3048 0.0123
NP_441462.1_2 Reverse -327 -337 1.74999 0.0811
NP_441462.1_2 Reverse -117 -127 0.57002 0.144
NP_441462.1_2 Forward -126 -116 -0.41329 0.225
NP_441621.1_7 Forward -382 -368 14.0609 0.0266
NP_441621.1_7 Forward -338 -324 -5.60527 0.256
NP_443062.1_1 Forward -380 -362 10.4961 0.116
NP_443062.1_1 Reverse -327 -345 5.5232 0.227
NP_443062.1_1 Reverse -147 -165 5.42569 0.229
NP_441601.1_4 Forward -328 -309 -1.37718 0.293
NP_442204.1_1 Reverse -367 -378 1.53364 0.269
NP_442204.1_1 Forward -130 -119 -0.236322 0.289
NP_442204.1_2 Reverse -317 -336 13.3725 0.223
NP_441560.1_3 Reverse -312 -330 10.1472 0.271
NP_441560.1_10 Forward -322 -303 5.211 0.298
NP_440516.1_8 Forward -380 -371 18.9776 0.00442
NP_440516.1_8 Forward -336 -327 16.9127 0.00442
NP_440516.1_8 Reverse -327 -336 14.8477 0.00685
NP_440516.1_8 Forward -126 -117 9.24284 0.0264
NP_440516.1_8 Reverse -371 -380 7.07956 0.0867
NP_440516.1_8 Forward -314 -305 -0.196935 0.185
NP_442080.1_7 Forward -103 -84 -5.01543 0.296
NP_442428.1_5 Forward -379 -372 15.8704 0.0124
NP_442428.1_5 Reverse -372 -379 15.8704 0.0124
NP_442428.1_5 Reverse -118 -125 13.1171 0.038
NP_442428.1_5 Forward -125 -118 6.23397 0.201
NP_442428.1_5 Forward -335 -328 6.13563 0.209
NP_442428.1_5 Reverse -328 -335 6.0373 0.212
NP_442428.1_5 Reverse -32 -39 4.66067 0.244
NP_442120.1_10 Forward -218 -199 -13.5702 0.286
NP_440673.1_3 Forward -378 -371 13.1171 0.0426
NP_440673.1_3 Reverse -373 -380 12.4288 0.0426
NP_440673.1_3 Reverse -329 -336 12.4288 0.0426
NP_440673.1_3 Reverse -119 -126 10.1672 0.149
NP_440673.1_3 Reverse -14 -21 8.29892 0.221
NP_441052.1_2 Reverse -371 -381 10.9931 0.0285
NP_441052.1_2 Reverse -117 -127 8.73149 0.0397
NP_441052.1_2 Forward -126 -116 7.15819 0.0797
NP_441052.1_2 Forward -306 -296 2.33998 0.209
NP_441052.1_2 Forward -336 -326 0.865012 0.256
NP_441052.1_2 Forward -380 -370 0.668351 0.256
NP_441052.1_2 Reverse -327 -337 0.668351 0.256
NP_440992.1_2 Forward -380 -361 8.55425 0.291
NP_442219.1_9 Forward -379 -370 8.84951 0.0681
NP_442219.1_9 Forward -125 -116 8.84951 0.0681
NP_442219.1_9 Reverse -372 -381 8.25953 0.0681
NP_442219.1_9 Reverse -118 -127 5.01461 0.193
NP_440436.1_4 Reverse -372 -381 15.9289 0.00508
NP_440436.1_4 Reverse -328 -337 8.55409 0.0997
NP_440436.1_4 Forward -39 -30 4.52254 0.256
NP_441884.1_8 Forward -381 -362 -8.94866 0.265
NP_441884.1_9 Forward -352 -333 -20.7484 0.205
NP_441884.1_9 Forward -339 -320 -23.9933 0.284
NP_440314.1_9 Reverse -148 -167 -10.3253 0.295
NP_442907.1_9 Reverse -292 -311 4.81767 0.171
NP_441719.1_4 Forward -379 -372 16.3621 0.0124
NP_441719.1_4 Reverse -372 -379 16.3621 0.0124
NP_441719.1_4 Forward -335 -328 6.82395 0.0855
NP_441719.1_4 Forward -125 -118 6.62729 0.151
NP_441719.1_4 Reverse -328 -335 6.52896 0.188
NP_441719.1_4 Reverse -118 -125 6.52896 0.188
NP_441719.1_4 Forward -155 -148 3.97235 0.231
NP_441733.1_10 Forward -383 -370 9.45906 0.117
NP_441004.1_1 Reverse -267 -286 -10.9153 0.229
NP_441004.1_1 Forward -177 -158 -14.9469 0.271
NP_441004.1_1 Reverse -252 -271 -15.9302 0.279
NP_441004.1_2 Forward -101 -82 0.786102 0.23
NP_442366.1_3 Reverse -30 -48 -3.12744 0.242
NP_442873.1_5 Forward -271 -252 13.175 0.189
NP_442873.1_9 Forward -283 -264 10.4217 0.208
NP_440296.1_10 Reverse -261 -280 -7.96535 0.246
NP_441115.1_4 Forward -127 -109 10.1465 0.187
NP_442694.1_9 Forward -252 -233 16.1257 0.168
NP_442854.1_6 Forward -336 -317 2.3594 0.272
NP_440328.1_4 Forward -342 -323 7.86593 0.117
NP_443054.1_2 Reverse -325 -339 2.45787 0.245
NP_442430.1_10 Forward -136 -117 10.815 0.262
NP_441966.1_7 Reverse -46 -65 -1.18128 0.279
NP_441851.1_10 Forward -381 -371 10.0098 0.106
NP_441851.1_10 Forward -337 -327 6.37155 0.172
NP_442622.1_8 Reverse -117 -135 -18.5654 0.23
NP_442622.1_8 Reverse -371 -389 -18.9587 0.293
NP_442011.1_1 Forward -337 -318 3.6377 0.239
NP_441668.1_4 Forward -50 -31 2.45773 0.198
NP_442515.1_1 Reverse -370 -384 -2.06536 0.268
NP_442515.1_1 Forward -337 -323 -4.91696 0.298
NP_440593.1_3 Forward -45 -26 -5.11376 0.258
NP_440940.1_7 Forward -390 -372 4.54162 0.25
NP_441349.1_10 Reverse -361 -380 -0.590531 0.0947
NP_441349.1_10 Reverse -317 -336 -8.55534 0.278
NP_441349.1_10 Reverse -34 -53 -9.73531 0.297
NP_441409.1_6 Reverse -111 -130 -6.68705 0.133
NP_440432.1_9 Reverse -372 -387 18.7611 0.00961
NP_440432.1_9 Reverse -328 -343 4.40479 0.0701
NP_440432.1_9 Reverse -148 -163 -5.03498 0.233
NP_442843.1_1 Reverse -195 -214 -10.227 0.277
NP_442843.1_1 Reverse -265 -284 -11.8003 0.293
NP_440474.1_8 Reverse -372 -386 7.66879 0.202
NP_440474.1_8 Forward -335 -321 6.88214 0.215
NP_441477.1_10 Reverse -320 -338 -0.669169 0.294
NP_440431.1_3 Reverse -130 -149 -10.817 0.278
NP_442450.1_5 Forward -382 -372 10.1081 0.115
NP_442450.1_5 Reverse -115 -125 5.78156 0.227
NP_440588.1_2 Reverse -108 -127 9.14423 0.0446
NP_440588.1_2 Reverse -362 -381 5.80098 0.0617
NP_440588.1_2 Forward -135 -116 -3.73712 0.195
NP_440023.1_7 Forward -182 -163 13.7658 0.259
NP_442006.1_2 Forward -180 -163 -10.5809 0.197
NP_442006.1_2 Forward -237 -220 -15.3991 0.224
NP_442243.1_1 Reverse -31 -49 -0.276578 0.244
NP_441570.1_1 Forward -380 -362 -6.86402 0.0823
NP_441570.1_1 Reverse -117 -135 -17.5821 0.283
NP_441078.1_4 Forward -380 -371 9.93116 0.0203
NP_441078.1_4 Forward -336 -327 9.93116 0.0203
NP_441078.1_4 Reverse -371 -380 9.83282 0.0226
NP_441078.1_4 Reverse -327 -336 9.83282 0.0226
NP_441078.1_4 Forward -126 -117 0.393051 0.205
NP_441078.1_4 Reverse -117 -126 -0.000272808 0.205
NP_442729.1_8 Reverse -50 -63 5.42749 0.246
NP_441539.1_10 Forward -180 -161 -1.18052 0.171
NP_440707.1_6 Forward -134 -115 16.4199 0.172
NP_440526.1_3 Reverse -372 -383 11.4645 0.0646
NP_441432.1_8 Forward -127 -118 13.7661 0.0281
NP_441432.1_8 Forward -381 -372 8.35786 0.0755
NP_441432.1_8 Reverse -370 -379 6.98123 0.112
NP_441432.1_8 Reverse -326 -335 6.98123 0.112
NP_441432.1_8 Forward -337 -328 5.50626 0.151
NP_441432.1_8 Reverse -291 -300 2.85133 0.281
NP_441432.1_8 Reverse -36 -45 2.85133 0.281
NP_442320.1_8 Forward -342 -328 5.01447 0.0442
NP_442320.1_8 Forward -386 -372 -3.44199 0.122
NP_442344.1_7 Reverse -266 -285 -7.57203 0.188
NP_441732.1_2 Reverse -367 -383 -16.3627 0.165
NP_441732.1_2 Reverse -113 -129 -16.4611 0.167
NP_442003.1_4 Reverse -328 -347 12.4875 0.27
NP_440760.1_1 Forward -46 -27 -18.1918 0.21
NP_442797.1_7 Forward -337 -319 -0.472507 0.283
NP_442146.1_3 Forward -167 -148 17.6007 0.185
NP_441072.1_5 Forward -138 -120 22.2419 0.095
NP_440713.1_4 Reverse -287 -306 3.73603 0.239
NP_440713.1_4 Reverse -317 -336 2.85105 0.256
NP_442489.1_1 Forward -272 -253 16.1249 0.269
NP_442489.1_2 Forward -347 -328 7.17762 0.172
NP_442489.1_7 Reverse -327 -336 10.5211 0.0102
NP_442489.1_7 Forward -380 -371 10.4228 0.0151
NP_442489.1_7 Forward -336 -327 10.4228 0.0151
NP_442489.1_7 Reverse -371 -380 10.3245 0.0193
NP_442489.1_7 Forward -126 -117 0.688044 0.152
NP_442489.1_7 Reverse -117 -126 0.491382 0.178
NP_442079.1_7 Forward -379 -360 4.916 0.184
NP_442079.1_7 Reverse -372 -391 0.294447 0.286
NP_440559.1_1 Reverse -372 -381 17.306 0.00658
NP_440559.1_1 Forward -335 -326 5.89959 0.136
NP_441659.2_8 Forward -380 -370 11.3864 0.0184
NP_441659.2_8 Forward -336 -326 11.3864 0.0184
NP_441659.2_8 Reverse -371 -381 9.81313 0.0269
NP_441659.2_8 Reverse -327 -337 8.82982 0.0393
NP_441659.2_8 Reverse -117 -127 1.55333 0.238
NP_440860.1_8 Reverse -190 -209 13.6675 0.296
NP_440860.1_8 Reverse -325 -344 13.2741 0.296
NP_442913.1_10 Reverse -351 -370 -6.29373 0.3
NP_441040.1_2 Forward -61 -42 -15.4385 0.286
NP_441800.1_3 Reverse -26 -44 5.91901 0.286
NP_440779.1_5 Reverse -371 -388 -5.46769 0.149
NP_442346.1_5 Reverse -370 -380 12.4681 0.0421
NP_442346.1_5 Forward -381 -371 9.51814 0.118
NP_442346.1_5 Reverse -116 -126 8.4365 0.137
NP_442346.1_5 Reverse -326 -336 6.46988 0.201
NP_442346.1_5 Reverse -346 -356 4.50326 0.286
NP_442346.1_5 Forward -127 -117 4.50326 0.286
NP_440545.1_3 Forward -384 -367 7.02034 0.0522
NP_440545.1_3 Reverse -113 -130 0.530496 0.137
NP_440545.1_3 Reverse -367 -384 -0.944468 0.161
NP_440545.1_3 Forward -228 -211 -4.18939 0.22
NP_440025.1_1 Forward -193 -174 9.53756 0.192
NP_440831.1_3 Forward -68 -49 6.67837 0.271
NP_440831.1_3 Reverse -318 -337 4.83391 0.298
NP_440831.1_9 Forward -157 -138 12.5858 0.296
NP_441629.1_3 Forward -280 -261 -2.45958 0.269
NP_440486.1_6 Reverse -266 -285 5.60432 0.293
NP_441653.1_2 Forward -347 -328 7.10507 0.223
NP_440010.1_10 Forward -392 -373 4.62101 0.244
NP_441943.1_8 Reverse -54 -73 -5.11376 0.245
NP_442603.1_7 Forward -126 -112 11.2087 0.119
NP_442603.1_7 Reverse -56 -70 5.80051 0.273
NP_442603.1_7 Reverse -371 -385 5.50552 0.29
NP_440449.1_6 Reverse -319 -337 10.7847 0.148
NP_441948.1_4 Reverse -364 -382 -1.06249 0.14
NP_441948.1_4 Forward -387 -369 -1.16082 0.143
NP_441948.1_4 Forward -343 -325 -4.70074 0.239
NP_441833.1_4 Forward -379 -372 15.9687 0.0124
NP_441833.1_4 Reverse -372 -379 15.9687 0.0124
NP_441833.1_4 Reverse -328 -335 6.52896 0.0924
NP_441833.1_4 Reverse -118 -125 6.3323 0.134
NP_441833.1_4 Forward -335 -328 6.23397 0.163
NP_441833.1_4 Forward -125 -118 6.23397 0.163
NP_442162.1_9 Forward -379 -372 16.2637 0.0124
NP_442162.1_9 Reverse -372 -379 16.2637 0.0124
NP_442162.1_9 Forward -335 -328 12.9205 0.0282
NP_442162.1_9 Reverse -328 -335 12.9205 0.0282
NP_442162.1_9 Forward -125 -118 6.52896 0.178
NP_442162.1_9 Reverse -118 -125 6.43063 0.208
NP_440671.1_4 Forward -342 -328 4.91614 0.3
NP_442404.1_9 Forward -333 -319 8.75042 0.296
NP_440224.1_1 Forward -147 -128 -4.13045 0.29
NP_440772.1_6 Reverse -195 -214 9.14423 0.286
NP_442045.1_5 Forward -49 -30 5.50599 0.205
NP_441915.1_4 Forward -396 -377 6.1935 0.293
NP_442199.1_5 Reverse -319 -338 -3.73712 0.211
NP_442199.1_5 Forward -344 -325 -4.42544 0.228
NP_442140.1_3 Reverse -372 -382 14.828 0.0433
NP_442140.1_3 Reverse -328 -338 12.1731 0.0637
NP_442140.1_3 Forward -379 -369 6.46988 0.168
NP_442140.1_3 Forward -125 -115 4.3066 0.248
NP_441671.1_10 Forward -317 -298 7.27595 0.205
NP_440875.1_9 Reverse -329 -339 16.6457 0.0145
NP_440875.1_9 Reverse -119 -129 9.44274 0.233
NP_440875.1_9 Forward -378 -368 7.39866 0.267
NP_441813.1_5 Reverse -369 -379 18.1713 0.00743
NP_441813.1_5 Forward -338 -328 9.7148 0.0241
NP_441813.1_5 Forward -382 -372 8.92815 0.0347
NP_441813.1_5 Forward -128 -118 8.4365 0.0432
NP_441813.1_5 Reverse -325 -335 5.5849 0.118
NP_440594.1_8 Reverse -372 -385 11.0318 0.153
NP_440594.1_8 Reverse -118 -131 9.65513 0.183
NP_441259.1_3 Forward -394 -375 11.9958 0.251
NP_440590.1_4 Forward -335 -322 2.87088 0.0788
NP_440590.1_4 Reverse -328 -341 2.2809 0.0939
NP_440590.1_4 Reverse -118 -131 -4.11062 0.258
NP_440590.1_4 Reverse -372 -385 -5.78224 0.289
NP_440567.1_1 Reverse -372 -386 16.5192 0.0166
NP_440567.1_1 Forward -335 -321 7.76774 0.0654
NP_440567.1_1 Forward -379 -365 3.24451 0.148
NP_442497.1_10 Reverse -372 -381 19.8626 0.00532
NP_442497.1_10 Forward -379 -370 8.55452 0.0294
NP_442497.1_10 Forward -335 -326 7.86621 0.0695
NP_442497.1_10 Reverse -118 -127 7.76787 0.0731
NP_442497.1_10 Reverse -328 -337 0.589713 0.153
NP_440821.1_4 Forward -382 -372 19.5479 0.00399
NP_440821.1_4 Reverse -325 -335 0.963343 0.145
NP_440821.1_4 Forward -338 -328 0.471689 0.174
NP_440821.1_4 Reverse -369 -379 -0.118297 0.229
NP_440927.1_4 Forward -339 -320 11.9958 0.257
NP_441239.1_9 Reverse -369 -381 16.2636 0.0175
NP_441239.1_9 Reverse -325 -337 16.1653 0.0175
NP_441239.1_9 Reverse -29 -41 5.15219 0.227
NP_441239.1_9 Forward -382 -370 4.95553 0.234
NP_441239.1_9 Forward -338 -326 4.46387 0.253
NP_441009.1_4 Forward -380 -361 14.6508 0.167
NP_442897.1_7 Forward -386 -367 16.2241 0.228
NP_441892.1_1 Forward -389 -372 -3.00942 0.231
NP_441892.1_1 Forward -323 -306 -4.18939 0.256
NP_440665.1_1 Reverse -374 -393 -13.2752 0.257
NP_440604.1_6 Forward -380 -361 -5.01543 0.267
NP_442809.1_6 Forward -213 -194 -0.197208 0.299
NP_440546.1_4 Forward -380 -370 14.7 0.0459
NP_440546.1_4 Forward -336 -326 14.5061 0.0459
NP_440546.1_4 Reverse -371 -381 10.143 0.109
NP_440546.1_4 Reverse -327 -337 9.27034 0.146
NP_441230.1_5 Forward -341 -322 8.45592 0.146
NP_440675.1_3 Reverse -371 -390 10.1275 0.186
NP_440462.1_6 Reverse -369 -379 17.7779 0.00669
NP_440462.1_6 Reverse -325 -335 16.4996 0.0102
NP_440462.1_6 Forward -382 -372 10.4031 0.0396
NP_440462.1_6 Forward -128 -118 9.02648 0.0498
NP_440462.1_6 Forward -338 -328 7.74818 0.0699
NP_440462.1_6 Forward -158 -148 5.97822 0.135
NP_441184.1_4 Reverse -315 -334 18.3873 0.239
NP_440868.1_4 Reverse -367 -379 16.3619 0.0151
NP_440868.1_4 Forward -130 -118 9.87208 0.0421
NP_440868.1_4 Reverse -323 -335 9.67541 0.0441
NP_440868.1_4 Forward -340 -328 7.80712 0.0637
NP_440868.1_4 Forward -384 -372 0.727295 0.201
NP_442499.1_4 Reverse -87 -101 12.1926 0.226
NP_440270.1_6 Forward -51 -32 8.55425 0.256
NP_442402.1_1 Reverse -207 -226 8.45592 0.278
NP_442402.1_4 Reverse -207 -226 -3.63955 0.219
NP_442402.1_10 Reverse -166 -176 13.2542 0.204
NP_440036.1_10 Reverse -340 -352 16.1653 0.284
NP_440653.1_10 Reverse -32 -51 6.78429 0.203
NP_440696.1_3 Forward -311 -293 -3.32411 0.285
NP_441843.2_9 Reverse -329 -347 12.34 0.205
NP_442039.1_4 Forward -379 -372 15.1821 0.0124
NP_442039.1_4 Reverse -372 -379 15.1821 0.0124
NP_442039.1_4 Forward -335 -328 11.6422 0.0747
NP_442039.1_7 Reverse -33 -43 6.96153 0.286
NP_441811.1_8 Forward -386 -372 5.70279 0.293
NP_442380.1_10 Forward -63 -45 9.16393 0.262
NP_442837.1_3 Forward -379 -372 15.7721 0.0124
NP_442837.1_3 Reverse -372 -379 15.7721 0.0124
NP_442837.1_3 Reverse -118 -125 13.5105 0.0268
NP_442837.1_3 Forward -125 -118 6.13563 0.25
NP_442837.1_3 Forward -335 -328 6.0373 0.25
NP_442837.1_3 Reverse -328 -335 6.0373 0.25
NP_442053.1_1 Forward -380 -371 17.601 0.00138
NP_442053.1_1 Reverse -327 -336 16.6177 0.00257
NP_442053.1_1 Reverse -371 -380 16.2243 0.00451
NP_442053.1_1 Forward -336 -327 8.65285 0.0741
NP_442053.1_1 Forward -126 -117 7.96454 0.0863
NP_442053.1_1 Reverse -117 -126 6.48957 0.13
NP_440505.1_3 Forward -338 -328 14.3364 0.0224
NP_440505.1_3 Forward -382 -372 7.84651 0.147
NP_440505.1_3 Forward -128 -118 7.55152 0.151
NP_440505.1_3 Reverse -369 -379 7.35486 0.157
NP_440505.1_3 Reverse -325 -335 5.5849 0.222
NP_440505.1_3 Forward -226 -216 5.48657 0.227
NP_440505.1_7 Reverse -380 -399 3.83436 0.207
NP_440505.1_7 Reverse -298 -317 -1.37718 0.273
NP_440351.1_8 Forward -109 -91 7.98396 0.226
NP_441959.1_10 Forward -381 -363 11.7174 0.225
NP_442532.1_7 Forward -336 -322 4.52282 0.171
NP_440914.1_1 Forward -380 -370 15.0561 0.00832
NP_440914.1_1 Forward -126 -116 14.4706 0.0143
NP_440914.1_1 Forward -336 -326 12.1284 0.0654
NP_440914.1_1 Forward -21 -11 8.81029 0.186
NP_440914.1_1 Reverse -37 -47 7.15123 0.249
NP_440914.1_1 Reverse -327 -337 6.66328 0.269
NP_441011.1_8 Forward -379 -370 15.0444 0.0176
NP_441011.1_8 Reverse -372 -381 14.356 0.0249
NP_441011.1_8 Reverse -118 -127 13.8644 0.0295
NP_441011.1_8 Forward -335 -326 13.0777 0.0366
NP_441011.1_8 Reverse -328 -337 7.07956 0.179
NP_442533.1_1 Reverse -255 -274 -12.6852 0.236
NP_442533.1_1 Reverse -264 -283 -14.9469 0.248
NP_442533.1_6 Reverse -327 -336 14.2577 0.0132
NP_442533.1_6 Forward -300 -291 10.8161 0.0518
NP_442533.1_6 Forward -380 -371 7.86621 0.0862
NP_442533.1_6 Forward -336 -327 7.47288 0.0898
NP_442533.1_6 Reverse -371 -380 7.37455 0.0898
NP_442533.1_6 Forward -306 -297 6.48957 0.109
NP_442533.1_6 Forward -126 -117 5.3096 0.145
NP_442533.1_6 Forward -273 -264 4.52295 0.179
NP_442533.1_6 Reverse -297 -306 4.12963 0.191
NP_442533.1_6 Reverse -347 -356 3.93297 0.197
NP_442533.1_6 Forward -311 -302 3.34298 0.216
NP_442533.1_6 Forward -40 -31 2.94966 0.232
NP_441089.1_10 Forward -347 -328 0.786102 0.294
NP_442541.1_10 Forward -46 -32 3.63724 0.254
NP_440263.1_5 Forward -250 -236 8.35772 0.294
NP_442232.1_3 Reverse -319 -338 -3.04881 0.163
NP_442322.1_4 Forward -276 -259 -0.945159 0.226
NP_442322.1_4 Forward -314 -297 -6.15667 0.275
NP_442322.1_4 Forward -270 -253 -9.30325 0.29
NP_442229.1_1 Forward -42 -28 9.6354 0.184
NP_442229.1_1 Reverse -325 -339 7.07881 0.198
NP_441219.1_6 Forward -166 -148 17.5221 0.0986
NP_441482.1_7 Forward -386 -372 -3.04867 0.106
NP_441482.1_7 Reverse -321 -335 -12.0951 0.29
NP_439944.1_9 Reverse -372 -382 17.4829 0.00423
NP_439944.1_9 Forward -335 -325 8.4365 0.108
NP_441028.1_6 Reverse -217 -227 3.42118 0.296
NP_440116.1_8 Forward -379 -360 11.0125 0.0288
NP_440115.1_6 Forward -129 -119 10.2065 0.115
NP_440115.1_6 Forward -383 -373 10.0098 0.115
NP_440115.1_6 Reverse -324 -334 6.17489 0.197
NP_440115.1_6 Reverse -368 -378 4.79825 0.282
NP_441059.1_2 Forward -392 -373 -4.72043 0.242
NP_442890.1_9 Forward -322 -303 19.469 0.113
NP_441972.1_5 Reverse -372 -391 -9.047 0.278
NP_441106.1_1 Forward -381 -372 9.73449 0.0311
NP_441106.1_1 Reverse -370 -379 9.34117 0.0333
NP_441106.1_1 Reverse -326 -335 8.84951 0.0431
NP_441106.1_1 Forward -127 -118 8.75118 0.0469
NP_441106.1_1 Forward -337 -328 8.45619 0.0548
NP_441106.1_1 Reverse -146 -155 5.21127 0.167
NP_441106.1_1 Reverse -30 -39 4.62128 0.213
NP_439903.1_6 Reverse -368 -387 -0.886293 0.287
NP_442306.1_10 Reverse -366 -385 -2.85214 0.0932
NP_442306.1_10 Reverse -322 -341 -11.3086 0.126
NP_442306.1_10 Reverse -43 -62 -21.6334 0.282
NP_441286.1_1 Reverse -370 -382 5.54551 0.0259
NP_441286.1_1 Forward -337 -325 -4.28759 0.154
NP_441286.1_1 Forward -381 -369 -4.48425 0.161
NP_440670.1_8 Forward -336 -327 18.0926 0.00136
NP_440670.1_8 Reverse -327 -336 15.831 0.00494
NP_440670.1_8 Forward -380 -371 9.04618 0.0606
NP_440670.1_8 Reverse -371 -380 8.75118 0.0606
NP_441479.1_1 Forward -383 -364 14.6508 0.126
NP_441479.1_1 Reverse -198 -217 11.2092 0.211
NP_440886.1_7 Forward -337 -327 8.14104 0.0805
NP_440886.1_7 Reverse -370 -380 8.04271 0.0805
NP_440886.1_7 Forward -381 -371 6.76441 0.114
NP_440886.1_7 Reverse -326 -336 6.76441 0.114
NP_440886.1_7 Forward -127 -117 6.17443 0.141
NP_440886.1_7 Forward -265 -255 4.89613 0.213
NP_442614.1_2 Forward -380 -366 9.93102 0.24
NP_442614.1_2 Forward -126 -112 6.19444 0.291
NP_442614.1_2 Forward -336 -322 5.99778 0.295
NP_442072.1_1 Forward -218 -200 3.65739 0.289
NP_442072.1_9 Forward -337 -319 -12.7639 0.091
NP_442072.1_9 Reverse -202 -220 -15.4188 0.18
NP_442072.1_9 Reverse -326 -344 -21.8103 0.212
NP_440907.2_8 Reverse -372 -382 19.449 0.00351
NP_440907.2_8 Forward -335 -325 9.616 0.103
NP_440907.2_8 Reverse -328 -338 6.17443 0.178
NP_441021.1_1 Reverse -372 -391 -1.27885 0.114
NP_441021.1_8 Forward -341 -323 8.18062 0.181
NP_441463.1_3 Forward -346 -327 -9.34199 0.278
NP_441463.1_3 Forward -390 -371 -9.63698 0.282
NP_441463.1_3 Reverse -361 -380 -9.83364 0.286
NP_441626.1_2 Forward -379 -372 15.7721 0.0124
NP_441626.1_2 Reverse -372 -379 15.7721 0.0124
NP_441626.1_2 Forward -335 -328 12.2322 0.0511
NP_441626.1_2 Forward -125 -118 6.0373 0.212
NP_441626.1_2 Reverse -328 -335 5.93897 0.231
NP_441626.1_2 Reverse -118 -125 5.93897 0.231
NP_442365.1_7 Reverse -367 -386 0.196116 0.177
NP_442794.1_1 Reverse -113 -125 20.6885 0.00523
NP_442615.1_1 Reverse -318 -336 7.39397 0.0317
NP_442615.1_1 Forward -389 -371 -2.14413 0.139
NP_442615.1_1 Reverse -108 -126 -7.06068 0.273
NP_442615.1_1 Reverse -362 -380 -7.25734 0.283
NP_441962.1_4 Forward -374 -355 -14.1602 0.284
NP_440387.1_1 Forward -336 -320 6.05672 0.0293
NP_440387.1_1 Reverse -371 -387 -0.728113 0.141
NP_441431.1_2 Reverse -368 -382 12.487 0.116
NP_441431.1_2 Forward -339 -325 11.7003 0.135
NP_441431.1_2 Reverse -28 -42 10.0287 0.17
NP_441488.1_7 Reverse -321 -340 15.0441 0.0544
NP_441488.1_8 Forward -319 -305 8.16044 0.204
NP_441836.1_2 Reverse -258 -277 2.26107 0.175
NP_441836.1_2 Forward -132 -113 -0.197208 0.212
NP_441993.1_1 Reverse -321 -340 1.55686 0.274
NP_440114.1_10 Forward -336 -322 17.7975 0.00892
NP_440114.1_10 Reverse -327 -341 12.1926 0.0885
NP_440114.1_10 Reverse -371 -385 11.2093 0.121
NP_441510.2_9 Forward -379 -360 10.1275 0.165
NP_440287.1_4 Forward -211 -192 15.1416 0.194
NP_440293.1_3 Reverse -295 -314 -3.24547 0.244
NP_440293.1_9 Forward -58 -44 12.4072 0.243
NP_440293.1_10 Forward -383 -364 -2.36049 0.273
NP_439988.1_7 Reverse -373 -387 14.8469 0.292
NP_441237.1_9 Reverse -372 -382 17.2863 0.00348
NP_439910.1_2 Forward -344 -327 -12.7442 0.0944
NP_440502.1_3 Reverse -217 -227 16.7119 0.1
NP_442278.1_9 Reverse -49 -68 17.9932 0.299
NP_440457.1_1 Forward -384 -372 17.7386 0.0426
NP_440457.1_1 Forward -340 -328 1.61227 0.232
NP_440457.1_1 Reverse -367 -379 0.628964 0.25
NP_440457.1_1 Forward -318 -306 -0.354346 0.262
NP_442940.1_2 Forward -336 -317 8.35759 0.167
NP_440798.1_6 Reverse -328 -341 4.14919 0.147
NP_440798.1_6 Reverse -372 -385 2.2809 0.182
NP_440798.1_6 Forward -335 -322 0.707601 0.251
NP_441984.1_3 Reverse -323 -341 7.59063 0.245
NP_441332.1_6 Forward -268 -258 15.132 0.141
NP_441436.1_2 Forward -395 -376 -6.1954 0.296
NP_440473.1_1 Reverse -368 -387 12.6071 0.219
NP_440473.1_9 Forward -137 -118 -10.3253 0.273
NP_442509.1_9 Reverse -371 -381 13.6475 0.0475
NP_442509.1_9 Reverse -327 -337 13.4509 0.0553
NP_442509.1_9 Forward -380 -370 6.56775 0.263
NP_440554.1_4 Reverse -328 -338 13.5497 0.0245
NP_440554.1_4 Forward -379 -369 11.3864 0.0403
NP_440554.1_4 Reverse -118 -128 8.33817 0.0773
NP_440554.1_4 Reverse -372 -382 6.27322 0.123
NP_440554.1_4 Forward -335 -325 5.68323 0.135
NP_441885.1_5 Forward -336 -326 9.12481 0.0238
NP_441885.1_5 Forward -126 -116 2.33998 0.0799
NP_441885.1_5 Forward -380 -370 2.24165 0.0822
NP_441885.1_5 Reverse -327 -337 1.65166 0.106
NP_441885.1_5 Reverse -371 -381 1.55333 0.109
NP_440649.2_2 Reverse -114 -133 18.0924 0.285
NP_442341.1_7 Forward -337 -323 5.21113 0.165
NP_442341.1_9 Forward -128 -114 18.7801 0.015
NP_442341.1_9 Reverse -223 -237 10.2254 0.136
NP_442341.1_9 Forward -338 -324 5.50552 0.267
NP_441756.1_5 Reverse -211 -230 -3.44213 0.29
NP_441173.1_9 Forward -277 -269 10.9338 0.242
NP_440423.1_6 Forward -388 -369 -18.4868 0.233
NP_440423.1_6 Forward -230 -211 -21.24 0.284
NP_443000.1_7 Forward -128 -118 17.4829 0.00719
NP_443000.1_7 Reverse -369 -379 11.2881 0.0345
NP_443000.1_7 Forward -382 -372 2.14332 0.226
NP_443000.1_7 Forward -338 -328 1.84832 0.228
NP_443000.1_7 Reverse -325 -335 0.963343 0.278
NP_442513.1_5 Reverse -312 -331 11.0117 0.266
NP_441842.1_10 Forward -387 -373 13.7659 0.0689
NP_441842.1_10 Forward -178 -164 7.27608 0.264
NP_440275.1_3 Forward -382 -372 19.5479 0.00756
NP_440275.1_3 Forward -338 -328 12.8614 0.0299
NP_440275.1_3 Reverse -325 -335 9.02648 0.0563
NP_440275.1_3 Reverse -369 -379 7.45319 0.0714
NP_440275.1_3 Forward -128 -118 6.37155 0.111
NP_442932.1_9 Reverse -258 -277 5.99764 0.252
NP_440091.1_1 Forward -384 -372 3.38223 0.163
NP_440091.1_1 Forward -340 -328 1.02229 0.218
NP_442354.1_7 Forward -303 -284 7.57094 0.216
NP_442275.1_1 Reverse -27 -46 5.80098 0.264
NP_440679.1_10 Reverse -194 -213 -11.5053 0.182
NP_441359.1_5 Forward -339 -320 5.40766 0.195
NP_442451.1_2 Forward -205 -186 -11.0136 0.284
NP_439962.1_4 Forward -331 -312 0.58944 0.197
NP_439962.1_8 Reverse -184 -203 8.16093 0.21
NP_441105.1_3 Reverse -316 -335 5.80098 0.0654
NP_441105.1_3 Forward -51 -32 -0.197208 0.132
NP_441105.1_3 Forward -64 -45 -2.75381 0.167
NP_440216.1_1 Reverse -327 -341 23.6974 0.000685
NP_440216.1_1 Forward -380 -366 6.78443 0.0124
NP_440216.1_1 Reverse -371 -385 -3.24533 0.0754
NP_440216.1_1 Forward -336 -322 -11.3085 0.178
NP_440216.1_1 Reverse -117 -131 -11.3085 0.178
NP_440216.1_1 Reverse -215 -229 -11.8001 0.219
NP_440172.1_1 Forward -380 -370 18.5646 0.00421
NP_440172.1_1 Forward -126 -116 13.1564 0.022
NP_440172.1_1 Forward -336 -326 7.84651 0.0718
NP_440172.1_1 Reverse -371 -381 6.46988 0.103
NP_440172.1_1 Reverse -327 -337 5.78156 0.132
NP_442015.1_10 Reverse -113 -126 10.2457 0.04
NP_441226.1_7 Forward -379 -372 14.4934 0.0123
NP_441226.1_7 Reverse -372 -379 14.4934 0.0123
NP_441226.1_7 Forward -335 -328 12.7234 0.0312
NP_441226.1_7 Reverse -328 -335 11.5435 0.0757
NP_441111.1_7 Reverse -372 -380 18.7023 0.00294
NP_441111.1_7 Forward -379 -371 8.96754 0.0463
NP_441111.1_7 Forward -335 -327 8.96754 0.0463
NP_441111.1_7 Reverse -328 -336 8.86921 0.0589
NP_441111.1_7 Reverse -118 -126 8.86921 0.0589
NP_442379.1_10 Forward -387 -370 -4.38605 0.297
NP_441766.1_2 Reverse -371 -380 18.2893 0.00297
NP_441766.1_2 Reverse -327 -336 13.9627 0.0114
NP_441766.1_2 Forward -380 -371 9.14451 0.0337
NP_441766.1_2 Reverse -117 -126 8.45619 0.0593
NP_441766.1_2 Forward -336 -327 7.76787 0.0714
NP_440416.1_9 Forward -47 -28 -3.44213 0.0746
NP_440416.1_9 Forward -331 -312 -8.45701 0.117
NP_440416.1_9 Reverse -208 -227 -11.8003 0.154
NP_440416.1_9 Reverse -364 -383 -12.8819 0.16
NP_443052.1_9 Forward -271 -252 7.57094 0.134
NP_443052.1_9 Forward -268 -249 0.786102 0.191
NP_443052.1_9 Reverse -46 -65 -5.11376 0.265
NP_441940.1_4 Forward -308 -289 9.53756 0.266
NP_441940.1_4 Reverse -369 -388 6.29264 0.294
NP_442154.1_1 Reverse -253 -271 -4.70074 0.125
NP_442154.1_1 Reverse -256 -274 -15.5171 0.22
NP_442154.1_1 Reverse -172 -190 -17.3854 0.254
NP_442154.1_1 Reverse -316 -334 -17.7788 0.267
NP_440261.1_5 Reverse -118 -131 2.87088 0.0655
NP_440261.1_5 Reverse -372 -385 -0.767364 0.0655
NP_440261.1_5 Forward -335 -322 -3.02898 0.108
NP_440261.1_5 Forward -379 -366 -4.9956 0.183
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

ACCTTGCCGTCAACCAGTGGGGCGATCGCGTGGCAGACGCAACTAAGCATGGCCCCACTCAACCGGCGATCGGCTCCACCATCCTGGGCGGTCAGGCCCTGCCCATGCCTAAGTTCTCAGCCATTCTGCCCACCCCCGACACCTCCGGTGATTTTGAGGAAATGTGCCTGACGGCAGGGGAAAGCAGCGGCAATATCACCGCTATCAAATCCGCCAGAGACATCCTGTGGGAAATGGAGAATGAAGCGCTCGATTTACTCACCTACCGCTTGCAGGCGATCACGAAGGAACAAAATCTCATGGCTGCTGGCTAAATTCTCACTTCTGGATCTGTTCCTGATGGCGCTGTAGGTTGCCCTTTGCCAGCGCTGAGTCTGATAGCAATGACGTCAATACATGC

CDS

ATGCGAGCCTTACCTTCTTTCCCCACCACGACCTCGATAGCGTTGGCGATAAGACCGCTTCAACCACCCCGACTTTTGAATTTTCAGGAGAATTCTATGAACAACTTTACCCACAATGCCCAAACCCTGCTGGAACAACAGCGTCCGAACCTAGAAATAACACTACAAGAAAATACCCGTCCAACTGTTGATCAGCCTGCGCGACTGCGTCATTTCTTTGGGCGGCTCGGTAATACCTTGGTGCAATGGCTCACCCAGAAAAGTACGCTCCGTATCCATCGATCTACCCAGGGTGAGACCGAAGTTTGGGAAGTATATGACCCCAGAGACCACCGCACCCACTTTTTTACCCACGAAAATGAAGTGCGCATTTGGTTAGAGGAGTGCTATTACCGATAG

Protein

No sequence available