Your browser is old and dusty. Try Google Chrome!

Details for sll8011

ORF sll8011
Accession NP_942405.1
Symbol
Category
Definition
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_441061.1_2 Forward -96 -82 1.47456 0.188
NP_440557.1_1 Forward -90 -71 -0.000545616 0.265
NP_440795.1_7 Reverse -9 -16 8.39725 0.213
NP_441418.1_6 Forward -229 -210 -28.2215 0.203
NP_441418.1_6 Reverse -82 -101 -29.4015 0.224
NP_440815.1_2 Forward -188 -174 10.422 0.265
NP_441453.1_7 Forward -267 -260 12.9205 0.23
NP_441453.1_7 Reverse -196 -203 11.6422 0.298
NP_441818.1_9 Forward -81 -62 -2.75381 0.209
NP_441818.1_9 Forward -87 -68 -7.27704 0.271
NP_441818.1_9 Reverse -328 -347 -9.93197 0.291
NP_442287.1_1 Forward -277 -267 13.5492 0.277
NP_443002.1_5 Reverse -291 -309 8.08151 0.299
NP_443027.1_4 Reverse -86 -96 6.46988 0.275
NP_441745.1_5 Reverse -254 -273 11.7992 0.112
NP_441812.1_1 Forward -183 -169 13.5686 0.231
NP_442062.1_8 Reverse -266 -276 4.89658 0.193
NP_441859.1_3 Reverse -359 -378 2.6536 0.258
NP_441802.1_1 Reverse -34 -53 8.75091 0.22
NP_442268.1_9 Reverse -15 -34 13.2741 0.295
NP_440044.1_8 Forward -257 -238 0.196116 0.203
NP_441352.1_4 Forward -117 -98 10.8159 0.274
NP_441594.1_6 Reverse -246 -265 6.58763 0.189
NP_441083.1_5 Reverse -220 -230 5.38824 0.12
NP_441738.1_4 Reverse -72 -91 6.78429 0.203
NP_440209.1_1 Reverse -378 -386 2.08437 0.286
NP_440870.1_4 Forward -264 -246 12.8022 0.0783
NP_442889.1_1 Forward -217 -198 -11.0136 0.217
NP_440407.1_6 Reverse -197 -211 13.9626 0.212
NP_441713.1_1 Reverse -178 -197 -16.3235 0.28
NP_440178.1_7 Reverse -87 -106 -14.6519 0.156
NP_441716.1_1 Reverse -249 -263 5.60446 0.224
NP_441716.1_1 Reverse -82 -96 3.63784 0.259
NP_440851.1_6 Forward -214 -197 -0.0594896 0.288
NP_440747.1_10 Forward -232 -220 -12.1541 0.227
NP_441014.1_9 Forward -340 -321 6.78429 0.217
NP_441014.1_10 Forward -370 -351 11.11 0.118
NP_441014.1_10 Forward -92 -73 -1.27961 0.259
NP_442848.1_5 Reverse -105 -123 -2.24246 0.284
NP_441012.1_4 Forward -24 -11 9.85238 0.272
NP_441012.1_4 Forward -335 -322 5.91914 0.286
NP_441634.1_3 Forward -161 -142 17.6007 0.096
NP_441634.1_8 Reverse -247 -261 -0.295402 0.252
NP_440376.1_1 Reverse -266 -275 4.42462 0.159
NP_440376.1_1 Reverse -106 -115 3.93297 0.188
NP_440376.1_1 Reverse -1 -10 1.47469 0.251
NP_442687.1_7 Forward -276 -266 3.61828 0.299
NP_442485.1_3 Forward -160 -141 -5.80207 0.296
NP_440667.1_2 Reverse -88 -107 -8.65367 0.29
NP_442658.1_1 Forward -277 -267 7.84605 0.205
NP_440141.1_8 Reverse -73 -92 6.88262 0.252
NP_442544.1_2 Reverse -194 -208 -0.393733 0.22
NP_442300.1_5 Reverse -80 -99 10.7175 0.289
NP_442937.1_5 Reverse -77 -96 6.68596 0.272
NP_442937.1_5 Forward -234 -215 6.58763 0.275
NP_442321.1_4 Forward -165 -146 -8.55534 0.289
NP_442486.1_6 Reverse -63 -82 1.86774 0.266
NP_442836.1_10 Forward -228 -218 8.73149 0.299
NP_441580.1_6 Reverse -71 -90 -6.1954 0.235
NP_441941.1_9 Forward -221 -202 0.687771 0.268
NP_443055.1_6 Forward -275 -257 2.57501 0.206
NP_440138.1_6 Forward -202 -183 3.14526 0.246
NP_440615.1_2 Reverse -274 -293 4.52268 0.296
NP_441099.1_5 Forward -83 -64 -12.2919 0.299
NP_443020.1_4 Forward -171 -152 17.0099 0.232
NP_441646.1_1 Reverse -1 -20 1.27776 0.232
NP_442438.1_10 Forward -108 -94 -0.885388 0.283
NP_442431.1_10 Forward -84 -66 -0.275845 0.287
NP_440147.1_4 Forward -277 -264 0.60927 0.249
NP_441041.1_4 Reverse -88 -107 -13.0786 0.28
NP_442004.1_6 Forward -264 -250 5.70279 0.184
NP_441725.1_5 Forward -336 -326 -0.806614 0.271
NP_440983.1_5 Reverse -134 -153 0.0977854 0.217
NP_441678.1_9 Reverse -183 -202 -5.70374 0.299
NP_440395.1_6 Forward -270 -251 11.1109 0.273
NP_440479.1_6 Forward -184 -170 13.2736 0.282
NP_442500.1_8 Forward -178 -164 11.4317 0.261
NP_442049.1_6 Forward -237 -218 3.24438 0.276
NP_440867.1_10 Forward -236 -217 4.32602 0.283
NP_442215.1_2 Reverse -9 -25 5.86006 0.0764
NP_442215.1_2 Forward -277 -261 -0.43312 0.167
NP_441751.2_8 Forward -263 -249 -5.50694 0.214
NP_442554.1_8 Forward -96 -86 2.43831 0.272
NP_442142.1_4 Forward -94 -81 12.9 0.0406
NP_442142.1_4 Forward -390 -377 4.34528 0.223
NP_442292.1_1 Forward -96 -87 3.7363 0.192
NP_441020.2_6 Reverse -147 -164 6.52869 0.262
NP_441673.1_1 Forward -275 -266 -8.06341 0.254
NP_442490.1_10 Reverse -216 -234 8.67227 0.264
NP_442719.1_2 Reverse -124 -142 -10.4046 0.273
NP_442808.1_1 Forward -388 -378 6.56775 0.107
NP_442808.1_1 Forward -276 -266 6.37109 0.116
NP_442808.1_1 Reverse -105 -115 3.51951 0.238
NP_442808.1_1 Reverse -219 -229 0.864583 0.3
NP_440752.1_8 Forward -311 -292 12.3892 0.213
NP_442113.1_10 Forward -344 -325 -8.16202 0.278
NP_442903.1_2 Forward -185 -166 3.48503 0.242
NP_442342.1_7 Reverse -299 -318 15.5938 0.246
NP_441114.1_3 Forward -209 -200 17.1093 0.113
NP_440558.1_2 Forward -94 -75 -4.42544 0.245
NP_440558.1_2 Forward -306 -287 -5.9004 0.267
NP_442593.1_1 Forward -91 -72 14.1591 0.285
NP_441878.1_6 Reverse -265 -275 -6.8048 0.196
NP_441878.1_6 Reverse -327 -337 -7.29646 0.217
NP_441433.1_8 Forward -154 -135 2.26107 0.223
NP_442397.1_9 Reverse -282 -301 1.96607 0.283
NP_442397.1_9 Forward -97 -78 1.86774 0.283
NP_442645.1_2 Forward -105 -86 -16.6185 0.237
NP_442645.1_2 Forward -219 -200 -17.2085 0.25
NP_442508.1_8 Forward -235 -218 13.2152 0.256
NP_441633.1_3 Forward -277 -264 2.57589 0.0926
NP_442590.1_10 Forward -271 -252 3.24438 0.294
NP_442998.1_5 Forward -144 -134 10.2065 0.222
NP_440899.1_1 Reverse -70 -89 5.96765 0.291
NP_442802.1_6 Forward -116 -97 0.786102 0.204
NP_440256.1_1 Forward -94 -75 -5.80207 0.193
NP_441090.1_5 Forward -87 -69 16.8337 0.234
NP_442283.1_6 Forward -148 -129 16.8141 0.189
NP_441559.1_8 Forward -215 -201 -5.11362 0.248
NP_441270.1_4 Forward -306 -287 17.8948 0.245
NP_442158.1_4 Reverse -174 -184 15.9097 0.129
NP_441866.1_3 Reverse -356 -369 11.524 0.242
NP_441866.1_6 Reverse -187 -206 6.78348 0.285
NP_442452.1_4 Reverse -200 -219 13.6675 0.165
NP_442866.1_1 Forward -342 -323 -5.80207 0.245
NP_442386.1_9 Reverse -139 -148 5.40752 0.253
NP_442791.1_5 Reverse -74 -93 -3.04881 0.241
NP_442240.1_2 Reverse -95 -114 -7.96535 0.135
NP_440161.1_3 Forward -339 -320 10.3242 0.23
NP_441134.1_10 Reverse -192 -210 10.5406 0.238
NP_440926.1_9 Forward -319 -300 13.1758 0.19
NP_442239.1_8 Reverse -146 -165 6.68596 0.263
NP_441138.1_5 Reverse -164 -177 2.92653 0.297
NP_440316.1_10 Reverse -201 -211 7.15819 0.251
NP_441803.1_2 Forward -96 -77 8.35759 0.116
NP_440364.1_6 Reverse -81 -94 13.785 0.275
NP_441018.1_3 Reverse -165 -184 12.29 0.286
NP_440163.1_10 Reverse -325 -335 8.73149 0.262
NP_441060.1_1 Reverse -159 -178 13.2525 0.294
NP_441335.1_8 Reverse -248 -267 6.98095 0.281
NP_440297.1_9 Forward -336 -326 0.176696 0.282
NP_440350.1_2 Reverse -81 -100 14.9458 0.106
NP_442187.1_3 Forward -230 -220 14.6313 0.165
NP_442280.1_10 Forward -214 -196 6.13623 0.28
NP_441896.1_3 Forward -149 -130 7.27595 0.0973
NP_440894.1_10 Reverse -101 -120 5.70265 0.228
NP_440894.1_10 Forward -280 -261 2.94938 0.279
NP_440822.1_8 Reverse -142 -161 6.78429 0.286
NP_440052.1_5 Forward -55 -36 -4.03212 0.249
NP_441949.1_4 Forward -86 -67 4.42435 0.286
NP_441834.1_10 Forward -216 -197 0.0977854 0.299
NP_442637.1_1 Reverse -193 -212 -2.45882 0.16
NP_443064.1_6 Forward -117 -107 11.5004 0.13
NP_442578.1_7 Reverse -36 -43 6.62729 0.18
NP_440710.1_1 Forward -345 -327 -7.749 0.244
NP_443062.1_6 Reverse -320 -339 6.98095 0.178
NP_440516.1_8 Forward -229 -220 -0.295266 0.232
NP_442080.1_7 Reverse -77 -96 -5.11376 0.299
NP_442120.1_10 Forward -161 -142 -6.49039 0.211
NP_442120.1_10 Forward -305 -286 -15.9302 0.296
NP_441867.1_2 Reverse -143 -162 -11.3086 0.223
NP_441052.1_2 Forward -258 -248 10.2065 0.0295
NP_442412.1_3 Forward -215 -196 9.73422 0.286
NP_441004.1_1 Reverse -32 -51 -9.047 0.206
NP_441004.1_1 Reverse -58 -77 -11.7019 0.241
NP_441004.1_9 Reverse -68 -86 14.1181 0.227
NP_442813.1_2 Reverse -286 -305 1.86774 0.25
NP_442694.1_4 Reverse -265 -274 11.6028 0.277
NP_443054.1_2 Reverse -144 -158 8.75105 0.109
NP_443054.1_2 Forward -277 -263 0.0979218 0.278
NP_443054.1_2 Reverse -288 -302 -0.197071 0.288
NP_442430.1_2 Forward -101 -82 5.30933 0.268
NP_442208.1_5 Forward -321 -302 -7.57203 0.274
NP_441982.1_7 Forward -140 -121 19.764 0.142
NP_440432.1_9 Forward -274 -259 -4.54333 0.211
NP_442843.1_1 Forward -148 -129 -4.72043 0.239
NP_442843.1_1 Forward -90 -71 -5.31042 0.244
NP_442843.1_1 Reverse -141 -160 -6.88371 0.245
NP_439960.1_10 Forward -236 -218 -3.42244 0.273
NP_441150.1_6 Forward -94 -75 14.0599 0.256
NP_440195.1_4 Forward -120 -101 6.39097 0.273
NP_441570.1_1 Reverse -82 -100 -13.1572 0.221
NP_442729.1_5 Reverse -87 -97 8.1415 0.248
NP_440526.1_3 Forward -274 -263 6.54802 0.195
NP_441732.1_2 Forward -107 -91 -16.7561 0.195
NP_440760.1_1 Forward -275 -256 -21.3384 0.234
NP_440578.1_10 Reverse -9 -28 10.3242 0.278
NP_441057.1_4 Reverse -130 -148 -2.14413 0.272
NP_442489.1_7 Reverse -266 -275 -1.77023 0.247
NP_440565.1_7 Reverse -101 -120 -1.18052 0.282
NP_441659.2_8 Forward -337 -327 2.53664 0.198
NP_442913.1_10 Reverse -257 -276 0.196116 0.155
NP_442008.1_2 Reverse -34 -53 4.52268 0.237
NP_440708.1_6 Forward -89 -70 -7.86702 0.255
NP_442346.1_5 Reverse -327 -337 5.87989 0.225
NP_442346.1_10 Reverse -6 -25 4.22769 0.184
NP_442346.1_10 Reverse -247 -266 -3.24547 0.294
NP_441629.1_3 Forward -344 -325 0.392004 0.235
NP_441744.1_6 Reverse -263 -282 16.991 0.217
NP_442934.1_9 Reverse -353 -371 16.9321 0.169
NP_440459.1_2 Reverse -73 -90 8.7903 0.249
NP_440459.1_2 Forward -35 -18 8.20031 0.267
NP_440010.1_4 Forward -101 -82 -3.04956 0.294
NP_441943.1_8 Reverse -192 -211 -12.6852 0.261
NP_442551.1_4 Forward -213 -198 -1.29841 0.245
NP_441168.1_7 Forward -227 -208 15.6341 0.278
NP_442547.1_2 Forward -279 -260 20.5506 0.036
NP_441813.1_3 Forward -319 -300 13.8495 0.272
NP_440590.1_4 Reverse -76 -89 -4.9956 0.272
NP_440567.1_1 Reverse -62 -76 -0.000409212 0.261
NP_441009.1_4 Reverse -94 -113 9.83255 0.294
NP_441892.1_1 Reverse -73 -90 -4.68105 0.266
NP_440665.1_1 Forward -337 -318 -11.8003 0.244
NP_440665.1_1 Reverse -316 -335 -16.4218 0.288
NP_442105.1_1 Reverse -368 -387 16.1257 0.0707
NP_442270.1_9 Reverse -71 -90 -7.27704 0.213
NP_440546.1_4 Forward -268 -258 6.55553 0.291
NP_442402.1_4 Forward -53 -34 -8.94939 0.285
NP_440653.1_10 Forward -32 -13 2.55606 0.288
NP_441811.1_1 Forward -220 -201 4.32602 0.285
NP_441811.1_8 Reverse -88 -102 7.86607 0.241
NP_440825.1_4 Forward -83 -64 5.50599 0.266
NP_440825.1_6 Reverse -159 -178 7.96426 0.285
NP_442837.1_3 Forward -368 -361 6.82395 0.184
NP_440160.1_9 Forward -318 -299 12.0942 0.216
NP_440520.1_1 Reverse -248 -267 -5.01543 0.289
NP_441252.1_6 Reverse -199 -206 14.3954 0.168
NP_442471.1_4 Forward -386 -367 15.9282 0.288
NP_440914.1_1 Reverse -202 -212 8.41992 0.191
NP_442533.1_6 Reverse -328 -337 1.67135 0.293
NP_440263.1_1 Reverse -87 -100 16.5324 0.239
NP_441028.1_6 Forward -294 -284 5.19112 0.265
NP_441170.1_4 Forward -266 -248 6.214 0.208
NP_441972.1_5 Forward -90 -71 -4.81876 0.211
NP_441972.1_5 Forward -209 -190 -9.93197 0.294
NP_439903.1_6 Reverse -52 -71 1.6703 0.241
NP_441286.1_1 Reverse -87 -99 -1.73098 0.145
NP_442674.1_3 Reverse -74 -93 3.14526 0.295
NP_441930.1_2 Reverse -201 -211 15.6147 0.19
NP_441930.1_2 Forward -211 -201 11.8781 0.271
NP_440886.1_7 Reverse -219 -229 5.78111 0.163
NP_440828.1_1 Forward -89 -70 7.66846 0.197
NP_442213.1_5 Forward -86 -67 -1.27885 0.293
NP_441808.1_8 Forward -216 -197 7.57094 0.277
NP_441021.1_1 Forward -325 -306 -12.3902 0.286
NP_441463.1_3 Forward -101 -82 5.211 0.0771
NP_441463.1_6 Reverse -247 -261 8.73514 0.25
NP_442362.1_7 Reverse -142 -160 10.1472 0.287
NP_441962.1_4 Reverse -261 -280 -11.3086 0.239
NP_440387.1_1 Reverse -266 -282 -5.93965 0.258
NP_440855.1_1 Reverse -316 -335 11.2092 0.12
NP_441993.1_1 Reverse -88 -107 1.75177 0.27
NP_441993.1_1 Forward -275 -256 0.582284 0.297
NP_442084.1_6 Reverse -137 -155 10.6389 0.221
NP_440311.1_2 Reverse -134 -153 13.1758 0.299
NP_440766.1_5 Reverse -206 -218 9.47014 0.275
NP_442743.1_5 Forward -96 -77 13.8641 0.121
NP_439910.1_2 Reverse -352 -369 -22.0856 0.207
NP_439910.1_2 Forward -395 -378 -22.479 0.25
NP_442867.1_8 Forward -157 -138 4.916 0.277
NP_440457.1_1 Reverse -324 -336 8.79043 0.101
NP_441801.1_4 Forward -271 -261 3.42162 0.231
NP_441984.1_3 Forward -279 -261 4.9357 0.299
NP_442509.1_9 Forward -275 -265 13.8442 0.0448
NP_441489.1_4 Reverse -288 -302 14.7492 0.162
NP_441173.1_9 Reverse -137 -145 13.1954 0.184
NP_441173.1_9 Reverse -136 -144 12.9004 0.206
NP_442395.2_4 Reverse -219 -238 -0.492971 0.295
NP_440191.1_5 Forward -154 -135 18.6823 0.118
NP_440507.2_3 Forward -100 -81 9.53674 0.218
NP_440091.1_1 Reverse -31 -43 -0.452677 0.273
NP_443046.1_9 Forward -122 -104 11.3264 0.168
NP_440175.1_7 Reverse -166 -184 8.58238 0.293
NP_441105.1_3 Forward -210 -191 -5.80207 0.224
NP_440216.1_9 Reverse -142 -151 7.07956 0.289
NP_442329.1_8 Forward -232 -213 5.211 0.261
NP_440416.1_9 Forward -92 -73 -10.4236 0.141
NP_440416.1_9 Reverse -248 -267 -20.65 0.287
NP_443052.1_9 Reverse -62 -81 -5.9004 0.274
NP_440072.1_5 Reverse -380 -398 -3.91409 0.286
NP_440591.1_9 Reverse -87 -105 6.01734 0.231
NP_442154.1_1 Reverse -329 -347 -14.2388 0.217
NP_442046.1_8 Forward -90 -71 10.9142 0.293
NP_440261.1_7 Forward -150 -131 -4.22878 0.217
NP_440988.1_10 Forward -260 -246 7.7064 0.215
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

GCCGGACTTAACCCACGAACGACTTCAACGTTTTGCTCGCTGTTTAGGTAAGACACCTAGTGAAACCACCGCCCTGCTAGTGGAAGAATCCTTGCGGCAGCAGGACTTTCCCTACATTGAATTTCGACAAACGCCCCTGGGTCGTCATGCCCATCTTAAAAACTCTACCCTGGCGGTCTGGGAAGTTGTCCGCATTGCCCAAGGGTATGCTTTAGACCCAGAAAAAACAGCACAACACTTCCAGCGTCCTCTGCCTTGGGTAAAATCGGCCTTACTTTATGCAGAGGCTTACCCCGAAGAGATCAACATCGCCATTACCGATGCTGGGGCCGTTAACGAAACCACATTGACCCGTCTGTTACCGCAGCTCGAAGTCCAAGGGCAGTCATAGCAGAACCCC

CDS

ATGTTAGGTTTTCTATTGGATGAACACATATCTCCGGTGGTGGCTCAGCAGGTTATTAGTAAGGCACCAGACATTGAAATATATCCCTTACTAACTTGGCAGGGAGGGCTGTATCTAGGATTTCCAGATGAGGTAATTTTGGAGGCTGCCACCACGGCACAATTGGTGTTGGTAACCTATGACCAAAAAACGATACCGCCCATTCTTTGGACTTGGGGAGAGCAGGGTCAGTCCCATAGCGGTATTATCTTCGTTGACTATCAGAGTATGCCGCCCCAAGATTTTGGGAGTCTAGTCCAGGCTTTGCTTAAATTATGGAAGGATGAACGGGAAAGGGGTTGGACCGATCGCCTGCTGTATCTCAAGTGTTCCTGA

Protein

No sequence available