Your browser is old and dusty. Try Google Chrome!

Details for sll8009

ORF sll8009
Accession NP_942403.1
Symbol
Category
Definition
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_441061.1_2 Reverse -269 -283 -1.8687 0.274
NP_440795.1_7 Forward -276 -269 14.6904 0.0123
NP_440795.1_7 Reverse -269 -276 14.6904 0.0123
NP_441418.1_6 Reverse -268 -287 -21.0434 0.136
NP_442291.1_5 Forward -278 -262 -1.12144 0.192
NP_441453.1_1 Forward -284 -266 4.04996 0.263
NP_441453.1_4 Reverse -268 -276 16.539 0.00633
NP_441453.1_4 Forward -277 -269 16.539 0.00633
NP_441453.1_7 Forward -59 -52 12.9205 0.23
NP_442151.1_6 Forward -277 -263 9.73436 0.141
NP_441818.1_1 Forward -276 -265 10.1862 0.232
NP_441818.1_9 Reverse -7 -26 -2.85214 0.209
NP_440226.1_1 Forward -277 -258 14.6508 0.0293
NP_440226.1_1 Reverse -268 -287 11.0125 0.0571
NP_442169.1_1 Forward -249 -230 4.32602 0.26
NP_440150.1_6 Forward -367 -348 1.86774 0.283
NP_442744.1_8 Reverse -261 -280 -6.88371 0.297
NP_442173.1_1 Forward -276 -268 15.4574 0.00633
NP_442173.1_1 Reverse -269 -277 15.4574 0.00633
NP_001035873.1_9 Forward -393 -374 12.1925 0.273
NP_442752.1_4 Forward -277 -270 13.8055 0.0199
NP_442752.1_4 Reverse -268 -275 13.8055 0.0199
NP_442752.1_4 Forward -237 -230 6.52896 0.154
NP_443027.1_4 Forward -279 -269 13.943 0.0452
NP_442975.1_10 Forward -281 -267 11.897 0.0482
NP_440784.1_7 Forward -276 -269 15.9687 0.0123
NP_440784.1_7 Reverse -269 -276 15.9687 0.0123
NP_440061.1_9 Reverse -266 -280 10.1271 0.128
NP_440631.1_9 Forward -120 -101 11.9744 0.286
NP_440878.1_9 Reverse -258 -277 5.01433 0.174
NP_442062.1_8 Reverse -268 -278 19.4496 0.000558
NP_442062.1_8 Forward -277 -267 17.3846 0.00193
NP_440304.1_4 Forward -279 -269 9.91146 0.051
NP_440304.1_4 Reverse -266 -276 1.84832 0.299
NP_442242.1_4 Forward -276 -269 14.3954 0.0124
NP_442242.1_4 Reverse -269 -276 14.3954 0.0124
NP_440044.1_8 Reverse -269 -288 -0.39387 0.22
NP_440044.1_8 Forward -276 -257 -2.45882 0.264
NP_441781.1_7 Forward -277 -258 6.4893 0.186
NP_441208.1_9 Reverse -265 -279 13.5693 0.103
NP_441208.1_9 Forward -378 -364 5.80112 0.262
NP_441083.1_5 Forward -277 -267 20.3345 0.00053
NP_441083.1_5 Reverse -268 -278 11.3864 0.0159
NP_441738.1_2 Forward -275 -268 15.28 0.0102
NP_441738.1_2 Reverse -270 -277 15.28 0.0102
NP_441558.1_5 Forward -120 -101 4.12936 0.29
NP_441645.1_8 Reverse -127 -146 13.9625 0.243
NP_440209.1_1 Reverse -268 -276 18.1123 0.00295
NP_440209.1_1 Forward -277 -269 18.1123 0.00295
NP_442889.1_1 Reverse -7 -26 -14.8485 0.283
NP_442889.1_8 Forward -280 -266 21.1401 0.00339
NP_442889.1_8 Forward -273 -259 3.14559 0.287
NP_441713.1_1 Forward -283 -264 -6.09707 0.117
NP_441713.1_1 Reverse -262 -281 -14.5535 0.259
NP_440053.1_2 Forward -160 -141 12.9791 0.283
NP_441716.1_1 Forward -277 -263 6.6861 0.191
NP_441716.1_1 Reverse -378 -392 2.94952 0.284
NP_442111.1_4 Reverse -267 -281 18.7808 0.00603
NP_440906.1_5 Forward -276 -269 15.8704 0.0124
NP_440906.1_5 Reverse -269 -276 15.8704 0.0124
NP_440747.1_10 Reverse -265 -277 14.9853 0.00221
NP_440747.1_10 Forward -280 -268 -2.1243 0.0225
NP_440747.1_10 Forward -367 -355 -12.4491 0.282
NP_441130.1_10 Forward -279 -265 10.4227 0.113
NP_441130.1_10 Forward -380 -366 10.0294 0.117
NP_441486.1_1 Reverse -265 -279 13.2743 0.00871
NP_441486.1_1 Forward -280 -266 5.50613 0.0365
NP_441880.2_10 Reverse -269 -287 17.3254 0.111
NP_440842.1_10 Forward -280 -266 0.88457 0.296
NP_442848.1_1 Reverse -262 -276 -3.73699 0.27
NP_442848.1_1 Forward -283 -269 -4.03198 0.279
NP_442848.1_5 Forward -186 -168 3.75572 0.276
NP_443018.1_3 Forward -276 -269 14.8871 0.0123
NP_443018.1_3 Reverse -269 -276 14.8871 0.0123
NP_441634.1_8 Reverse -266 -280 6.6861 0.114
NP_440376.1_1 Forward -277 -268 19.4693 0.000692
NP_440376.1_1 Reverse -268 -277 19.4693 0.000692
NP_441588.1_4 Forward -275 -265 18.1713 0.0143
NP_442687.1_7 Forward -278 -268 15.8113 0.0125
NP_442687.1_7 Reverse -267 -277 8.92815 0.0994
NP_442485.1_3 Reverse -266 -285 -4.22878 0.278
NP_440642.1_10 Reverse -311 -325 2.75226 0.277
NP_440741.1_1 Reverse -185 -204 15.2399 0.0631
NP_440667.1_2 Reverse -250 -269 -2.65548 0.232
NP_442296.1_9 Forward -276 -257 11.9958 0.0897
NP_440360.1_8 Reverse -269 -288 16.5191 0.258
NP_442658.1_1 Forward -279 -269 18.7607 0.00222
NP_442658.1_1 Reverse -266 -276 6.76441 0.214
NP_442198.1_3 Forward -232 -213 4.52268 0.275
NP_442205.1_2 Forward -279 -260 13.5795 0.247
NP_441414.1_9 Reverse -268 -287 13.2741 0.0145
NP_441958.1_5 Forward -278 -268 12.2714 0.00183
NP_441958.1_5 Reverse -267 -277 12.2714 0.00183
NP_442836.1_10 Reverse -122 -132 11.0914 0.269
NP_439990.1_5 Reverse -263 -276 9.95071 0.128
NP_442911.1_2 Forward -287 -268 7.47261 0.0245
NP_442911.1_2 Reverse -258 -277 -9.73531 0.262
NP_441580.1_6 Forward -288 -269 -7.27704 0.239
NP_440153.1_5 Reverse -269 -283 0.786239 0.289
NP_443055.1_6 Forward -285 -267 3.55831 0.195
NP_440993.1_2 Forward -282 -266 1.04184 0.295
NP_441129.1_3 Reverse -351 -370 -17.7001 0.285
NP_441099.1_5 Forward -287 -268 -9.73531 0.231
NP_442002.1_9 Forward -278 -271 10.7572 0.185
NP_441294.1_7 Forward -274 -260 15.0099 0.0328
NP_441294.1_7 Reverse -264 -278 11.3624 0.147
NP_441294.1_7 Forward -281 -267 11.2664 0.15
NP_441646.1_1 Forward -284 -265 0.392778 0.251
NP_442438.1_10 Forward -282 -268 6.19444 0.119
NP_442438.1_10 Reverse -263 -277 1.17956 0.204
NP_441000.1_6 Forward -278 -264 3.93283 0.101
NP_441000.1_6 Reverse -267 -281 -3.54032 0.224
NP_440147.1_4 Reverse -266 -279 19.4888 0.00276
NP_440147.1_4 Forward -279 -266 3.46087 0.187
NP_441550.1_8 Reverse -266 -276 14.6309 0.0132
NP_441550.1_8 Forward -279 -269 10.501 0.066
NP_441916.1_7 Reverse -268 -278 18.4663 0.00144
NP_441916.1_7 Forward -277 -267 10.3048 0.0261
NP_441041.1_4 Reverse -268 -287 -9.73531 0.222
NP_441041.1_7 Reverse -265 -277 11.8878 0.0689
NP_441041.1_7 Forward -280 -268 10.1386 0.102
NP_442396.1_5 Reverse -264 -277 10.7374 0.106
NP_442396.1_5 Forward -281 -268 8.67241 0.151
NP_440569.1_10 Forward -51 -32 18.5728 0.0915
NP_441725.1_5 Reverse -269 -279 9.02648 0.0553
NP_441725.1_5 Forward -276 -266 2.04498 0.115
NP_439966.1_7 Forward -279 -269 17.4824 0.00636
NP_439966.1_7 Reverse -266 -276 7.25606 0.15
NP_439966.1_9 Forward -279 -270 10.7178 0.0863
NP_442941.1_3 Forward -276 -266 11.0914 0.0116
NP_442941.1_3 Reverse -269 -279 2.53664 0.14
NP_440289.1_1 Reverse -227 -244 16.7066 0.266
NP_440289.1_2 Forward -280 -267 10.1474 0.0278
NP_440289.1_2 Reverse -265 -278 -2.144 0.251
NP_440260.1_8 Reverse -252 -270 2.28076 0.182
NP_440802.1_3 Reverse -256 -275 9.14423 0.276
NP_442281.1_1 Forward -282 -268 1.76896 0.29
NP_440375.1_8 Reverse -269 -288 15.0441 0.0983
NP_441644.1_6 Forward -277 -267 17.3841 0.00127
NP_441644.1_6 Reverse -268 -278 10.1076 0.0628
NP_442215.1_2 Forward -279 -263 11.0716 0.0433
NP_442247.1_8 Reverse -266 -280 11.2093 0.247
NP_440253.1_2 Reverse -268 -286 6.11567 0.0856
NP_440929.1_8 Forward -277 -268 19.2726 0.000701
NP_440929.1_8 Reverse -268 -277 19.2726 0.000701
NP_441346.1_7 Reverse -178 -197 11.0125 0.238
NP_442933.1_5 Forward -213 -194 11.0125 0.288
NP_442933.1_10 Forward -277 -268 17.601 0.00325
NP_442933.1_10 Reverse -268 -277 17.601 0.00325
NP_441751.2_8 Forward -276 -262 4.81781 0.0464
NP_441751.2_8 Reverse -269 -283 -1.5737 0.129
NP_442554.1_8 Reverse -269 -279 16.008 0.0065
NP_442554.1_8 Forward -276 -266 15.3197 0.00882
NP_442554.1_8 Reverse -356 -366 3.22496 0.235
NP_441762.1_7 Reverse -267 -279 12.4287 0.0142
NP_441762.1_7 Forward -278 -266 9.57708 0.0142
NP_442142.1_4 Reverse -265 -278 13.49 0.0348
NP_442142.1_4 Forward -280 -267 5.91857 0.178
NP_442142.1_4 Forward -307 -294 2.28034 0.295
NP_442292.1_1 Forward -276 -267 18.486 0.00229
NP_442292.1_1 Reverse -269 -278 9.63616 0.0183
NP_442476.1_6 Reverse -269 -283 19.3708 0.0268
NP_443009.1_5 Reverse -267 -278 18.3477 0.00265
NP_441741.1_6 Forward -45 -26 11.4058 0.249
NP_441715.1_4 Reverse -269 -279 9.32148 0.097
NP_441715.1_4 Forward -276 -266 7.94484 0.107
NP_440015.1_9 Forward -277 -259 8.18062 0.111
NP_440464.1_10 Forward -276 -266 13.0082 0.169
NP_440464.1_10 Reverse -61 -71 12.7217 0.189
NP_441468.1_1 Forward -276 -269 15.8704 0.0124
NP_441468.1_1 Reverse -269 -276 15.8704 0.0124
NP_441020.2_6 Reverse -266 -283 6.33202 0.267
NP_441015.1_10 Reverse -13 -32 -11.7019 0.3
NP_441673.1_1 Forward -277 -268 20.8459 0.000698
NP_441673.1_1 Reverse -268 -277 20.8459 0.000698
NP_441826.1_2 Forward -283 -269 0.786239 0.172
NP_441826.1_2 Reverse -262 -276 -4.13031 0.292
NP_441393.1_2 Reverse -15 -34 14.4242 0.272
NP_441637.1_9 Reverse -101 -119 -0.7675 0.292
NP_442868.1_6 Reverse -266 -276 9.81313 0.038
NP_442868.1_6 Forward -279 -269 8.53483 0.0555
NP_442719.1_2 Reverse -35 -53 -3.71814 0.201
NP_442719.1_2 Forward -232 -214 -9.91296 0.268
NP_442719.1_2 Forward -231 -213 -10.8963 0.284
NP_441612.1_2 Forward -277 -267 8.54929 0.21
NP_442808.1_1 Forward -278 -268 18.4657 0.00201
NP_442808.1_1 Reverse -267 -277 8.63269 0.0481
NP_442808.1_1 Reverse -234 -244 7.15773 0.086
NP_442808.1_1 Reverse -108 -118 4.99446 0.178
NP_441101.1_10 Forward -368 -349 -5.11376 0.281
NP_440145.1_3 Forward -287 -268 9.0459 0.0446
NP_440145.1_3 Reverse -258 -277 -4.6221 0.242
NP_442718.1_8 Reverse -28 -47 17.9095 0.265
NP_442542.1_2 Forward -279 -266 11.9173 0.114
NP_442050.1_1 Reverse -204 -223 7.37428 0.274
NP_442050.1_5 Forward -279 -269 8.23937 0.234
NP_442050.1_5 Reverse -266 -276 7.64939 0.243
NP_442342.1_9 Forward -279 -263 2.02515 0.294
NP_440558.1_2 Forward -31 -12 -7.4737 0.294
NP_440111.2_4 Reverse -344 -363 8.16093 0.271
NP_440274.1_2 Forward -16 -2 17.4035 0.199
NP_441878.1_6 Forward -278 -268 10.4031 0.0176
NP_441878.1_6 Reverse -267 -277 10.4031 0.0176
NP_441036.1_8 Forward -278 -268 17.7779 0.000554
NP_441036.1_8 Reverse -248 -258 11.5831 0.114
NP_441036.1_8 Reverse -267 -277 8.33817 0.174
NP_441036.1_8 Reverse -108 -118 5.5849 0.271
NP_441557.1_5 Forward -277 -268 19.9609 0.000699
NP_441557.1_5 Reverse -268 -277 19.9609 0.000699
NP_441557.1_8 Reverse -381 -391 10.9926 0.269
NP_441445.1_1 Reverse -259 -278 6.19431 0.153
NP_441445.1_1 Forward -286 -267 0.58944 0.272
NP_441445.1_1 Reverse -252 -271 0.0977854 0.283
NP_442066.2_4 Reverse -268 -287 -8.94866 0.296
NP_442066.2_9 Forward -281 -268 10.639 0.154
NP_442066.2_9 Forward -122 -109 9.85238 0.159
NP_441433.1_8 Forward -213 -194 7.66927 0.172
NP_441308.1_8 Forward -279 -269 9.22315 0.226
NP_442830.1_5 Forward -215 -201 5.80051 0.228
NP_441564.1_10 Forward -273 -254 2.65439 0.287
NP_440762.1_10 Forward -171 -153 16.6371 0.0969
NP_442183.1_1 Reverse -268 -282 13.5693 0.0423
NP_442183.1_1 Forward -286 -272 6.78443 0.161
NP_442444.1_6 Forward -285 -267 15.1453 0.21
NP_441549.1_9 Forward -70 -52 -5.19239 0.198
NP_442347.1_2 Forward -276 -267 12.4878 0.056
NP_442347.1_2 Reverse -269 -278 11.1111 0.056
NP_442645.1_2 Forward -285 -266 -10.9153 0.144
NP_442645.1_2 Reverse -260 -279 -12.2919 0.144
NP_442645.1_2 Reverse -253 -272 -17.6018 0.259
NP_441037.1_4 Forward -279 -269 16.2838 0.0168
NP_441037.1_4 Reverse -128 -138 9.85159 0.21
NP_441037.1_4 Reverse -266 -276 7.9999 0.237
NP_441633.1_3 Reverse -266 -279 18.3088 0.00715
NP_441633.1_3 Forward -279 -266 -3.71729 0.177
NP_441633.1_3 Reverse -376 -389 -7.06055 0.288
NP_440136.1_2 Forward -276 -269 15.9687 0.0123
NP_440136.1_2 Reverse -269 -276 15.9687 0.0123
NP_442590.1_9 Forward -253 -234 8.35759 0.238
NP_442998.1_10 Forward -275 -268 15.5754 0.0102
NP_442998.1_10 Reverse -270 -277 15.5754 0.0102
NP_440299.1_1 Forward -281 -268 16.3416 0.0105
NP_440299.1_1 Reverse -264 -277 10.3434 0.0573
NP_441799.1_1 Reverse -264 -278 17.4035 0.011
NP_441799.1_1 Forward -281 -267 10.3237 0.0756
NP_441007.1_10 Forward -282 -269 1.69091 0.203
NP_440256.1_1 Reverse -265 -284 4.52268 0.0435
NP_440087.1_1 Forward -286 -267 -8.35868 0.278
NP_440915.1_6 Forward -281 -267 12.1926 0.0218
NP_440915.1_6 Reverse -264 -278 1.67122 0.132
NP_441464.1_8 Reverse -268 -282 5.01447 0.26
NP_441464.1_8 Forward -277 -263 3.93283 0.283
NP_440306.1_3 Reverse -86 -105 5.80098 0.295
NP_442993.1_1 Forward -277 -261 -7.31629 0.146
NP_442386.1_5 Reverse -40 -59 4.03023 0.284
NP_442386.1_9 Forward -278 -269 15.7322 0.0144
NP_442386.1_9 Reverse -267 -276 13.8639 0.0289
NP_442386.1_9 Reverse -235 -244 5.40752 0.253
NP_441340.1_5 Forward -276 -269 15.6737 0.0124
NP_441340.1_5 Reverse -269 -276 15.6737 0.0124
NP_441340.1_9 Forward -318 -308 7.00193 0.297
NP_440194.1_3 Forward -287 -268 3.44104 0.271
NP_440586.1_8 Forward -276 -269 13.2151 0.026
NP_440586.1_8 Reverse -269 -276 13.2151 0.026
NP_442251.1_6 Forward -276 -269 15.2804 0.0124
NP_442251.1_6 Reverse -269 -276 15.2804 0.0124
NP_441262.1_3 Reverse -268 -275 14.7888 0.0223
NP_441262.1_3 Forward -277 -270 14.7888 0.0223
NP_443051.1_1 Reverse -267 -276 10.4228 0.00754
NP_443051.1_1 Forward -278 -269 10.4228 0.00754
NP_439937.1_9 Reverse -267 -284 -6.84499 0.157
NP_439937.1_9 Forward -278 -261 -7.04165 0.157
NP_439937.1_9 Reverse -54 -71 -12.5482 0.273
NP_440439.1_1 Forward -280 -267 2.37923 0.135
NP_440372.1_2 Forward -276 -269 16.3621 0.0124
NP_440372.1_2 Reverse -269 -276 16.3621 0.0124
NP_440271.1_2 Reverse -196 -215 2.3594 0.284
NP_439977.1_5 Forward -283 -264 -3.3438 0.299
NP_439977.1_8 Reverse -98 -117 14.5603 0.284
NP_440139.1_1 Forward -283 -264 8.94676 0.106
NP_441572.1_7 Forward -283 -264 -3.04881 0.206
NP_442887.1_5 Forward -68 -49 -11.5053 0.264
NP_442384.1_10 Forward -277 -264 9.06573 0.0574
NP_442384.1_10 Reverse -268 -281 8.9674 0.059
NP_442114.1_4 Reverse -268 -279 12.1534 0.107
NP_442790.1_4 Forward -286 -267 -14.4552 0.277
NP_442262.1_10 Forward -276 -269 14.1988 0.0123
NP_442262.1_10 Reverse -269 -276 14.1988 0.0123
NP_441689.1_5 Reverse -266 -276 5.78111 0.197
NP_440344.1_10 Forward -284 -267 0.432165 0.0358
NP_440344.1_10 Reverse -261 -278 -0.551145 0.0435
NP_442910.1_1 Reverse -261 -280 -8.16202 0.285
NP_441965.1_10 Forward -280 -264 6.74504 0.165
NP_440297.1_9 Forward -276 -266 -0.118297 0.282
NP_440297.1_9 Reverse -269 -279 -0.216628 0.282
NP_442280.1_10 Forward -217 -199 11.6881 0.205
NP_440999.1_9 Forward -281 -267 5.30946 0.113
NP_440999.1_9 Reverse -351 -365 -1.8687 0.252
NP_440888.1_2 Reverse -268 -282 17.8952 0.00302
NP_440888.1_2 Forward -277 -263 10.5204 0.0919
NP_442033.1_10 Forward -279 -260 -5.80207 0.18
NP_442033.1_10 Forward -367 -348 -12.5869 0.273
NP_441543.1_2 Reverse -269 -278 18.486 0.00236
NP_441543.1_2 Forward -276 -267 16.9127 0.00359
NP_442845.1_2 Reverse -262 -276 11.5043 0.128
NP_442845.1_2 Forward -283 -269 3.93283 0.272
NP_442845.1_4 Forward -279 -260 7.27595 0.202
NP_441918.1_7 Reverse -267 -286 -3.44213 0.297
NP_441469.1_8 Forward -278 -269 16.126 0.00797
NP_441469.1_8 Reverse -267 -276 6.48957 0.227
NP_443064.1_6 Forward -277 -267 12.5669 0.0796
NP_442337.1_8 Forward -149 -130 0.0977854 0.258
NP_442578.1_7 Forward -276 -269 14.5921 0.026
NP_442578.1_7 Reverse -269 -276 14.5921 0.026
NP_440710.1_1 Forward -19 -1 -8.43732 0.264
NP_441462.1_2 Forward -277 -267 11.5831 0.00406
NP_441462.1_2 Reverse -268 -278 11.5831 0.00406
NP_441621.1_7 Forward -279 -265 -3.24533 0.188
NP_441621.1_7 Reverse -266 -280 -3.34366 0.188
NP_443062.1_1 Reverse -268 -286 15.1764 0.041
NP_443062.1_6 Reverse -260 -279 10.9142 0.11
NP_443062.1_6 Reverse -370 -389 5.60432 0.201
NP_442204.1_5 Reverse -48 -67 0.196116 0.27
NP_442487.1_6 Reverse -255 -274 11.6017 0.227
NP_440516.1_8 Forward -277 -268 16.9127 0.00442
NP_440516.1_8 Reverse -268 -277 16.9127 0.00442
NP_442428.1_5 Forward -276 -269 15.8704 0.0124
NP_442428.1_5 Reverse -269 -276 15.8704 0.0124
NP_441443.1_10 Reverse -264 -282 2.96833 0.275
NP_440618.1_1 Reverse -361 -380 -11.7019 0.297
NP_442120.1_10 Reverse -250 -269 -15.1435 0.289
NP_440673.1_2 Forward -287 -268 14.3892 0.0986
NP_440673.1_3 Forward -275 -268 12.4288 0.0426
NP_440673.1_3 Reverse -270 -277 12.4288 0.0426
NP_441052.1_2 Forward -277 -267 19.9412 0.00106
NP_441052.1_2 Reverse -268 -278 10.5014 0.0285
NP_442219.1_8 Reverse -251 -270 9.51997 0.23
NP_442219.1_9 Forward -276 -267 17.7976 0.00718
NP_442219.1_9 Reverse -269 -278 8.35786 0.0681
NP_440436.1_4 Reverse -269 -278 18.1905 0.00233
NP_440436.1_4 Forward -276 -267 17.2072 0.00233
NP_442086.1_3 Reverse -269 -288 8.65258 0.231
NP_440314.1_9 Reverse -269 -288 10.8159 0.0289
NP_440314.1_9 Forward -276 -257 -7.37537 0.24
NP_441719.1_4 Forward -276 -269 16.3621 0.0124
NP_441719.1_4 Reverse -269 -276 16.3621 0.0124
NP_441733.1_10 Reverse -265 -278 9.85238 0.106
NP_441733.1_10 Forward -280 -267 7.88576 0.148
NP_442366.1_3 Forward -278 -260 5.03403 0.0899
NP_442366.1_3 Forward -352 -334 -3.42244 0.247
NP_442366.1_5 Reverse -265 -275 14.8275 0.0375
NP_441115.1_4 Forward -278 -260 10.7364 0.168
NP_442206.1_10 Forward -364 -349 1.15987 0.236
NP_443054.1_2 Reverse -266 -280 3.04785 0.24
NP_443054.1_2 Forward -279 -265 2.16287 0.245
NP_441966.1_2 Reverse -88 -107 20.8413 0.0442
NP_442308.1_4 Reverse -255 -274 2.94938 0.267
NP_441851.1_10 Forward -278 -268 16.008 0.00552
NP_441851.1_10 Reverse -267 -277 15.8113 0.00552
NP_442011.1_1 Reverse -267 -286 -1.86883 0.271
NP_442515.1_1 Reverse -267 -281 6.88276 0.097
NP_441349.1_10 Reverse -258 -277 6.58763 0.035
NP_440432.1_9 Reverse -269 -284 6.07642 0.0481
NP_440474.1_8 Reverse -269 -283 15.8302 0.0547
NP_440431.1_4 Forward -318 -299 -8.26048 0.275
NP_442450.1_5 Reverse -266 -276 7.55152 0.13
NP_440588.1_2 Reverse -259 -278 6.68596 0.0535
NP_440078.1_10 Forward -118 -99 3.24438 0.269
NP_441078.1_4 Forward -277 -268 19.6659 0.0007
NP_441078.1_4 Reverse -268 -277 19.6659 0.0007
NP_442729.1_8 Forward -281 -268 10.1474 0.125
NP_440526.1_3 Forward -276 -265 10.2846 0.0646
NP_440526.1_3 Reverse -269 -280 2.51647 0.267
NP_441432.1_8 Reverse -267 -276 16.8143 0.00595
NP_441432.1_8 Forward -278 -269 8.25953 0.0755
NP_442320.1_8 Forward -283 -269 15.2409 0.011
NP_442320.1_8 Reverse -262 -276 -2.26202 0.0871
NP_441732.1_2 Reverse -264 -280 -16.1661 0.165
NP_442003.1_4 Forward -276 -257 10.2259 0.288
NP_440760.1_1 Reverse -268 -287 -20.2567 0.222
NP_440199.1_10 Reverse -265 -275 7.25653 0.231
NP_442146.1_8 Reverse -43 -62 17.2074 0.269
NP_442298.1_2 Reverse -59 -78 18.3865 0.179
NP_441072.1_2 Reverse -257 -276 5.30933 0.3
NP_442489.1_7 Forward -277 -268 20.1576 0.000695
NP_442489.1_7 Reverse -268 -277 20.1576 0.000695
NP_442079.1_7 Reverse -269 -288 7.37428 0.139
NP_440559.1_1 Forward -276 -267 17.4043 0.00658
NP_440559.1_1 Reverse -269 -278 8.75118 0.0586
NP_441659.2_8 Forward -277 -267 18.1713 0.00133
NP_441659.2_8 Reverse -268 -278 11.9764 0.0147
NP_442913.1_10 Reverse -49 -68 -1.86883 0.178
NP_442776.1_6 Forward -279 -260 6.58763 0.298
NP_442346.1_5 Reverse -267 -277 16.6963 0.00248
NP_442346.1_5 Forward -278 -268 9.02648 0.118
NP_440545.1_3 Reverse -264 -281 3.77542 0.079
NP_440545.1_5 Reverse -264 -281 9.28195 0.21
NP_441629.1_3 Forward -269 -250 -2.45958 0.269
NP_442828.1_7 Reverse -201 -220 0.884433 0.276
NP_441888.1_7 Forward -282 -268 2.94952 0.225
NP_441948.1_4 Reverse -261 -279 1.98577 0.129
NP_441833.1_4 Forward -276 -269 15.9687 0.0124
NP_441833.1_4 Reverse -269 -276 15.9687 0.0124
NP_441895.1_2 Reverse -198 -217 -26.6482 0.246
NP_442162.1_9 Forward -276 -269 16.2637 0.0124
NP_442162.1_9 Reverse -269 -276 16.2637 0.0124
NP_441973.1_1 Reverse -289 -304 0.963207 0.235
NP_442140.1_3 Reverse -269 -279 17.4829 0.0159
NP_442140.1_3 Forward -276 -266 12.2714 0.0632
NP_440875.1_9 Reverse -270 -280 9.44274 0.233
NP_441813.1_5 Forward -279 -269 10.0098 0.0208
NP_441813.1_5 Reverse -266 -276 8.63316 0.0367
NP_440590.1_4 Forward -276 -263 11.3273 0.0209
NP_440590.1_4 Reverse -269 -282 3.26421 0.0749
NP_440567.1_1 Reverse -269 -283 19.1741 0.0136
NP_440567.1_1 Forward -276 -262 9.43936 0.0442
NP_442497.1_10 Forward -276 -267 10.4228 0.0087
NP_442497.1_10 Reverse -269 -278 10.4228 0.0087
NP_440821.1_4 Forward -279 -269 18.7612 0.00422
NP_440821.1_4 Reverse -266 -276 9.41981 0.0286
NP_441239.1_9 Forward -279 -267 16.0669 0.0175
NP_441239.1_9 Reverse -266 -278 5.93884 0.202
NP_441212.1_6 Forward -246 -227 5.50599 0.204
NP_442669.1_1 Forward -55 -36 8.55425 0.0463
NP_440546.1_4 Reverse -268 -278 11.8882 0.0679
NP_440546.1_4 Forward -277 -267 10.046 0.109
NP_441230.1_5 Forward -261 -242 0.0977854 0.275
NP_440462.1_6 Forward -279 -269 17.9746 0.00578
NP_440462.1_6 Reverse -266 -276 1.35667 0.294
NP_442340.1_3 Reverse -225 -244 -6.98204 0.227
NP_440868.1_4 Forward -281 -269 9.97041 0.0405
NP_440868.1_4 Reverse -264 -276 6.23383 0.0878
NP_442499.1_3 Reverse -267 -285 3.55906 0.289
NP_441582.1_5 Forward -279 -260 9.63507 0.164
NP_441582.1_5 Reverse -266 -285 4.71854 0.221
NP_442402.1_4 Forward -147 -128 -7.17944 0.272
NP_440696.1_6 Reverse -256 -275 6.19431 0.266
NP_442039.1_4 Forward -276 -269 15.1821 0.0124
NP_442039.1_4 Reverse -269 -276 15.1821 0.0124
NP_440825.1_7 Forward -276 -266 12.9096 0.152
NP_442837.1_3 Forward -276 -269 15.7721 0.0124
NP_442837.1_3 Reverse -269 -276 15.7721 0.0124
NP_439994.1_3 Forward -278 -259 15.8525 0.084
NP_442053.1_1 Forward -277 -268 18.3876 0.0007
NP_442053.1_1 Reverse -268 -277 18.3876 0.0007
NP_440505.1_3 Forward -279 -269 14.1397 0.0235
NP_440505.1_3 Reverse -266 -276 9.22315 0.122
NP_441102.1_1 Reverse -68 -87 5.40766 0.256
NP_441203.1_1 Forward -276 -257 -19.3717 0.297
NP_442532.1_7 Reverse -268 -282 6.58777 0.171
NP_440914.1_1 Forward -277 -267 17.5935 0.000537
NP_440914.1_1 Reverse -268 -278 8.6151 0.186
NP_440914.1_1 Reverse -109 -119 8.12715 0.207
NP_441011.1_8 Reverse -269 -278 16.9127 0.00602
NP_441011.1_8 Forward -276 -267 8.25953 0.144
NP_441011.1_8 Forward -354 -345 5.80125 0.227
NP_441011.1_8 Reverse -288 -297 5.3096 0.271
NP_442533.1_6 Forward -277 -268 17.2076 0.00137
NP_442533.1_6 Reverse -268 -277 17.2076 0.00137
NP_442533.1_6 Forward -364 -355 1.37636 0.3
NP_442229.1_1 Forward -279 -265 11.7987 0.18
NP_439944.1_9 Forward -276 -266 10.5014 0.0887
NP_439944.1_9 Reverse -269 -279 10.4031 0.0887
NP_439944.1_10 Forward -127 -108 14.5524 0.223
NP_441697.1_5 Forward -89 -70 -11.4117 0.295
NP_440116.1_5 Reverse -265 -282 6.92201 0.166
NP_440116.1_8 Forward -276 -257 -0.885524 0.114
NP_439965.1_1 Reverse -259 -278 -5.9004 0.211
NP_442562.1_4 Reverse -250 -269 10.4225 0.127
NP_441106.1_1 Forward -278 -269 18.191 0.0028
NP_441106.1_1 Reverse -267 -276 9.63616 0.0311
NP_442306.1_3 Reverse -209 -228 11.7992 0.287
NP_442306.1_10 Reverse -263 -282 -11.3086 0.126
NP_441286.1_1 Reverse -267 -279 14.7886 0.00418
NP_441286.1_1 Forward -278 -266 3.38223 0.0467
NP_440670.1_8 Forward -277 -268 18.3876 0.000699
NP_440670.1_8 Reverse -268 -277 18.3876 0.000699
NP_440670.1_8 Reverse -109 -118 3.53964 0.257
NP_440886.1_7 Forward -278 -268 17.7774 0.0011
NP_440886.1_7 Reverse -267 -277 7.94438 0.0805
NP_440886.1_7 Forward -271 -261 3.71617 0.267
NP_442614.1_2 Forward -277 -263 12.291 0.165
NP_439995.1_5 Forward -287 -268 9.14423 0.235
NP_440767.1_8 Reverse -239 -258 15.5357 0.212
NP_442072.1_9 Reverse -267 -285 -12.4689 0.0852
NP_441753.1_10 Forward -286 -267 2.65439 0.228
NP_440907.2_8 Reverse -269 -279 17.4824 0.00685
NP_440907.2_8 Forward -276 -266 7.64939 0.117
NP_441021.1_1 Forward -276 -257 -4.52377 0.172
NP_441463.1_3 Forward -287 -268 7.37428 0.0533
NP_441463.1_6 Reverse -266 -280 5.73949 0.287
NP_441626.1_2 Forward -276 -269 15.7721 0.0124
NP_441626.1_2 Reverse -269 -276 15.7721 0.0124
NP_441460.1_2 Forward -210 -197 15.555 0.171
NP_442794.1_1 Reverse -264 -276 2.69391 0.286
NP_442615.1_1 Reverse -259 -277 12.8022 0.0126
NP_442615.1_1 Forward -286 -268 -0.964162 0.123
NP_441962.1_4 Reverse -263 -282 0.884433 0.111
NP_440387.1_1 Reverse -268 -284 17.4631 0.0044
NP_440387.1_1 Forward -277 -261 -1.71142 0.143
NP_441431.1_2 Forward -280 -266 11.602 0.136
NP_442020.1_1 Reverse -216 -235 -1.37794 0.291
NP_440114.1_8 Forward -183 -164 11.0125 0.287
NP_440114.1_10 Reverse -268 -282 10.0294 0.155
NP_440114.1_10 Forward -277 -263 6.6861 0.26
NP_441156.1_1 Reverse -201 -220 10.4225 0.261
NP_440287.1_5 Forward -220 -201 10.52 0.286
NP_440287.1_6 Reverse -100 -119 3.93269 0.208
NP_440293.1_3 Reverse -168 -187 -3.04881 0.243
NP_441237.1_9 Forward -276 -266 14.828 0.0242
NP_439910.1_2 Forward -285 -268 -21.6923 0.184
NP_439910.1_2 Reverse -260 -277 -22.184 0.215
NP_440457.1_1 Forward -281 -269 7.90546 0.101
NP_440457.1_1 Reverse -264 -276 0.825626 0.25
NP_440798.1_6 Reverse -269 -282 2.87088 0.159
NP_441436.1_8 Forward -55 -36 9.53756 0.263
NP_440473.1_1 Forward -367 -348 13.6676 0.187
NP_442509.1_9 Reverse -268 -278 16.2041 0.00739
NP_442509.1_9 Forward -277 -267 8.14104 0.192
NP_440554.1_4 Reverse -269 -279 13.943 0.0218
NP_441885.1_5 Forward -277 -267 20.9245 0.000538
NP_441885.1_5 Reverse -268 -278 11.4848 0.00668
NP_442341.1_7 Reverse -267 -281 11.6026 0.0534
NP_442341.1_7 Forward -278 -264 8.35772 0.0881
NP_442341.1_9 Forward -279 -265 8.65209 0.166
NP_441756.1_5 Forward -217 -198 0.392778 0.234
NP_441756.1_5 Reverse -231 -250 -3.3438 0.29
NP_441173.1_9 Forward -135 -127 9.75379 0.284
NP_443000.1_7 Reverse -266 -276 10.3048 0.0345
NP_443000.1_7 Forward -279 -269 2.04498 0.226
NP_440275.1_3 Forward -279 -269 17.9746 0.0082
NP_440275.1_3 Reverse -266 -276 8.04317 0.0602
NP_440091.1_1 Forward -281 -269 12.7237 0.0353
NP_440091.1_1 Reverse -264 -276 10.7571 0.0429
NP_443060.1_5 Reverse -260 -279 7.57013 0.226
NP_442354.1_8 Forward -63 -44 5.89931 0.275
NP_443010.1_10 Forward -280 -263 10.4049 0.124
NP_443010.1_10 Forward -358 -341 10.3082 0.125
NP_440216.1_1 Reverse -268 -282 6.58777 0.0145
NP_440216.1_1 Forward -277 -263 -0.393733 0.0284
NP_440172.1_1 Forward -277 -267 15.0247 0.00945
NP_440172.1_1 Reverse -268 -278 8.73149 0.0586
NP_442015.1_10 Reverse -264 -277 1.59258 0.204
NP_441226.1_7 Forward -276 -269 14.4934 0.0123
NP_441226.1_7 Reverse -269 -276 14.4934 0.0123
NP_442446.1_4 Reverse -267 -286 16.0274 0.179
NP_441111.1_7 Forward -276 -268 18.7023 0.00294
NP_441111.1_7 Reverse -269 -277 18.7023 0.00294
NP_441766.1_2 Forward -277 -268 17.5026 0.00297
NP_441766.1_2 Reverse -268 -277 17.5026 0.00297
NP_443052.1_8 Forward -287 -268 10.6192 0.0166
NP_440072.1_5 Reverse -1 -19 -2.0458 0.269
NP_440261.1_5 Reverse -269 -282 -10.5021 0.201
NP_440261.1_5 Forward -276 -263 -12.3704 0.284
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

TGTGTATGTGCGGGGCAAGTACCGTGATGTTATCCTGCCGATGACAGTGATCCGTCGTCTAGATGCAGTTCTGGAGCCGAGTAAGGAAAAGGTACTGACCATGAAGGGTTAACTGGATAGTGCGGCGATCGCCAATCAACATGCCGCCCTCTGTCAGGCTTCCGGGGAGGCTTTTTACAATGTCTCCCCCTTTACCCTGCGGGACTTGAAGAACCGTGCCAAGCAACAGCAACTAAAGGCTGATTTTGAGACCTATCTGGATGGGTTCTCCCAGAACGTTCAGGAGATCCTCGATAAGTTCAAGTTCCGTAACCAAATTCCAACATTAATTGAGGCGGACATCCTTGGGCACCTGTTGGAAAAGTTTCTCGACTCCCGTGTCAACCTCAGCCCTAAGCCG

CDS

GTGCAAGACATAGATGGTAACGAGGTGCTTTCAGCCCTGGACAACCATTCCATGGGCACTATCTTTGAGGAACTAATCCGCCGCTTCAACGAAGAGAACAACGATGAGGCAGGGGAGCACTTCACCCCCCGGGATGTGGTCAAGCTCATGGCTGACCTAATCTTTCTGTCCATTGGTGACTTAATTGAATCCGGTACCTATCTCGTCTATGACGGTGCCTGTGGCACTGGGGGGATGTTAACGGTAGCGGAGGAGAGGCTAGCTGAACTGGCTCAAAATCAAGGTAAGGAGGTCTCTATTCACCTCTTTGGACAGGAGGTACAGCCAGAAACCTACGCCATTTCCAAGGCGGATTTACTGCTGAAGGGGGAAGGGGCGGAAGCGGAGAATATGAAGTACGGTTCCACCCTTTCCAGTGATGCGTTTCCGTCCCAGGAATTTGACTTCATGCTCTCTAATCCTCCTTACGGTAAAAGCTGGAAGACTGACTTGGAGCGCCTGGGGGGCAAGGGAGACATTAAAGACCCACGGTTTGTGACCCGGCATGGGGATGAAGCTGACTACAAGATGATTACCCGTTCCTCAGACGGACAGTTAATGTTCTTGGTCAATAAGCTGGCTAAGATGAAGCACAACACCCGCTTGGGTAGCCGTATTGCTGAGGTACACAACGGGTCGTCCCTCTTTACTGGGGATGCGGGCCAGGGAGAAAGTAATATCCGCCGCTGGATCATTGAAAACGACTGGTTGGAGACTATCATTGCCCTGCCGGAGAATATCTTCTACAACACCGGTATTGCCACCTATATCTGGCTGTTAAGCAACCGTAAGAACGAGGAGCGTCGGGGTAAGGTTCAGCTCATTGATGGGACGGAGTGGTATGTACCCTTACGCCGTAACCTCGGTAAGAAGAATTGTGAGCTTTCCGAGGAACAGATCCAAACTATTGTGGACCTGGTGGTCAATCCGAGGGAGACAGAGAAATCGAAGATCTTTCCCAATCAAGCTTTCGGCTACTGGAAGGTGACTGTCGATCGCCCTTTGCGGGTGGAGGGGGCAGATCCCCAGCGGGTTTACAAAGCCGCCGAAATTAAGGCGTTCAAAAGTGAAGGTAGGGTTACCGAAGAAGGGGTACCGATTATCAAGAAGATTCACAAGAAGGGAACCCGGCCTGATCCTATACACGGTTTGTTCGAGGTGGAGATTGGCGGCAAGCCCTGTGTGGTGGAGTATGAACCCGATAGTAATTTACGGGACAGCGAGCAGATTCCGTTGTTGGAGGATGGGGGCATCGAGGCGTTCTTTCGACGGGAGGTGTTACCCTACACCCCGGATGCCTGGATCGAGGCTAGCAAGACCCAGATAGGCTATGAAGTTTCCTTTACCCGTCATTTTTATAAGCCTGTGCCCATGCGGACTTTGGATGAGATCAAAGCGGATATCTATGCCCTAGAGCAGGAAACTGAGGGTTTGTTGGAACAAATTGTTGGGAATGCTTAG

Protein

No sequence available