Your browser is old and dusty. Try Google Chrome!

Details for sll8002

ORF sll8002
Accession NP_942396.1
Symbol
Category
Definition
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_441061.1_2 Reverse -121 -135 0.294584 0.213
NP_440795.1_7 Forward -270 -263 8.39725 0.213
NP_441418.1_6 Forward -382 -363 -30.0898 0.256
NP_442623.1_3 Forward -193 -174 -11.9969 0.263
NP_442744.1_9 Forward -176 -162 13.1262 0.28
NP_440110.1_7 Forward -137 -118 10.3242 0.289
NP_441935.1_1 Reverse -331 -350 5.60432 0.292
NP_441558.1_5 Forward -71 -52 3.73603 0.299
NP_441265.1_3 Reverse -367 -381 -0.197071 0.268
NP_442191.1_4 Reverse -116 -130 11.3809 0.262
NP_440642.1_10 Reverse -113 -127 1.96562 0.284
NP_441274.1_9 Forward -377 -358 9.14423 0.231
NP_441127.1_1 Forward -376 -362 7.66941 0.3
NP_439905.1_2 Reverse -109 -123 10.4227 0.214
NP_439990.1_5 Reverse -180 -193 6.80412 0.221
NP_443055.1_6 Reverse -358 -376 -1.84987 0.284
NP_441099.1_5 Reverse -157 -176 -7.86702 0.181
NP_441456.1_10 Forward -74 -55 12.1925 0.281
NP_440147.1_4 Reverse -106 -119 2.37923 0.208
NP_441550.1_8 Forward -136 -126 8.04271 0.135
NP_441916.1_10 Reverse -353 -372 0.786102 0.275
NP_440569.1_7 Forward -176 -157 13.2741 0.219
NP_442004.1_6 Reverse -167 -181 2.16287 0.273
NP_439966.1_9 Forward -101 -92 6.68623 0.253
NP_442029.1_8 Forward -342 -323 15.1424 0.129
NP_441016.2_6 Reverse -358 -377 6.88182 0.25
NP_440265.1_8 Forward -219 -201 14.4738 0.224
NP_441876.1_9 Reverse -363 -373 12.0743 0.267
NP_441826.1_2 Reverse -241 -255 -0.0987402 0.204
NP_442227.1_2 Forward -341 -322 -0.0988766 0.253
NP_442361.1_3 Forward -18 -5 12.6056 0.183
NP_442361.1_3 Reverse -155 -168 8.47575 0.285
NP_441878.1_6 Forward -118 -108 -7.78811 0.266
NP_441557.1_8 Reverse -109 -119 10.796 0.275
NP_441308.1_8 Forward -178 -168 13.8447 0.218
NP_441633.1_3 Reverse -123 -136 -4.60227 0.205
NP_442590.1_10 Forward -400 -381 6.09597 0.25
NP_442802.1_6 Forward -140 -121 -2.95047 0.209
NP_440256.1_1 Reverse -244 -263 -6.88371 0.223
NP_440717.1_3 Reverse -111 -125 6.88214 0.291
NP_442866.1_1 Forward -387 -368 -7.67036 0.268
NP_440702.1_2 Forward -384 -365 -5.40875 0.257
NP_441838.1_1 Forward -375 -356 10.7175 0.262
NP_441494.1_5 Reverse -263 -277 17.7968 0.227
NP_442386.1_9 Forward -341 -332 4.7192 0.289
NP_441160.1_5 Reverse -168 -187 -5.80207 0.288
NP_440586.1_9 Reverse -320 -339 7.7676 0.273
NP_440027.1_3 Forward -350 -332 11.1298 0.159
NP_439937.1_8 Forward -101 -82 0.294447 0.235
NP_440408.1_7 Reverse -340 -359 12.0942 0.212
NP_442368.1_3 Forward -386 -368 3.16574 0.3
NP_440267.1_2 Reverse -242 -256 6.88214 0.219
NP_440937.1_5 Reverse -182 -201 7.96426 0.287
NP_440888.1_2 Forward -335 -321 10.2254 0.1
NP_441621.1_7 Reverse -323 -337 1.57289 0.139
NP_440519.1_6 Forward -340 -326 9.63603 0.29
NP_442823.1_9 Reverse -52 -71 16.6867 0.196
NP_440673.1_3 Reverse -249 -256 6.72562 0.277
NP_441052.1_2 Forward -222 -212 -0.216628 0.269
NP_440992.1_2 Reverse -326 -345 9.0459 0.273
NP_442219.1_8 Reverse -252 -271 7.29741 0.271
NP_441884.1_8 Reverse -143 -162 -7.86702 0.254
NP_441004.1_4 Forward -390 -380 7.64985 0.294
NP_441115.1_4 Forward -351 -333 8.17984 0.257
NP_440864.1_1 Forward -393 -374 1.27776 0.182
NP_441851.1_9 Forward -376 -357 6.88262 0.291
NP_442011.1_1 Forward -340 -321 -3.14714 0.289
NP_441046.1_2 Reverse -326 -345 0.982764 0.262
NP_440726.1_8 Forward -387 -368 17.994 0.201
NP_440588.1_2 Forward -391 -372 -2.36049 0.164
NP_442006.1_2 Reverse -325 -342 -6.94266 0.169
NP_442006.1_2 Forward -132 -115 -7.33598 0.171
NP_441570.1_1 Forward -382 -364 -12.1739 0.209
NP_440078.1_10 Forward -124 -105 6.68596 0.218
NP_442443.1_1 Forward -65 -46 -5.21209 0.282
NP_441094.1_6 Reverse -373 -390 9.87119 0.257
NP_439900.1_4 Forward -354 -340 17.3052 0.161
NP_440386.1_3 Forward -68 -49 -3.04881 0.221
NP_441040.1_2 Forward -344 -325 -15.6352 0.286
NP_440459.1_2 Forward -132 -115 11.2486 0.18
NP_440010.1_10 Reverse -118 -137 2.3594 0.279
NP_441329.1_6 Forward -28 -9 -1.48055 0.293
NP_442943.1_1 Forward -67 -52 12.8674 0.124
NP_442839.1_10 Reverse -385 -399 12.3893 0.288
NP_440156.1_4 Reverse -61 -71 8.63269 0.281
NP_442809.1_1 Reverse -50 -69 12.7816 0.277
NP_442565.1_6 Forward -33 -19 15.7325 0.28
NP_440696.1_8 Reverse -244 -263 13.3725 0.141
NP_442679.1_1 Forward -218 -199 -5.21209 0.29
NP_439994.1_1 Reverse -13 -32 12.5858 0.131
NP_440505.1_3 Reverse -47 -57 5.97822 0.202
NP_441203.1_1 Reverse -374 -393 -7.17871 0.13
NP_442532.1_4 Reverse -40 -58 13.2006 0.215
NP_442533.1_1 Forward -385 -366 2.85105 0.0967
NP_442533.1_6 Forward -117 -108 1.76968 0.289
NP_442541.1_4 Forward -85 -67 10.9331 0.298
NP_441028.1_6 Reverse -362 -372 4.40448 0.278
NP_441028.1_6 Reverse -221 -231 3.42118 0.296
NP_442728.1_2 Forward -384 -365 21.1406 0.0635
NP_441106.1_1 Reverse -330 -339 2.16301 0.297
NP_439903.1_6 Forward -385 -366 -1.18128 0.293
NP_442306.1_3 Forward -76 -57 27.6305 0.000588
NP_440670.1_8 Reverse -60 -69 7.96454 0.0731
NP_440886.1_7 Reverse -366 -376 4.10949 0.253
NP_442401.1_4 Reverse -20 -30 15.5198 0.263
NP_441021.1_1 Reverse -109 -128 -6.09707 0.177
NP_441626.1_4 Reverse -323 -342 21.3373 0.056
NP_442224.1_1 Reverse -317 -336 -4.22878 0.233
NP_441272.1_7 Reverse -20 -30 13.4514 0.257
NP_442867.1_8 Reverse -172 -191 5.89931 0.273
NP_440798.1_6 Reverse -91 -104 0.904263 0.242
NP_441332.1_6 Reverse -114 -124 11.3563 0.261
NP_440649.2_2 Forward -343 -324 18.289 0.285
NP_442341.1_7 Reverse -232 -246 2.2612 0.263
NP_441902.1_1 Reverse -352 -371 13.6666 0.28
NP_441359.1_5 Reverse -324 -343 1.57275 0.29
NP_441105.1_3 Forward -128 -109 -0.787193 0.142
NP_441045.1_8 Forward -75 -56 16.3224 0.265
NP_441226.1_7 Forward -339 -332 8.59356 0.197
NP_442446.1_3 Forward -362 -343 12.5858 0.223
NP_440244.1_1 Reverse -323 -342 4.62101 0.186
NP_442154.1_1 Forward -384 -366 -14.9272 0.218
NP_442564.1_10 Reverse -364 -378 8.84938 0.296
NP_440261.1_5 Reverse -359 -372 -4.9956 0.183
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

ATTGCCCGGGTGGCGCAACGTGTTCGAGCTGGGGGGCATCATGTTCCTGAAGCCATTATCCGCCGACGCTTTGCCGCCGGGTTACATAACCTGGAGACTCTCTACAAACTAATAGTTGATGAATGGGTCTGCTATGACAACTCAGGCAATGAACCTGTGCTTATTAACAAAGGAGGTAAGTTATGACCAATCAACAGGGTAATGTTAATGCTCGCAACAGAGAAGAAGATCCCGACATCCTAGGCTCAGAGAAAGCTCTAAGACGGGCCGCTCAGAGGGCACGGGAGAGGGCTAAACAGGCTGGAATCGGAGTGATAATCCTCAAAGACGGTGAAATCGTCGAAGAACTGCCAGATTCTTAACTTTACAGCGGCTAAAAACTAGCAACAGAGGACGAAGA

CDS

ATGACCGTTCCCGCTCAGCCTAAGATTTACCACATTGTCCATGTGGATCGGTTGCCCTCAATTATTGCTGATGGGTGTCTGTGGTGCGATGCGGCGATCTCTCAACGGAATCCGGCAGGGACAACCATCGGGATGAACAAAATCAAGCAACGGCGGTTGAAGGAATTAACCTTGACTAGCCATCCAAGTTTGTACGTAGGCCAATGTGTGCCTTTCTACTTTTGTCCACGTTCCATCATGTTGTTTTTGATCCACAAAAAGAATACAGAGTTGACCTATCAGGGAGGACAGGAACCGATTATTCACCTGGAGGGAGATTTAATCCAAGCTGTGAACTGGGCAGATCAAAACAACCTCCGCTGGGCCTTCACCCTCTCCAATGCTGGGTCATCTTACTTTGAAGACCGCAATAGCTTAGCGCAGTTACACGAAATTGACTGGGCCGCCGTGCAAGCGACTAATTGGCAGACCTGTAAAGAGGGCAAGCAGGCAGAGTTTTTGGTGGAAAGCACTTTTCCATGGCATCTTGTCGAGCGTATCGGGGTAAAATCACGAGTAATTTATGATCAAGTTATCAAAGCTCTGCCCACAGGAGGACACCATCCACAGGTAGAGGTTCGACCGGACTGGTATTACTAA

Protein

No sequence available