Your browser is old and dusty. Try Google Chrome!

Details for sll8001

ORF sll8001
Accession NP_942395.1
Symbol
Category
Definition
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_442744.1_9 Forward -256 -242 12.4475 0.288
NP_441781.1_7 Forward -65 -46 1.57275 0.226
NP_441208.1_9 Reverse -49 -63 7.86607 0.219
NP_442742.1_9 Reverse -145 -164 4.22769 0.127
NP_442841.1_5 Forward -169 -150 18.7798 0.184
NP_441558.1_5 Reverse -130 -149 6.88262 0.2
NP_440209.1_1 Forward -127 -119 2.1827 0.254
NP_442889.1_8 Reverse -129 -143 6.98048 0.167
NP_440178.1_7 Reverse -51 -70 -21.83 0.241
NP_441209.1_3 Forward -399 -380 18.6683 0.226
NP_441209.1_8 Reverse -68 -86 7.217 0.291
NP_442634.1_2 Forward -49 -30 1.67108 0.285
NP_443018.1_3 Reverse -133 -140 10.2655 0.107
NP_442730.1_8 Forward -301 -282 8.84842 0.185
NP_442730.1_8 Reverse -233 -252 3.53858 0.275
NP_442687.1_7 Forward -251 -241 9.12481 0.0994
NP_442687.1_7 Reverse -283 -293 5.48657 0.2
NP_440667.1_2 Reverse -209 -228 -8.65367 0.29
NP_440360.1_5 Forward -313 -294 2.0644 0.297
NP_442300.1_4 Forward -56 -37 18.4848 0.152
NP_442937.1_5 Reverse -273 -292 5.99764 0.293
NP_441415.1_3 Forward -143 -124 9.73422 0.295
NP_439905.1_2 Forward -292 -278 10.0294 0.227
NP_442911.1_2 Reverse -237 -256 -5.01543 0.148
NP_440993.1_2 Reverse -113 -129 1.14018 0.29
NP_441646.1_1 Forward -300 -281 0.58944 0.247
NP_440811.1_5 Reverse -72 -91 16.9124 0.113
NP_441550.1_8 Forward -295 -285 4.69947 0.291
NP_441725.1_4 Reverse -213 -227 3.63724 0.278
NP_441725.1_5 Forward -292 -282 -0.806614 0.271
NP_439966.1_7 Forward -252 -242 5.58445 0.216
NP_441514.1_6 Forward -177 -170 12.7238 0.29
NP_442575.1_8 Reverse -272 -291 3.83436 0.171
NP_442215.1_2 Reverse -282 -298 -5.15301 0.246
NP_441310.1_10 Forward -118 -108 15.7909 0.131
NP_442554.1_8 Forward -140 -130 3.81494 0.209
NP_442142.1_4 Forward -108 -95 3.36198 0.258
NP_441015.1_10 Reverse -273 -292 -10.227 0.283
NP_441015.1_10 Reverse -279 -298 -10.522 0.284
NP_441637.1_9 Reverse -95 -113 11.1305 0.177
NP_441637.1_9 Forward -98 -80 -2.24246 0.292
NP_442719.1_2 Reverse -326 -344 -6.96305 0.232
NP_442808.1_1 Reverse -112 -122 5.58445 0.146
NP_441878.1_6 Reverse -283 -293 1.94665 0.0567
NP_441878.1_6 Forward -294 -284 0.57002 0.14
NP_441036.1_8 Forward -44 -34 9.02648 0.174
NP_442650.1_2 Forward -256 -242 2.85119 0.24
NP_441557.1_4 Forward -322 -308 11.2093 0.291
NP_441445.1_1 Reverse -275 -294 2.65439 0.233
NP_441445.1_1 Forward -224 -205 1.17943 0.259
NP_442066.2_4 Forward -250 -231 -8.06369 0.293
NP_442183.1_1 Reverse -241 -255 8.55439 0.113
NP_440356.1_1 Forward -214 -195 15.6332 0.213
NP_442444.1_6 Reverse -135 -153 18.3374 0.143
NP_442998.1_5 Forward -115 -105 11.1898 0.191
NP_440299.1_1 Reverse -243 -256 5.13193 0.187
NP_441435.1_5 Reverse -280 -299 8.45592 0.183
NP_440256.1_1 Reverse -238 -257 -9.44032 0.28
NP_442386.1_9 Forward -251 -242 4.52254 0.297
NP_440168.1_8 Forward -83 -64 3.24438 0.244
NP_442950.1_1 Forward -346 -327 -5.01543 0.244
NP_440586.1_8 Reverse -133 -140 9.08521 0.178
NP_442959.1_5 Forward -113 -94 8.16093 0.224
NP_440027.1_3 Reverse -285 -303 4.54162 0.257
NP_439937.1_8 Forward -214 -195 -3.44213 0.268
NP_442783.1_8 Reverse -107 -126 14.1583 0.266
NP_442384.1_10 Reverse -284 -297 11.819 0.0326
NP_441877.1_5 Reverse -69 -88 0.196116 0.276
NP_441877.1_10 Forward -244 -226 17.6204 0.224
NP_442262.1_10 Reverse -133 -140 9.18389 0.211
NP_440297.1_9 Forward -292 -282 0.0783647 0.282
NP_441592.1_4 Reverse -278 -297 -0.688862 0.246
NP_441103.1_7 Reverse -160 -178 18.4062 0.212
NP_440990.1_10 Reverse -275 -294 18.3873 0.249
NP_440888.1_2 Reverse -55 -69 8.94708 0.142
NP_440888.1_2 Reverse -4 -18 5.80051 0.262
NP_440071.1_6 Forward -328 -314 13.611 0.261
NP_440220.1_4 Reverse -151 -170 -3.73788 0.296
NP_440519.1_8 Forward -167 -151 2.12349 0.269
NP_442204.1_5 Reverse -274 -293 1.67108 0.231
NP_442080.1_7 Reverse -161 -180 0.884433 0.227
NP_442823.1_8 Reverse -284 -303 12.6841 0.266
NP_441052.1_2 Forward -58 -48 2.53664 0.201
NP_441884.1_8 Forward -251 -232 -11.6036 0.271
NP_441004.1_1 Reverse -272 -291 -17.1101 0.289
NP_442873.1_5 Reverse -31 -50 9.43841 0.248
NP_443054.1_2 Forward -371 -357 -0.492064 0.295
NP_441851.1_10 Reverse -283 -293 4.10993 0.287
NP_440682.1_2 Reverse -5 -24 -7.96535 0.25
NP_442856.1_7 Reverse -163 -182 -6.09707 0.295
NP_442515.1_1 Forward -294 -280 -0.590395 0.228
NP_440593.1_3 Forward -292 -273 -5.99873 0.268
NP_440588.1_2 Forward -302 -283 -5.60541 0.256
NP_440588.1_2 Forward -296 -277 -6.78538 0.292
NP_439950.1_1 Forward -344 -335 16.126 0.145
NP_441078.1_4 Reverse -284 -293 -1.86856 0.272
NP_440707.1_9 Forward -349 -330 1.27776 0.292
NP_442320.1_4 Reverse -270 -289 18.1898 0.266
NP_442010.1_1 Forward -99 -81 16.3413 0.164
NP_442489.1_7 Reverse -284 -293 -1.37691 0.195
NP_442763.1_8 Reverse -50 -69 3.34271 0.186
NP_442913.1_10 Reverse -43 -62 -2.36049 0.184
NP_440545.1_3 Forward -297 -280 -6.746 0.287
NP_440831.1_3 Reverse -275 -294 6.38714 0.275
NP_442934.1_1 Reverse -328 -347 12.4875 0.267
NP_440459.1_2 Reverse -269 -286 10.7569 0.192
NP_440847.1_3 Forward -288 -274 11.602 0.261
NP_441050.1_5 Reverse -65 -83 1.29745 0.233
NP_440671.1_4 Reverse -24 -38 9.63603 0.176
NP_441671.1_1 Forward -223 -204 3.14605 0.263
NP_440875.1_9 Forward -139 -129 11.3895 0.17
NP_440227.1_10 Reverse -140 -159 13.9616 0.193
NP_441239.1_9 Forward -302 -290 5.25052 0.223
NP_442568.1_9 Reverse -293 -312 17.7974 0.123
NP_440604.1_6 Forward -127 -108 -2.75381 0.225
NP_442193.1_1 Forward -167 -149 9.55725 0.24
NP_441508.1_4 Reverse -152 -166 13.8579 0.29
NP_441874.1_1 Reverse -274 -288 14.1593 0.197
NP_440868.1_4 Forward -254 -242 -0.157684 0.248
NP_442402.1_4 Reverse -97 -116 1.76863 0.173
NP_442402.1_10 Reverse -146 -156 14.8275 0.18
NP_440653.1_10 Reverse -133 -152 3.53937 0.271
NP_442039.1_7 Forward -196 -186 12.4681 0.231
NP_442533.1_1 Reverse -281 -300 -15.7335 0.257
NP_442533.1_6 Forward -293 -284 5.60459 0.137
NP_441028.1_6 Reverse -108 -118 7.74772 0.218
NP_441028.1_6 Reverse -365 -375 3.42118 0.296
NP_441028.1_6 Reverse -339 -349 3.42118 0.296
NP_440116.1_5 Forward -130 -113 6.92201 0.166
NP_441972.1_5 Forward -286 -267 -5.21209 0.215
NP_441972.1_5 Forward -76 -57 -9.63698 0.292
NP_442213.1_6 Reverse -41 -60 11.4058 0.246
NP_440841.1_4 Forward -326 -307 -4.6221 0.19
NP_442794.1_1 Forward -260 -248 7.02048 0.152
NP_440387.1_5 Reverse -109 -128 11.2303 0.274
NP_440634.1_1 Forward -73 -54 17.109 0.223
NP_440114.1_10 Reverse -241 -255 5.80112 0.292
NP_442733.1_3 Forward -306 -287 14.4541 0.236
NP_441272.1_7 Forward -161 -151 17.5813 0.175
NP_440457.1_1 Reverse -26 -38 2.89058 0.205
NP_442509.1_9 Reverse -284 -294 7.15773 0.234
NP_440734.1_9 Reverse -314 -333 13.5691 0.213
NP_442341.1_7 Reverse -226 -240 1.08123 0.299
NP_441173.1_9 Reverse -149 -157 11.0321 0.228
NP_442513.1_9 Reverse -285 -302 21.5733 0.136
NP_441842.1_10 Reverse -291 -305 6.09611 0.299
NP_440275.1_3 Forward -41 -31 6.46988 0.105
NP_440679.1_10 Reverse -277 -296 -20.5517 0.286
NP_440149.1_8 Forward -256 -237 -7.96535 0.296
NP_440216.1_1 Reverse -198 -212 -12.0951 0.24
NP_440216.1_1 Reverse -284 -298 -12.1934 0.247
NP_440216.1_9 Reverse -134 -143 15.9293 0.128
NP_440216.1_9 Reverse -133 -142 6.78456 0.289
NP_442015.1_10 Reverse -280 -293 2.77255 0.187
NP_440198.1_3 Forward -302 -283 15.6332 0.253
NP_440416.1_9 Forward -300 -281 -8.55534 0.117
NP_440416.1_9 Forward -288 -269 -20.2567 0.283
NP_440261.1_5 Reverse -285 -298 -12.1738 0.272
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

AAAAAGAATACAGAGTTGACCTATCAGGGAGGACAGGAACCGATTATTCACCTGGAGGGAGATTTAATCCAAGCTGTGAACTGGGCAGATCAAAACAACCTCCGCTGGGCCTTCACCCTCTCCAATGCTGGGTCATCTTACTTTGAAGACCGCAATAGCTTAGCGCAGTTACACGAAATTGACTGGGCCGCCGTGCAAGCGACTAATTGGCAGACCTGTAAAGAGGGCAAGCAGGCAGAGTTTTTGGTGGAAAGCACTTTTCCATGGCATCTTGTCGAGCGTATCGGGGTAAAATCACGAGTAATTTATGATCAAGTTATCAAAGCTCTGCCCACAGGAGGACACCATCCACAGGTAGAGGTTCGACCGGACTGGTATTACTAATCTGGAGGAGGCGCTA

CDS

ATGTTTGAATGTAAAAGTGGCAACATCCTAACAGAAGATACCGAAGCCCTGGTCAACACCGTCAACTGTGTGGGCGTGATGGGCCGTGGGATCGCGCTACAGTTCAAGAAAGCCTTCCCAGAGAACTTCAAAGCCTATGCCCAGGCTTGTAAAGAGGAAAAAGTTAAGCCCGGCGAAATGTTTGTCTTTCAAACCGGACAACTGGTAAACCCTCGCTTTATCATCAACTTTCCAACCAAACGTCACTGGCGTACCCATAGCCGTATAGATGATATTGAAAACGGACTAAAAGCCCTTAAATGTACTATACAGAAATACAAGATTCGCTCTATCGCCATTCCCCCCTTAGGTTGTGGGTTGGGGGGCCTTGATTGGGCTGAAGTTAAAACCCGCATTGAAGTAATCCTCAAGCCTCTTGATAACGTACAGATTATCCTCTATGAACCCCATGGTGAACTATCCCAAGCAAAAACGGTACAGAGTCTTCGTGCGCCAAAGATGACCCCTGGTAGAGCTGTGTTAGTTGAGTTGGTCAGCCGATATCTCCAAGGTTTGTTAGATCCCTTTATCACTCTGCTAGAAATACACAAGCTAATGTATTTTATGCAAGAGTCAGGGGAATTCCTGCAACTCAGGTATGCAAAAGCGCCCTACGGCCCTTACGCCGAAAACCTGCGCCATGTCCTGAATGTTATTGAAGGACATCTCATCACCGGATATGCAGATGGGGGTGATCAACCCAATAAACCCATAGCCCTACTGCCCAATGCAATTGAGAAAGCAACTACATTCCTACAGGATTATCCAGAAACCCATACTAGGTTTGAGAAAGTGACCGATTTAGTGGAAGGATTTGAGTCTCCTTTCGGTTTAGAACTACTGTCAACCGTGCACTGGATAGTCAAGAATGAACCAGTCAATTCTTTGTCTGATGTTATTGATCGCACCTACGCATGGAACCAGCGTAAGCAACAATTCACCCAAAGACAAATCGAGCTAGCAGTCAATGTTTTGAACAAAAAGGGCTGGATTAATCGTCCTTATTAA

Protein

No sequence available