Your browser is old and dusty. Try Google Chrome!

Details for sll7103

ORF sll7103
Accession NP_942391.1
Symbol
Category
Definition
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_441061.1_2 Reverse -4 -18 1.96621 0.179
NP_442100.1_4 Forward -182 -163 9.63507 0.278
NP_441480.1_1 Forward -188 -169 -0.787193 0.287
NP_440897.1_6 Reverse -296 -315 3.9319 0.14
NP_441453.1_4 Forward -12 -4 6.80426 0.121
NP_441453.1_4 Reverse -3 -11 6.11594 0.121
NP_442151.1_1 Reverse -133 -152 4.42435 0.287
NP_442151.1_6 Reverse -3 -17 6.98109 0.214
NP_440226.1_9 Reverse -239 -258 12.1925 0.215
NP_442623.1_3 Forward -46 -27 -11.2103 0.231
NP_441098.1_3 Reverse -259 -278 -6.50185 0.28
NP_440996.1_1 Reverse -247 -266 18.6308 0.0234
NP_440996.1_2 Reverse -203 -212 14.8477 0.248
NP_442173.1_1 Reverse -4 -12 12.0158 0.0316
NP_442173.1_1 Forward -11 -3 4.83764 0.241
NP_442752.1_4 Forward -12 -5 13.8055 0.0199
NP_441812.1_4 Reverse -306 -324 11.9172 0.253
NP_441470.1_4 Reverse -376 -395 27.5321 0.0000116
NP_441470.1_6 Reverse -233 -252 28.2204 0.0000759
NP_441470.1_7 Reverse -332 -351 27.2371 0.000139
NP_440784.1_7 Forward -11 -4 6.23397 0.241
NP_440784.1_7 Reverse -4 -11 6.13563 0.241
NP_442972.1_2 Reverse -221 -235 15.2402 0.136
NP_442268.1_3 Forward -310 -291 12.9783 0.284
NP_441492.1_1 Reverse -128 -147 11.1109 0.148
NP_441365.1_5 Reverse -128 -147 37.5619 0.000000115
NP_440300.1_5 Forward -119 -101 12.225 0.271
NP_441083.1_5 Reverse -3 -13 17.7779 0.00336
NP_441083.1_5 Forward -12 -2 -1.00328 0.289
NP_441434.1_1 Forward -279 -265 10.0383 0.233
NP_441434.1_1 Reverse -265 -279 7.93745 0.26
NP_441738.1_2 Reverse -5 -12 15.28 0.0102
NP_441558.1_5 Reverse -1 -20 8.25926 0.155
NP_440209.1_1 Forward -12 -4 8.57422 0.0425
NP_440209.1_1 Reverse -3 -11 5.52596 0.0821
NP_440178.1_7 Forward -303 -284 -15.0452 0.156
NP_440659.1_9 Forward -21 -2 19.2723 0.09
NP_441716.1_2 Forward -96 -77 3.35565 0.229
NP_442111.1_4 Reverse -2 -16 9.34103 0.0609
NP_440906.1_5 Forward -11 -4 6.23397 0.234
NP_440906.1_5 Reverse -4 -11 6.13563 0.241
NP_440747.1_10 Forward -15 -3 5.25052 0.0154
NP_442973.1_5 Reverse -136 -155 9.93088 0.287
NP_443018.1_3 Reverse -4 -11 11.7405 0.0655
NP_443018.1_3 Forward -11 -4 5.44732 0.193
NP_440376.1_1 Forward -12 -3 5.99792 0.111
NP_440376.1_1 Reverse -3 -12 -0.196935 0.285
NP_441588.1_4 Reverse -5 -15 9.02648 0.14
NP_442730.1_8 Forward -182 -163 8.16011 0.185
NP_442687.1_7 Reverse -177 -187 4.20827 0.262
NP_440550.1_9 Reverse -5 -24 13.1758 0.281
NP_442720.1_8 Forward -359 -341 7.59063 0.297
NP_442658.1_1 Reverse -143 -153 6.37109 0.231
NP_440141.1_8 Forward -50 -31 11.4058 0.206
NP_442496.1_5 Reverse -195 -213 4.83737 0.288
NP_441958.1_5 Reverse -2 -12 1.55333 0.095
NP_441958.1_5 Forward -13 -3 0.865012 0.12
NP_440610.1_4 Forward -47 -28 17.5015 0.245
NP_440203.1_5 Reverse -6 -16 14.2375 0.0886
NP_442064.1_4 Forward -22 -3 7.4718 0.242
NP_440200.1_7 Reverse -191 -210 6.22677 0.204
NP_441913.1_1 Reverse -304 -320 13.6262 0.246
NP_442598.1_2 Forward -338 -329 14.2577 0.252
NP_441000.1_1 Reverse -127 -145 13.3937 0.184
NP_440147.1_4 Forward -14 -1 -0.37404 0.282
NP_441550.1_8 Forward -14 -4 13.3526 0.0252
NP_441550.1_8 Reverse -1 -11 8.43603 0.124
NP_441041.1_4 Reverse -3 -22 -7.76869 0.192
NP_441369.1_1 Reverse -93 -112 38.7419 0.000000157
NP_441369.1_2 Reverse -123 -142 38.9385 0.0000000955
NP_441369.1_3 Reverse -76 -90 28.5156 0.00021
NP_442004.1_6 Reverse -3 -17 7.47274 0.159
NP_441725.1_5 Forward -11 -1 -0.511621 0.26
NP_439966.1_7 Reverse -1 -11 14.5325 0.0203
NP_442941.1_3 Reverse -4 -14 1.25834 0.15
NP_442941.1_3 Forward -11 -1 0.766681 0.171
NP_440983.1_5 Forward -53 -34 -7.27704 0.287
NP_440260.1_8 Forward -21 -3 2.28076 0.182
NP_441334.1_7 Reverse -1 -20 -18.9784 0.275
NP_441079.1_3 Reverse -147 -166 13.4708 0.166
NP_441566.1_3 Reverse -191 -210 14.5524 0.198
NP_440437.1_1 Reverse -287 -306 -5.80207 0.292
NP_442049.1_6 Forward -20 -1 6.78429 0.215
NP_442288.1_5 Reverse -91 -105 16.7159 0.12
NP_441556.1_6 Reverse -95 -113 12.4797 0.296
NP_441644.1_6 Reverse -3 -13 14.4342 0.0126
NP_441644.1_6 Forward -12 -2 5.68278 0.18
NP_443049.1_6 Forward -13 -3 14.4711 0.114
NP_442247.1_5 Forward -120 -106 14.4865 0.234
NP_440929.1_8 Reverse -3 -12 7.07956 0.0713
NP_442933.1_1 Forward -244 -225 7.11373 0.253
NP_442671.1_2 Reverse -101 -120 24.6829 0.000359
NP_442554.1_8 Reverse -4 -14 5.48657 0.146
NP_442554.1_8 Forward -11 -1 5.09324 0.161
NP_442970.1_1 Reverse -103 -117 9.56081 0.269
NP_442292.1_1 Reverse -4 -13 8.65285 0.0335
NP_442016.1_2 Reverse -9 -28 20.7464 0.0979
NP_440895.1_6 Forward -18 -5 10.049 0.202
NP_440405.1_6 Reverse -259 -277 2.18243 0.26
NP_440881.1_10 Forward -310 -297 11.3273 0.249
NP_442076.1_5 Reverse -97 -116 9.93088 0.186
NP_440183.1_1 Forward -372 -353 8.25926 0.244
NP_441468.1_1 Forward -11 -4 6.13563 0.209
NP_441468.1_1 Reverse -4 -11 6.0373 0.223
NP_441673.1_1 Forward -12 -3 1.37636 0.114
NP_441673.1_1 Reverse -3 -12 1.1797 0.163
NP_441826.1_2 Reverse -296 -310 -0.197071 0.204
NP_441826.1_6 Reverse -257 -271 20.5508 0.0182
NP_442868.1_6 Forward -14 -4 0.0783647 0.248
NP_441056.1_1 Reverse -3 -22 -8.55534 0.282
NP_441612.1_2 Reverse -201 -211 11.5505 0.21
NP_442361.1_3 Forward -18 -5 16.7355 0.0568
NP_442808.1_1 Reverse -2 -12 9.71433 0.0481
NP_440871.1_3 Forward -97 -83 15.905 0.166
NP_442775.1_6 Forward -378 -359 10.5209 0.277
NP_442050.1_5 Reverse -1 -11 14.9258 0.0175
NP_440274.1_2 Forward -397 -383 12.3887 0.236
NP_441036.1_7 Reverse -197 -207 16.7941 0.0578
NP_442650.1_2 Reverse -3 -17 6.3911 0.134
NP_441557.1_5 Forward -12 -3 1.08137 0.0794
NP_441557.1_5 Reverse -3 -12 0.589713 0.134
NP_441445.1_1 Forward -320 -301 1.17943 0.259
NP_440084.1_5 Forward -385 -366 13.7658 0.124
NP_440356.1_4 Reverse -20 -39 1.57275 0.255
NP_441116.1_10 Forward -209 -190 4.71934 0.257
NP_442347.1_2 Reverse -4 -13 10.3245 0.058
NP_442047.1_2 Forward -323 -309 15.4376 0.161
NP_441633.1_3 Forward -73 -60 -4.9956 0.22
NP_441633.1_6 Forward -222 -203 8.75091 0.182
NP_440136.1_1 Forward -256 -240 9.69426 0.238
NP_440136.1_2 Forward -11 -4 6.23397 0.171
NP_440136.1_2 Reverse -4 -11 6.13563 0.193
NP_442998.1_5 Reverse -124 -134 8.53483 0.261
NP_442998.1_10 Reverse -5 -12 15.5754 0.0102
NP_440899.1_8 Forward -116 -97 -9.14533 0.258
NP_440299.1_1 Forward -16 -3 4.24695 0.213
NP_441118.1_2 Reverse -164 -183 24.4839 0.000875
NP_441118.1_10 Reverse -296 -314 24.0119 0.000829
NP_441362.1_2 Reverse -99 -118 5.55684 0.243
NP_440915.1_6 Forward -16 -2 11.2093 0.0267
NP_441296.1_6 Forward -288 -269 0.982764 0.299
NP_441704.1_8 Forward -23 -4 9.04509 0.196
NP_440537.1_7 Reverse -77 -96 16.6629 0.0599
NP_440306.1_3 Reverse -260 -279 4.71934 0.295
NP_442386.1_9 Reverse -8 -17 10.2257 0.136
NP_442386.1_9 Forward -19 -10 4.62087 0.294
NP_442386.1_9 Reverse -2 -11 4.52254 0.297
NP_441340.1_5 Forward -11 -4 13.5105 0.0314
NP_441340.1_5 Reverse -303 -310 8.8889 0.084
NP_441340.1_5 Reverse -4 -11 5.84064 0.208
NP_442484.1_2 Forward -23 -4 0.0977854 0.252
NP_441248.1_10 Reverse -380 -390 14.9073 0.277
NP_442240.1_1 Reverse -30 -49 9.93006 0.211
NP_440586.1_8 Reverse -4 -11 9.47853 0.146
NP_440586.1_8 Forward -11 -4 5.74197 0.283
NP_440192.1_4 Reverse -379 -398 12.6963 0.169
NP_441262.1_3 Forward -12 -5 14.7888 0.0223
NP_443051.1_1 Forward -13 -4 7.47288 0.0571
NP_443051.1_1 Reverse -2 -11 0.29472 0.195
NP_440372.1_2 Forward -11 -4 13.8055 0.0214
NP_440372.1_2 Reverse -4 -11 6.52896 0.188
NP_440372.1_3 Reverse -104 -118 15.0039 0.165
NP_441181.1_6 Reverse -4 -22 5.03403 0.235
NP_441293.1_6 Forward -395 -376 16.09 0.1
NP_442384.1_10 Reverse -3 -16 5.32916 0.131
NP_441018.1_3 Forward -302 -283 10.52 0.286
NP_440530.1_6 Forward -295 -281 15.7664 0.201
NP_442790.1_4 Forward -21 -2 -14.5535 0.278
NP_442262.1_10 Reverse -4 -11 13.2155 0.0213
NP_441689.1_5 Reverse -1 -11 8.53436 0.132
NP_440344.1_6 Forward -66 -52 16.1259 0.271
NP_440344.1_10 Forward -42 -25 -12.5475 0.257
NP_442123.1_10 Forward -25 -6 5.11266 0.288
NP_442910.1_1 Reverse -314 -333 -7.57203 0.254
NP_440562.1_5 Forward -360 -341 3.04771 0.261
NP_440350.1_5 Forward -349 -330 1.57275 0.158
NP_442187.1_3 Forward -13 -3 15.6147 0.105
NP_442280.1_10 Forward -22 -4 8.96084 0.246
NP_442129.1_6 Reverse -102 -121 13.9464 0.246
NP_440888.1_2 Forward -180 -166 6.19383 0.243
NP_440888.1_2 Reverse -3 -17 5.01387 0.298
NP_441771.1_4 Reverse -200 -219 -4.42544 0.292
NP_442225.1_10 Forward -22 -3 14.4533 0.147
NP_440663.1_6 Forward -310 -291 14.4541 0.0249
NP_441543.1_2 Reverse -4 -13 7.07956 0.131
NP_442845.1_2 Forward -18 -4 7.76774 0.195
NP_442845.1_2 Reverse -296 -310 3.93283 0.272
NP_442710.1_6 Reverse -210 -229 6.39097 0.204
NP_442710.1_7 Reverse -100 -119 -7.22274 0.294
NP_442578.1_7 Forward -11 -4 6.0373 0.18
NP_439907.1_10 Reverse -294 -313 11.0117 0.273
NP_441462.1_2 Forward -12 -2 16.2046 0.00406
NP_440519.1_6 Forward -185 -171 9.43936 0.29
NP_442204.1_1 Forward -16 -5 8.7118 0.0852
NP_440544.1_5 Forward -351 -344 13.8024 0.28
NP_440516.1_8 Forward -12 -3 18.9776 0.00442
NP_440516.1_8 Reverse -3 -12 5.01461 0.118
NP_442428.1_5 Forward -11 -4 6.13563 0.209
NP_442428.1_5 Reverse -4 -11 6.0373 0.212
NP_440673.1_3 Reverse -5 -12 12.4288 0.0426
NP_441052.1_2 Reverse -3 -13 10.6981 0.0285
NP_442219.1_8 Forward -22 -3 6.33108 0.3
NP_442219.1_9 Reverse -4 -13 7.96454 0.0696
NP_440436.1_4 Reverse -4 -13 7.57079 0.124
NP_441719.1_4 Forward -11 -4 6.82395 0.0855
NP_441719.1_4 Reverse -4 -11 6.52896 0.188
NP_442813.1_4 Reverse -30 -49 2.55606 0.197
NP_442366.1_5 Forward -15 -5 14.0409 0.0497
NP_442139.1_10 Forward -380 -361 12.1917 0.188
NP_442694.1_8 Forward -117 -99 12.3105 0.191
NP_442206.1_10 Reverse -3 -18 0.176559 0.269
NP_441851.1_10 Forward -36 -26 4.89658 0.24
NP_441982.1_10 Forward -145 -126 8.55343 0.143
NP_440005.1_3 Reverse -263 -282 21.2407 0.00993
NP_442689.1_8 Forward -117 -100 -8.61428 0.294
NP_441661.1_3 Reverse -338 -355 -3.99273 0.226
NP_442843.1_1 Reverse -10 -29 -1.47551 0.197
NP_441124.1_5 Reverse -96 -106 12.7217 0.215
NP_440431.1_3 Reverse -295 -314 -10.7186 0.276
NP_440943.1_5 Reverse -142 -156 14.1593 0.22
NP_442006.1_2 Reverse -9 -26 -10.3842 0.197
NP_440078.1_4 Forward -23 -4 11.0125 0.237
NP_441078.1_4 Forward -12 -3 0.196389 0.205
NP_441078.1_4 Reverse -3 -12 -0.000272808 0.205
NP_442348.1_2 Forward -356 -347 11.7994 0.225
NP_442906.1_9 Forward -221 -202 4.32602 0.207
NP_441432.1_8 Forward -13 -4 14.0611 0.0258
NP_441432.1_8 Reverse -170 -179 2.85133 0.281
NP_440713.1_4 Forward -22 -3 0.982764 0.298
NP_442489.1_2 Forward -23 -4 3.44104 0.236
NP_442489.1_7 Forward -12 -3 0.688044 0.152
NP_442489.1_7 Reverse -3 -12 0.688044 0.152
NP_440559.1_1 Reverse -4 -13 7.76787 0.0918
NP_441659.2_8 Reverse -3 -13 5.48657 0.106
NP_441659.2_8 Forward -12 -2 1.84832 0.224
NP_440284.1_8 Reverse -134 -153 29.6945 0.000000161
NP_440284.1_9 Reverse -202 -221 28.8104 0.00000727
NP_440336.1_1 Reverse -226 -245 10.5209 0.286
NP_441047.1_2 Reverse -4 -23 1.47442 0.239
NP_441833.1_4 Reverse -4 -11 6.52896 0.0924
NP_441833.1_4 Forward -11 -4 6.23397 0.163
NP_441329.1_1 Forward -207 -188 5.29938 0.265
NP_441329.1_6 Reverse -332 -351 12.0793 0.106
NP_441329.1_6 Reverse -330 -349 -2.14899 0.293
NP_442436.1_4 Forward -245 -231 12.3893 0.218
NP_442162.1_9 Forward -11 -4 12.9205 0.0282
NP_442162.1_9 Reverse -4 -11 12.9205 0.0282
NP_442140.1_3 Reverse -4 -14 10.2065 0.0902
NP_442140.1_3 Reverse -10 -20 3.71661 0.283
NP_441813.1_5 Reverse -1 -11 12.7631 0.0192
NP_440590.1_4 Reverse -4 -17 1.29759 0.127
NP_440567.1_1 Reverse -4 -18 4.42448 0.121
NP_442497.1_10 Reverse -4 -13 0.589713 0.153
NP_442497.1_10 Forward -11 -2 -1.18024 0.256
NP_440821.1_4 Forward -14 -4 -0.314959 0.251
NP_440227.1_2 Reverse -273 -289 8.41667 0.29
NP_441239.1_9 Reverse -1 -13 10.5604 0.076
NP_442568.1_8 Reverse -332 -346 10.7177 0.257
NP_442270.1_9 Forward -23 -4 -8.26035 0.217
NP_441541.1_1 Reverse -113 -131 -3.43572 0.264
NP_440833.1_4 Forward -361 -343 14.3755 0.0722
NP_440546.1_4 Forward -12 -2 15.6695 0.0459
NP_440462.1_6 Reverse -1 -11 12.9597 0.0319
NP_440868.1_4 Forward -16 -4 3.57889 0.134
NP_442499.1_4 Reverse -300 -314 11.0127 0.226
NP_442840.1_7 Reverse -204 -223 13.5691 0.064
NP_440341.1_7 Forward -330 -316 12.6843 0.2
NP_441848.1_4 Reverse -279 -295 7.74165 0.288
NP_442039.1_4 Forward -11 -4 11.6422 0.0747
NP_441811.1_8 Reverse -385 -399 5.80112 0.289
NP_442679.1_1 Reverse -225 -244 3.83436 0.147
NP_440825.1_7 Reverse -4 -14 10.9578 0.278
NP_442837.1_3 Forward -11 -4 6.0373 0.25
NP_442837.1_3 Reverse -4 -11 6.0373 0.25
NP_442053.1_1 Reverse -3 -12 14.4544 0.0114
NP_442053.1_1 Forward -12 -3 7.86621 0.0863
NP_440505.1_3 Forward -14 -4 7.64985 0.151
NP_441959.1_8 Reverse -103 -116 8.61288 0.286
NP_442456.1_5 Reverse -167 -185 6.80398 0.26
NP_440914.1_1 Reverse -3 -13 13.1043 0.0386
NP_440914.1_1 Forward -12 -2 10.8597 0.118
NP_441011.1_8 Forward -11 -2 11.5045 0.0778
NP_442533.1_6 Reverse -3 -12 4.42462 0.179
NP_441482.1_7 Forward -18 -4 -8.8502 0.193
NP_441028.1_6 Forward -208 -198 14.6309 0.158
NP_441527.1_4 Reverse -331 -350 -1.09858 0.146
NP_441527.1_4 Reverse -330 -349 -1.28956 0.146
NP_441527.1_4 Reverse -333 -352 -1.67153 0.148
NP_441527.1_4 Reverse -334 -353 -4.15432 0.179
NP_441527.1_4 Reverse -332 -351 -11.5072 0.282
NP_441527.1_4 Reverse -193 -212 -12.1756 0.285
NP_440115.1_6 Forward -15 -5 9.32148 0.115
NP_440007.1_9 Forward -16 -2 6.78443 0.217
NP_439965.1_1 Forward -365 -346 -10.4236 0.3
NP_441680.1_4 Reverse -4 -23 -1.37718 0.262
NP_442673.1_5 Forward -227 -209 11.4255 0.272
NP_441106.1_7 Reverse -364 -383 13.0766 0.205
NP_441825.1_4 Forward -356 -346 12.5664 0.249
NP_441286.1_1 Forward -13 -1 3.97222 0.0397
NP_440670.1_8 Forward -12 -3 8.75118 0.0606
NP_440670.1_8 Reverse -3 -12 6.19458 0.124
NP_442463.1_3 Forward -186 -167 10.0292 0.275
NP_440886.1_7 Reverse -2 -12 6.76441 0.114
NP_441001.1_10 Reverse -31 -50 5.89931 0.266
NP_439940.1_1 Reverse -75 -94 31.957 0.00000438
NP_440907.2_8 Reverse -4 -14 5.87944 0.184
NP_441626.1_2 Forward -11 -4 12.2322 0.0511
NP_441626.1_2 Reverse -4 -11 5.93897 0.231
NP_442794.1_1 Forward -16 -4 12.232 0.0721
NP_442615.1_1 Forward -21 -3 -2.53746 0.145
NP_440855.1_3 Forward -337 -318 9.63507 0.185
NP_441431.1_1 Forward -118 -100 5.06306 0.245
NP_441488.1_8 Forward -17 -3 21.4351 0.00564
NP_441836.1_1 Forward -23 -4 20.655 0.0154
NP_442805.1_6 Reverse -164 -183 1.86774 0.292
NP_440114.1_10 Reverse -145 -159 7.37441 0.236
NP_442324.1_7 Reverse -133 -152 6.24429 0.268
NP_441510.2_7 Forward -47 -33 9.83206 0.281
NP_440293.1_3 Reverse -39 -58 -5.70374 0.281
NP_440766.1_4 Forward -16 -2 3.24451 0.151
NP_440766.1_5 Reverse -199 -211 7.65579 0.288
NP_440278.1_1 Reverse -357 -376 9.53756 0.155
NP_440457.1_1 Forward -16 -4 1.80894 0.223
NP_440213.1_4 Forward -227 -208 15.6421 0.217
NP_442680.1_5 Reverse -270 -289 1.73297 0.237
NP_441436.1_8 Reverse -320 -339 7.07928 0.293
NP_441496.1_1 Forward -217 -203 14.3354 0.265
NP_441885.1_5 Reverse -3 -13 1.25834 0.11
NP_441885.1_5 Forward -12 -2 -0.0199663 0.186
NP_442341.1_5 Reverse -278 -297 15.0441 0.182
NP_442341.1_9 Reverse -1 -15 12.9786 0.0921
NP_440191.1_6 Forward -118 -104 13.1895 0.294
NP_443000.1_7 Forward -14 -4 0.57002 0.294
NP_441842.1_10 Forward -19 -5 7.66941 0.249
NP_440275.1_3 Forward -14 -4 5.48657 0.145
NP_441397.1_8 Reverse -199 -212 15.8179 0.142
NP_441902.1_3 Reverse -199 -209 13.0789 0.23
NP_442451.1_7 Reverse -98 -117 12.9791 0.113
NP_442451.1_7 Reverse -229 -248 8.65258 0.26
NP_441190.1_2 Reverse -207 -226 4.03102 0.17
NP_440149.1_8 Reverse -3 -22 -5.40875 0.226
NP_440216.1_9 Reverse -304 -313 5.50626 0.292
NP_440172.1_1 Forward -12 -2 8.82982 0.0586
NP_440172.1_1 Reverse -3 -13 2.24165 0.279
NP_441064.1_4 Forward -325 -306 7.07928 0.276
NP_442015.1_10 Forward -16 -3 0.60927 0.221
NP_441226.1_7 Forward -11 -4 12.7234 0.0312
NP_441226.1_7 Reverse -4 -11 11.5435 0.0757
NP_442834.1_9 Reverse -7 -26 14.5524 0.0911
NP_440117.1_7 Reverse -240 -254 17.9942 0.0592
NP_441111.1_7 Reverse -4 -12 8.86921 0.0589
NP_441766.1_2 Reverse -3 -12 14.7494 0.00772
NP_442116.1_6 Reverse -324 -341 12.5616 0.172
NP_442116.1_6 Forward -119 -102 7.50051 0.254
NP_440988.1_10 Reverse -1 -15 5.67333 0.24
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

CGGCCTCACTCCAAATTTCTTGGCTCTGTCTATCAATCTTGCATCGGGATTTTCTTCTACGTCTTTTTTTAGAGCTTCCCAGTCTAATTTCCTATGGCGACGCTCTACTTTTGTTGGGCTTAAATCTACTCTATTTAACCATCTGTATATCGAGGCTTTTCCTATTTTATATATCTTGGAAGCCTCAGTTATTTTTCCTCCAGCTTCTATATAAGCTACTACCCTTTGCCTTAAATCTAAACTGTAAGCCATTGTTTAAACCTGTTCATTTTGTACACTCCATAATTTTACATTAAATTCTCTCATCGTTAATTGAAATGACTATATCTTGAATCCGCCCCAGGATAACAAACCACAACTGCAACGGGGAAGCACTATTTTCCGCCTTGGCGATCGGGTT

CDS

ATGCAACTAAAAAATGATTATCATCGGGAAGTTTTTAATGGTGATCAGGGTACTATCACTGCCATTGAAAGGGAAGAACAAATATTGACTATTACTTATGATGACCGTCCCGTAGATTACGATTTTGCTGATTTAAACGAAATTGATTTGGCTTGGGCTATTAGCATTCATAAAAGCCAGGGTTCCGAATATCCAGTGGTGATTTTGCCGTTGTATATGCAACATTTTCTGCTATTAAGCCGTAATCTTTTTTACACTGGTTTAACCCGGGCCAAACGGTTAGCATTAGTAATCGGTTCCCAAAAGGCGATCGGTTATGCTGTCCGACAACAGAAAGAGCGTTATCGCTACACTAGGCTTGCCGATAGATTAGTCATTTCTCCATAA

Protein

No sequence available