Your browser is old and dusty. Try Google Chrome!

Details for sll7078

ORF sll7078
Accession NP_942366.2
Symbol
Category
Definition
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_441061.1_2 Forward -309 -295 13.4709 0.04
NP_440557.1_1 Forward -309 -290 3.93269 0.192
NP_440557.1_3 Forward -162 -143 11.3075 0.12
NP_440795.1_7 Forward -309 -302 14.6904 0.0123
NP_440795.1_7 Reverse -302 -309 14.6904 0.0123
NP_441418.1_6 Forward -310 -291 -29.3032 0.221
NP_442291.1_5 Reverse -300 -316 6.45005 0.0694
NP_442291.1_5 Forward -311 -295 -2.89139 0.229
NP_441453.1_4 Reverse -301 -309 16.539 0.00633
NP_441453.1_4 Forward -310 -302 16.539 0.00633
NP_441960.1_4 Reverse -256 -272 12.3492 0.248
NP_442151.1_6 Forward -310 -296 21.4357 0.0045
NP_442151.1_6 Reverse -301 -315 7.57108 0.194
NP_443043.1_9 Forward -258 -239 11.3067 0.24
NP_441818.1_1 Forward -309 -298 16.0861 0.0221
NP_441630.1_3 Reverse -293 -312 8.55425 0.111
NP_441630.1_3 Forward -318 -299 5.211 0.145
NP_442655.1_1 Forward -315 -296 1.67108 0.238
NP_442173.1_1 Forward -309 -301 15.4574 0.00633
NP_442173.1_1 Reverse -302 -310 15.4574 0.00633
NP_442752.1_4 Forward -310 -303 13.8055 0.0199
NP_442752.1_4 Reverse -301 -308 13.8055 0.0199
NP_443027.1_4 Forward -312 -302 13.2547 0.0521
NP_443027.1_4 Reverse -299 -309 13.1564 0.0521
NP_439997.1_4 Reverse -163 -182 10.0292 0.189
NP_441812.1_3 Reverse -300 -314 10.4227 0.222
NP_442975.1_10 Reverse -297 -311 12.487 0.0477
NP_442975.1_10 Forward -314 -300 3.93223 0.249
NP_440784.1_7 Forward -309 -302 15.9687 0.0123
NP_440784.1_7 Reverse -302 -309 15.9687 0.0123
NP_442909.1_7 Forward -330 -316 5.80051 0.269
NP_440061.1_9 Forward -312 -298 11.9953 0.103
NP_440110.1_8 Reverse -299 -318 0.786102 0.211
NP_441054.1_3 Forward -141 -123 16.6122 0.171
NP_442062.1_8 Forward -310 -300 17.3846 0.00193
NP_442062.1_8 Reverse -301 -311 10.3048 0.0493
NP_440761.1_4 Reverse -296 -315 -13.7669 0.257
NP_440304.1_4 Forward -312 -302 10.8948 0.051
NP_440304.1_4 Reverse -299 -309 9.91146 0.051
NP_442242.1_4 Forward -309 -302 14.3954 0.0124
NP_442242.1_4 Reverse -302 -309 14.3954 0.0124
NP_441781.1_7 Forward -283 -264 5.211 0.186
NP_442602.1_3 Reverse -139 -158 16.8141 0.0232
NP_441208.1_9 Reverse -298 -312 13.6676 0.103
NP_441594.1_6 Reverse -292 -311 11.8975 0.116
NP_441594.1_6 Reverse -347 -366 6.09597 0.196
NP_442196.1_10 Forward -312 -293 11.3075 0.225
NP_442110.1_7 Forward -310 -296 17.5025 0.0233
NP_442110.1_7 Reverse -301 -315 2.5562 0.222
NP_442896.1_7 Reverse -120 -139 16.5191 0.0141
NP_441925.1_4 Reverse -108 -127 -17.1108 0.288
NP_441083.1_5 Forward -310 -300 20.3345 0.00053
NP_441083.1_5 Reverse -301 -311 11.2881 0.0159
NP_442827.1_8 Reverse -293 -312 12.585 0.0454
NP_442827.1_8 Forward -318 -299 -0.39464 0.226
NP_442841.1_10 Reverse -280 -299 13.6675 0.159
NP_441738.1_2 Forward -308 -301 15.28 0.0102
NP_441738.1_2 Reverse -303 -310 15.28 0.0102
NP_441738.1_2 Forward -377 -370 9.77352 0.143
NP_441738.1_2 Forward -175 -168 8.29857 0.176
NP_441558.1_5 Forward -312 -293 13.2741 0.0606
NP_441558.1_5 Reverse -299 -318 9.43923 0.122
NP_441645.1_6 Reverse -118 -132 13.1753 0.193
NP_440209.1_1 Reverse -301 -309 18.1123 0.00295
NP_440209.1_1 Forward -310 -302 18.1123 0.00295
NP_441713.1_1 Reverse -295 -314 -16.8151 0.286
NP_442920.1_2 Reverse -129 -148 21.6285 0.0645
NP_440178.1_7 Reverse -300 -319 -12.4886 0.121
NP_440178.1_7 Forward -311 -292 -15.5368 0.162
NP_440053.1_2 Reverse -160 -179 10.0292 0.291
NP_442570.1_3 Forward -312 -293 -4.52377 0.231
NP_440331.1_5 Reverse -99 -118 10.7175 0.00196
NP_441716.1_1 Forward -310 -296 3.8345 0.259
NP_441327.1_5 Reverse -209 -218 12.6844 0.298
NP_442111.1_4 Reverse -300 -314 13.1759 0.0394
NP_442111.1_4 Forward -311 -297 2.2612 0.283
NP_440906.1_5 Forward -309 -302 15.8704 0.0124
NP_440906.1_5 Reverse -302 -309 15.8704 0.0124
NP_440747.1_10 Forward -313 -301 17.1486 0.000663
NP_440747.1_10 Reverse -298 -310 7.51213 0.00286
NP_441130.1_10 Forward -312 -298 8.06273 0.141
NP_441130.1_10 Reverse -299 -313 6.98109 0.173
NP_441486.1_1 Reverse -298 -312 -2.36035 0.175
NP_442634.1_4 Reverse -299 -313 6.58777 0.0489
NP_442634.1_4 Forward -312 -298 5.80112 0.051
NP_440403.1_4 Reverse -292 -311 0.884433 0.14
NP_440403.1_10 Reverse -292 -311 3.04771 0.278
NP_442848.1_1 Reverse -295 -309 6.3911 0.0791
NP_443018.1_3 Forward -309 -302 14.8871 0.0123
NP_443018.1_3 Reverse -302 -309 14.8871 0.0123
NP_441634.1_8 Forward -312 -298 5.40779 0.114
NP_440376.1_1 Forward -310 -301 19.4693 0.000692
NP_440376.1_1 Reverse -301 -310 19.4693 0.000692
NP_441857.1_5 Reverse -294 -312 5.23069 0.209
NP_441588.1_4 Forward -308 -298 8.63316 0.14
NP_442687.1_7 Forward -311 -301 9.02648 0.0994
NP_442687.1_7 Reverse -300 -310 8.92815 0.0994
NP_442958.1_3 Reverse -290 -309 -2.36049 0.293
NP_440642.1_10 Forward -259 -245 5.21053 0.241
NP_440642.1_10 Reverse -84 -98 3.53891 0.271
NP_441013.1_2 Forward -321 -303 -0.7675 0.274
NP_441422.1_7 Forward -312 -295 -2.3211 0.21
NP_441274.1_3 Reverse -310 -329 6.4893 0.181
NP_442296.1_9 Reverse -295 -314 -2.16383 0.219
NP_442658.1_1 Forward -312 -302 14.2375 0.0237
NP_442658.1_1 Reverse -299 -309 9.616 0.147
NP_441855.2_4 Forward -333 -314 11.5476 0.211
NP_442782.1_2 Reverse -301 -315 8.84938 0.198
NP_442205.1_9 Forward -316 -300 -1.90808 0.264
NP_439959.1_3 Reverse -289 -308 16.9124 0.148
NP_442937.1_5 Reverse -290 -309 6.68596 0.272
NP_441958.1_5 Forward -311 -301 21.2195 0.000805
NP_441958.1_5 Reverse -300 -310 12.2714 0.00183
NP_441958.1_5 Reverse -369 -379 -2.28158 0.27
NP_442836.1_5 Reverse -295 -314 14.7491 0.0588
NP_440984.1_7 Forward -315 -301 16.0275 0.0466
NP_440984.1_7 Reverse -296 -310 10.3243 0.126
NP_439990.1_5 Reverse -296 -309 11.7207 0.128
NP_440153.1_5 Reverse -302 -316 13.5693 0.0551
NP_440153.1_5 Forward -309 -295 11.2093 0.0763
NP_443055.1_3 Forward -319 -300 11.6 0.25
NP_443055.1_6 Forward -366 -348 3.16499 0.2
NP_440993.1_2 Forward -315 -299 12.1532 0.0735
NP_440993.1_2 Reverse -296 -312 3.89344 0.256
NP_441099.1_5 Reverse -291 -310 3.44104 0.0515
NP_441099.1_5 Forward -320 -301 -12.0953 0.294
NP_442002.1_1 Forward -136 -118 -10.3056 0.292
NP_442002.1_9 Reverse -369 -376 13.9038 0.141
NP_442002.1_9 Reverse -2 -9 11.1505 0.185
NP_441294.1_5 Reverse -13 -31 7.78729 0.291
NP_441294.1_7 Reverse -297 -311 11.3624 0.147
NP_442438.1_10 Reverse -296 -310 15.7325 0.0253
NP_441292.1_2 Forward -135 -116 -2.45882 0.219
NP_441000.1_5 Reverse -323 -342 7.07848 0.248
NP_441000.1_6 Reverse -300 -314 -3.83532 0.225
NP_440147.1_4 Forward -312 -299 19.6855 0.00258
NP_440147.1_4 Reverse -299 -312 9.16406 0.0428
NP_441550.1_8 Reverse -299 -309 16.7941 0.00906
NP_441550.1_8 Forward -312 -302 15.8108 0.0132
NP_441916.1_7 Reverse -301 -311 18.9579 0.00144
NP_441916.1_7 Forward -310 -300 10.3048 0.0261
NP_440345.1_3 Forward -146 -132 19.683 0.109
NP_440345.1_3 Forward -147 -133 12.0436 0.247
NP_441041.1_4 Reverse -295 -314 -10.522 0.233
NP_441041.1_4 Forward -358 -339 -12.6852 0.272
NP_441041.1_7 Forward -313 -301 13.3454 0.0485
NP_441041.1_7 Reverse -298 -310 12.4708 0.0611
NP_441725.1_4 Forward -315 -301 4.03056 0.278
NP_441725.1_5 Forward -309 -299 9.02648 0.0553
NP_441725.1_5 Reverse -302 -312 1.94665 0.115
NP_439966.1_7 Reverse -299 -309 14.8275 0.0177
NP_439966.1_7 Forward -312 -302 14.3359 0.0203
NP_439966.1_9 Reverse -299 -308 0.884706 0.253
NP_442941.1_3 Reverse -302 -312 19.2529 0.00262
NP_442941.1_3 Forward -309 -299 10.9931 0.0116
NP_440289.1_2 Reverse -298 -311 4.8375 0.0644
NP_440289.1_2 Forward -313 -300 3.16588 0.0811
NP_440983.1_9 Forward -319 -300 3.73603 0.285
NP_440260.1_7 Reverse -249 -268 -6.29373 0.292
NP_442281.1_1 Forward -315 -301 16.9119 0.00698
NP_442281.1_1 Reverse -296 -310 14.8469 0.0155
NP_441334.1_7 Reverse -299 -318 -10.9153 0.12
NP_441334.1_7 Forward -312 -293 -10.9153 0.12
NP_440177.1_9 Reverse -287 -306 14.0608 0.219
NP_440437.1_1 Forward -316 -297 3.14605 0.126
NP_441457.1_7 Forward -312 -293 0.0977854 0.288
NP_442288.1_3 Reverse -79 -96 8.59364 0.257
NP_440498.1_1 Forward -319 -301 0.0191479 0.218
NP_441644.1_6 Reverse -301 -311 19.0557 0.000803
NP_441644.1_6 Forward -310 -300 17.3841 0.00127
NP_442501.1_2 Forward -327 -308 0.196116 0.222
NP_442215.1_2 Forward -312 -296 -0.629782 0.17
NP_442215.1_2 Reverse -299 -315 -3.38305 0.214
NP_442029.1_6 Forward -133 -114 4.916 0.259
NP_442029.1_6 Reverse -171 -190 4.42435 0.268
NP_442029.1_6 Reverse -296 -315 2.65439 0.291
NP_440253.1_2 Forward -310 -292 -1.65248 0.245
NP_440929.1_8 Forward -310 -301 19.2726 0.000701
NP_440929.1_8 Reverse -301 -310 19.2726 0.000701
NP_442933.1_10 Forward -310 -301 17.601 0.00325
NP_442933.1_10 Reverse -301 -310 17.601 0.00325
NP_441751.2_8 Reverse -302 -316 7.47274 0.0339
NP_441751.2_8 Forward -309 -295 5.30946 0.0448
NP_442926.1_4 Forward -129 -111 16.4404 0.245
NP_442554.1_8 Forward -309 -299 18.0729 0.00543
NP_442554.1_8 Reverse -302 -312 17.2863 0.00543
NP_441762.1_7 Forward -311 -299 2.79224 0.0676
NP_441762.1_7 Reverse -300 -312 -6.84419 0.284
NP_442142.1_4 Forward -313 -300 12.9 0.0406
NP_442142.1_4 Reverse -298 -311 12.8017 0.0409
NP_442142.1_4 Reverse -346 -359 8.57349 0.112
NP_442142.1_4 Reverse -291 -304 3.26365 0.262
NP_442292.1_1 Forward -309 -300 18.486 0.00229
NP_442292.1_1 Reverse -302 -311 17.5026 0.00435
NP_442381.1_8 Reverse -298 -317 -12.7836 0.267
NP_443009.1_5 Reverse -300 -311 14.5128 0.02
NP_443009.1_5 Forward -311 -300 10.1862 0.0792
NP_441726.1_7 Forward -112 -93 12.7825 0.0952
NP_442406.1_1 Reverse -106 -125 11.11 0.234
NP_442301.1_5 Forward -138 -119 12.7816 0.268
NP_441715.1_4 Reverse -302 -312 16.7946 0.0106
NP_441715.1_4 Forward -309 -299 7.84651 0.107
NP_441198.1_5 Forward -308 -295 17.1282 0.206
NP_441468.1_1 Forward -309 -302 15.8704 0.0124
NP_441468.1_1 Reverse -302 -309 15.8704 0.0124
NP_441020.2_6 Reverse -368 -385 6.82368 0.251
NP_441015.1_10 Forward -315 -296 -8.752 0.277
NP_441015.1_10 Reverse -296 -315 -10.227 0.283
NP_441673.1_1 Forward -310 -301 20.8459 0.000698
NP_441673.1_1 Reverse -301 -310 20.8459 0.000698
NP_441826.1_2 Reverse -295 -309 25.369 0.000802
NP_441826.1_2 Forward -316 -302 -1.67204 0.252
NP_441330.1_1 Forward -315 -296 -2.75381 0.0791
NP_442868.1_6 Reverse -299 -309 17.4829 0.012
NP_442868.1_6 Forward -312 -302 10.4031 0.038
NP_441612.1_2 Forward -310 -300 8.54929 0.21
NP_442808.1_1 Forward -311 -301 8.73102 0.0481
NP_442808.1_1 Reverse -300 -310 8.63269 0.0481
NP_440145.1_3 Reverse -291 -310 -2.36049 0.168
NP_442820.1_4 Reverse -296 -313 12.1336 0.265
NP_442542.1_2 Reverse -293 -306 9.95071 0.131
NP_442542.1_9 Forward -317 -303 12.2903 0.11
NP_442542.1_9 Reverse -294 -308 11.2087 0.111
NP_442050.1_5 Forward -312 -302 15.9091 0.0091
NP_442050.1_5 Reverse -299 -309 15.6142 0.01
NP_440558.1_2 Reverse -112 -131 -5.9004 0.267
NP_441518.1_3 Reverse -291 -310 -3.3438 0.114
NP_441878.1_6 Forward -311 -301 10.5014 0.0176
NP_441878.1_6 Reverse -300 -310 10.4031 0.0176
NP_441036.1_8 Forward -311 -301 15.713 0.00724
NP_441036.1_8 Reverse -300 -310 8.33817 0.174
NP_441557.1_5 Forward -310 -301 19.9609 0.000699
NP_441557.1_5 Reverse -301 -310 19.9609 0.000699
NP_442066.2_4 Forward -310 -291 10.9142 0.0603
NP_442066.2_4 Reverse -301 -320 2.0644 0.139
NP_442066.2_9 Reverse -297 -310 8.08242 0.193
NP_442795.1_6 Forward -352 -333 12.8808 0.295
NP_440101.1_3 Forward -315 -296 0.884433 0.289
NP_442183.1_1 Forward -310 -296 8.55439 0.113
NP_442135.1_3 Reverse -289 -308 7.66927 0.235
NP_442135.1_3 Forward -322 -303 6.19431 0.26
NP_441574.1_1 Reverse -312 -331 -7.4737 0.292
NP_441549.1_9 Reverse -297 -315 -6.27403 0.198
NP_442632.1_1 Forward -260 -241 12.29 0.244
NP_442347.1_2 Forward -309 -300 12.4878 0.056
NP_442347.1_2 Reverse -302 -311 3.34298 0.284
NP_442645.1_2 Reverse -286 -305 -17.9951 0.267
NP_442645.1_2 Forward -312 -293 -21.6334 0.29
NP_442888.1_6 Reverse -290 -309 4.22769 0.228
NP_442888.1_7 Forward -159 -140 9.53756 0.295
NP_441037.1_4 Reverse -299 -309 9.55921 0.21
NP_441037.1_4 Forward -312 -302 7.22024 0.237
NP_441633.1_3 Forward -312 -299 6.01747 0.0481
NP_441633.1_3 Reverse -299 -312 -6.07724 0.236
NP_440136.1_2 Forward -309 -302 15.9687 0.0123
NP_440136.1_2 Reverse -302 -309 15.9687 0.0123
NP_442998.1_5 Reverse -178 -188 12.9597 0.158
NP_442998.1_5 Reverse -1 -11 8.23984 0.267
NP_442998.1_10 Forward -308 -301 15.5754 0.0102
NP_442998.1_10 Reverse -303 -310 15.5754 0.0102
NP_440299.1_1 Reverse -297 -310 13.5883 0.0298
NP_441799.1_1 Forward -314 -300 14.3553 0.0242
NP_441799.1_1 Reverse -297 -311 4.71887 0.238
NP_440640.1_6 Forward -282 -263 0.0977854 0.276
NP_441007.1_10 Reverse -296 -309 10.4424 0.0656
NP_441007.1_10 Forward -315 -302 1.39592 0.203
NP_442201.1_10 Reverse -290 -309 -14.4552 0.282
NP_440256.1_1 Forward -313 -294 5.30933 0.0372
NP_440256.1_1 Reverse -298 -317 0.884433 0.0791
NP_441559.1_8 Forward -315 -301 1.47456 0.155
NP_442756.1_1 Reverse -96 -115 6.4893 0.194
NP_440915.1_6 Reverse -297 -311 23.1074 0.00162
NP_440915.1_6 Forward -314 -300 1.08123 0.147
NP_440748.1_4 Reverse -312 -331 12.3883 0.292
NP_441464.1_8 Forward -327 -313 6.6861 0.226
NP_440026.1_7 Forward -315 -300 15.7129 0.188
NP_441939.1_3 Reverse -302 -321 13.9625 0.0811
NP_441939.1_3 Forward -309 -290 11.5042 0.112
NP_441199.1_6 Forward -314 -295 -1.37718 0.292
NP_442993.1_1 Reverse -301 -317 -9.18458 0.179
NP_442386.1_9 Reverse -300 -309 13.8639 0.0289
NP_442386.1_9 Forward -311 -302 6.39082 0.219
NP_442386.1_10 Forward -126 -113 13.9823 0.107
NP_441340.1_5 Forward -309 -302 15.6737 0.0124
NP_441340.1_5 Reverse -302 -309 15.6737 0.0124
NP_441254.1_1 Reverse -147 -160 10.8351 0.295
NP_442240.1_2 Forward -309 -290 -12.1936 0.159
NP_442240.1_2 Reverse -302 -321 -20.0601 0.295
NP_440211.1_4 Reverse -166 -176 13.5497 0.296
NP_440586.1_8 Forward -309 -302 13.2151 0.026
NP_440586.1_8 Reverse -302 -309 13.2151 0.026
NP_440586.1_8 Forward -393 -386 7.02027 0.279
NP_442251.1_6 Forward -309 -302 15.2804 0.0124
NP_442251.1_6 Reverse -302 -309 15.2804 0.0124
NP_441262.1_3 Reverse -301 -308 14.7888 0.0223
NP_441262.1_3 Forward -310 -303 14.7888 0.0223
NP_443051.1_1 Forward -311 -302 19.5676 0.00335
NP_443051.1_1 Reverse -300 -309 10.4228 0.00754
NP_439937.1_9 Reverse -114 -131 -1.04349 0.122
NP_439937.1_9 Reverse -113 -130 -11.3682 0.251
NP_441657.1_5 Forward -314 -295 3.44104 0.142
NP_440836.1_6 Forward -192 -178 11.701 0.214
NP_440398.1_6 Forward -177 -158 2.65439 0.294
NP_442374.1_9 Reverse -307 -326 17.699 0.0184
NP_440439.1_1 Forward -313 -300 10.934 0.0339
NP_440439.1_1 Reverse -298 -311 1.10092 0.162
NP_440372.1_2 Forward -309 -302 16.3621 0.0124
NP_440372.1_2 Reverse -302 -309 16.3621 0.0124
NP_441946.1_9 Reverse -138 -155 12.0007 0.287
NP_440316.1_10 Forward -125 -115 8.4365 0.239
NP_441803.1_2 Forward -315 -296 13.3725 0.0506
NP_440139.1_1 Forward -316 -297 1.08032 0.272
NP_441572.1_7 Reverse -295 -314 7.57094 0.0769
NP_440267.1_2 Forward -315 -301 20.5501 0.00946
NP_442384.1_10 Reverse -301 -314 9.95071 0.047
NP_442384.1_10 Forward -310 -297 3.95252 0.172
NP_441877.1_7 Reverse -290 -309 2.85027 0.218
NP_442572.1_10 Forward -334 -315 15.5947 0.284
NP_442790.1_4 Reverse -292 -311 -0.39387 0.0942
NP_442262.1_10 Forward -309 -302 14.1988 0.0123
NP_442262.1_10 Reverse -302 -309 14.1988 0.0123
NP_441689.1_5 Forward -312 -302 8.3377 0.132
NP_441689.1_5 Reverse -299 -309 5.87944 0.197
NP_440344.1_10 Reverse -294 -311 -8.12263 0.123
NP_440531.1_6 Forward -318 -299 5.40766 0.115
NP_440531.1_6 Reverse -293 -312 4.916 0.119
NP_442123.1_3 Reverse -301 -320 12.5858 0.2
NP_440562.1_3 Forward -309 -292 7.512 0.15
NP_441965.1_3 Reverse -291 -310 1.57275 0.22
NP_441965.1_10 Reverse -298 -314 8.515 0.125
NP_440297.1_9 Forward -309 -299 -0.216628 0.282
NP_440297.1_9 Reverse -302 -312 -0.216628 0.282
NP_443036.1_1 Forward -305 -286 11.0117 0.256
NP_442067.1_4 Reverse -290 -309 4.52268 0.256
NP_440999.1_9 Reverse -297 -311 11.3077 0.0455
NP_440999.1_9 Forward -314 -300 0.687908 0.177
NP_440888.1_2 Forward -310 -296 21.8284 0.000484
NP_440888.1_2 Reverse -301 -315 13.2736 0.0307
NP_440600.1_4 Forward -318 -300 8.47561 0.0689
NP_440600.1_4 Reverse -293 -311 -1.25915 0.163
NP_439969.1_3 Reverse -296 -315 7.96426 0.133
NP_442277.1_4 Reverse -292 -311 6.58682 0.157
NP_441949.1_6 Forward -324 -305 8.55343 0.289
NP_441543.1_2 Forward -309 -300 16.9127 0.00359
NP_441543.1_2 Reverse -302 -311 15.9293 0.00518
NP_441543.1_3 Forward -181 -167 10.3237 0.212
NP_442845.1_2 Reverse -295 -309 14.5526 0.0796
NP_442845.1_2 Forward -316 -302 5.21113 0.24
NP_441469.1_8 Forward -311 -302 6.5879 0.227
NP_441469.1_8 Reverse -300 -309 6.48957 0.227
NP_442315.1_2 Reverse -132 -144 12.822 0.291
NP_443064.1_3 Forward -140 -121 13.4708 0.159
NP_443064.1_6 Forward -310 -300 12.5669 0.0796
NP_443064.1_6 Reverse -301 -311 10.8217 0.13
NP_442337.1_8 Forward -338 -319 -1.08219 0.278
NP_442578.1_7 Forward -309 -302 14.5921 0.026
NP_442578.1_7 Reverse -302 -309 14.5921 0.026
NP_440710.1_1 Forward -318 -300 1.00246 0.148
NP_441462.1_2 Reverse -301 -311 20.2362 0.000805
NP_441462.1_2 Forward -310 -300 11.5831 0.00406
NP_441462.1_4 Forward -326 -307 -1.47551 0.177
NP_441621.1_7 Reverse -299 -313 4.62115 0.0934
NP_443062.1_1 Reverse -301 -319 12.1537 0.0851
NP_442204.1_1 Forward -314 -303 11.3667 0.0565
NP_442204.1_1 Forward -274 -263 3.10693 0.266
NP_441351.1_8 Reverse -347 -366 1.86774 0.265
NP_440516.1_8 Forward -310 -301 16.9127 0.00442
NP_440516.1_8 Reverse -301 -310 16.9127 0.00442
NP_442428.1_5 Forward -309 -302 15.8704 0.0124
NP_442428.1_5 Reverse -302 -309 15.8704 0.0124
NP_440673.1_2 Reverse -291 -310 8.82876 0.263
NP_440673.1_3 Forward -308 -301 12.4288 0.0426
NP_440673.1_3 Reverse -303 -310 12.4288 0.0426
NP_440673.1_7 Reverse -290 -309 1.57275 0.244
NP_440865.1_9 Forward -316 -297 -7.86702 0.251
NP_441052.1_2 Forward -310 -300 19.9412 0.00106
NP_441052.1_2 Reverse -301 -311 10.4031 0.0285
NP_441052.1_2 Reverse -349 -359 1.55333 0.238
NP_442219.1_9 Forward -309 -300 17.7976 0.00718
NP_442219.1_9 Reverse -302 -311 8.25953 0.0681
NP_440436.1_4 Forward -309 -300 17.2072 0.00233
NP_440436.1_4 Reverse -302 -311 9.24241 0.0871
NP_441884.1_8 Reverse -300 -319 -0.983855 0.138
NP_441884.1_9 Forward -313 -294 -12.9802 0.138
NP_441884.1_9 Reverse -298 -317 -22.125 0.275
NP_440648.1_1 Reverse -301 -320 3.44104 0.249
NP_442414.1_9 Reverse -109 -128 13.9625 0.227
NP_441719.1_4 Forward -309 -302 16.3621 0.0124
NP_441719.1_4 Reverse -302 -309 16.3621 0.0124
NP_441733.1_10 Reverse -298 -311 10.2457 0.106
NP_441004.1_1 Reverse -295 -314 -12.1936 0.245
NP_441004.1_1 Reverse -162 -181 -15.0452 0.271
NP_441004.1_1 Reverse -350 -369 -17.9951 0.296
NP_441115.1_4 Forward -311 -293 12.8014 0.0969
NP_440328.1_4 Reverse -295 -314 15.6341 0.0338
NP_440328.1_4 Forward -316 -297 -0.4922 0.281
NP_443054.1_2 Forward -312 -298 10.3243 0.0761
NP_442430.1_10 Forward -320 -301 11.995 0.245
NP_442586.1_6 Reverse -307 -326 8.16093 0.296
NP_441851.1_9 Forward -127 -108 7.47261 0.279
NP_441851.1_10 Reverse -300 -310 15.8113 0.00552
NP_441851.1_10 Forward -311 -301 8.53483 0.114
NP_442208.1_5 Reverse -299 -318 -9.83364 0.295
NP_442622.1_8 Reverse -301 -319 0.805796 0.0626
NP_442011.1_1 Reverse -300 -319 -1.18052 0.268
NP_442856.1_7 Forward -319 -300 -1.7705 0.231
NP_442515.1_1 Reverse -300 -314 3.04785 0.125
NP_442515.1_1 Forward -311 -297 -4.32697 0.298
NP_442515.1_1 Forward -23 -9 -4.32697 0.298
NP_440593.1_3 Reverse -296 -315 -6.1954 0.271
NP_440165.1_5 Forward -311 -292 -7.67036 0.274
NP_441349.1_10 Forward -320 -301 7.07928 0.0326
NP_441349.1_10 Reverse -291 -310 -6.98204 0.239
NP_441409.1_6 Reverse -295 -314 -8.65367 0.172
NP_440432.1_9 Reverse -302 -317 6.37141 0.0477
NP_440432.1_9 Forward -309 -294 -0.216765 0.164
NP_442843.1_1 Reverse -162 -181 -1.18052 0.192
NP_439960.1_10 Forward -317 -299 4.73903 0.161
NP_439960.1_10 Reverse -305 -323 -2.43913 0.255
NP_439960.1_10 Reverse -294 -312 -4.79907 0.297
NP_441477.1_10 Reverse -294 -312 8.37728 0.181
NP_439950.1_1 Reverse -167 -176 16.0277 0.145
NP_440954.1_4 Reverse -169 -188 -3.44213 0.275
NP_442006.1_2 Forward -124 -107 -15.6941 0.228
NP_440483.1_1 Reverse -156 -175 -2.75381 0.208
NP_440483.1_1 Reverse -125 -144 -8.55534 0.289
NP_441570.1_1 Reverse -301 -319 10.3439 0.00901
NP_441570.1_1 Forward -310 -292 0.904127 0.0353
NP_441078.1_4 Forward -310 -301 19.6659 0.0007
NP_441078.1_4 Reverse -301 -310 19.6659 0.0007
NP_442729.1_8 Reverse -297 -310 8.77074 0.125
NP_441663.1_8 Forward -316 -297 6.39097 0.126
NP_442348.1_2 Forward -265 -256 12.2911 0.218
NP_442348.1_2 Forward -117 -108 12.0944 0.218
NP_440707.1_6 Forward -318 -299 14.2566 0.172
NP_442443.1_1 Reverse -122 -141 1.86774 0.194
NP_442443.1_1 Reverse -310 -329 -0.885524 0.227
NP_440526.1_3 Forward -309 -298 20.0193 0.0113
NP_441432.1_8 Reverse -300 -309 16.8143 0.00595
NP_441432.1_8 Forward -311 -302 16.8143 0.00595
NP_442320.1_8 Reverse -295 -309 13.5693 0.0144
NP_441732.1_2 Forward -314 -298 2.91013 0.0145
NP_440760.1_1 Forward -310 -291 -7.17871 0.0685
NP_440760.1_1 Reverse -301 -320 -21.535 0.238
NP_442797.1_7 Reverse -293 -311 10.5406 0.169
NP_442797.1_7 Reverse -315 -333 -0.374176 0.282
NP_440199.1_10 Reverse -298 -308 7.35486 0.231
NP_442298.1_9 Forward -15 -2 20.1765 0.093
NP_440913.1_1 Forward -312 -294 12.3105 0.164
NP_440913.1_1 Reverse -299 -317 6.11567 0.23
NP_441072.1_2 Forward -321 -302 11.3075 0.188
NP_440713.1_4 Forward -320 -301 3.53937 0.242
NP_442489.1_7 Forward -310 -301 20.1576 0.000695
NP_442489.1_7 Reverse -301 -310 20.1576 0.000695
NP_440559.1_1 Forward -309 -300 17.4043 0.00658
NP_440559.1_1 Reverse -302 -311 8.65285 0.0586
NP_441659.2_8 Reverse -301 -311 20.9245 0.000805
NP_441659.2_8 Forward -310 -300 18.1713 0.00133
NP_441040.1_2 Forward -305 -286 -14.8485 0.286
NP_440708.1_6 Forward -341 -322 -9.24366 0.261
NP_442776.1_1 Forward -321 -302 8.45592 0.197
NP_440779.1_5 Forward -310 -293 -15.0058 0.3
NP_442346.1_5 Reverse -300 -310 16.6963 0.00248
NP_442346.1_5 Forward -311 -301 16.303 0.00248
NP_442346.1_10 Reverse -104 -123 -3.63879 0.294
NP_440545.1_3 Reverse -297 -314 6.13536 0.0568
NP_440545.1_3 Forward -314 -297 -0.256152 0.151
NP_440459.1_2 Forward -312 -295 17.0501 0.0834
NP_441653.1_2 Reverse -290 -309 3.72288 0.264
NP_440010.1_4 Forward -314 -295 1.76863 0.227
NP_440010.1_4 Reverse -291 -310 -1.27961 0.267
NP_442603.1_7 Forward -310 -296 13.1753 0.0923
NP_440449.1_6 Reverse -293 -311 7.96405 0.206
NP_440449.1_6 Forward -333 -315 4.55984 0.296
NP_441948.1_4 Forward -317 -299 -4.20908 0.22
NP_440170.1_6 Forward -315 -296 12.2908 0.283
NP_441833.1_4 Forward -309 -302 15.9687 0.0124
NP_441833.1_4 Reverse -302 -309 15.9687 0.0124
NP_441112.1_6 Forward -320 -301 5.211 0.183
NP_442162.1_9 Forward -309 -302 16.2637 0.0124
NP_442162.1_9 Reverse -302 -309 16.2637 0.0124
NP_440671.1_2 Forward -307 -293 16.4209 0.155
NP_440671.1_4 Reverse -295 -309 8.84938 0.188
NP_440671.1_4 Forward -316 -302 7.37441 0.219
NP_440224.1_1 Reverse -290 -309 2.85105 0.132
NP_440224.1_1 Forward -321 -302 1.17943 0.132
NP_442045.1_7 Forward -213 -194 3.14605 0.212
NP_441915.1_4 Forward -125 -106 7.57013 0.293
NP_442140.1_3 Forward -309 -299 13.5497 0.0542
NP_442140.1_3 Reverse -302 -312 4.69992 0.238
NP_441696.1_6 Reverse -302 -321 0.491109 0.294
NP_440875.1_9 Reverse -303 -313 16.5483 0.0145
NP_440875.1_9 Forward -308 -298 8.66404 0.233
NP_441813.1_5 Forward -312 -302 18.1713 0.00743
NP_441813.1_5 Reverse -299 -309 8.73149 0.0367
NP_441813.1_7 Forward -324 -310 8.45543 0.284
NP_442472.1_10 Reverse -275 -294 12.585 0.235
NP_440590.1_4 Forward -309 -296 21.0621 0.00401
NP_440590.1_4 Reverse -302 -315 -5.38892 0.277
NP_440590.1_7 Reverse -159 -173 15.3392 0.253
NP_440567.1_1 Forward -309 -295 15.0442 0.0181
NP_440567.1_1 Reverse -302 -316 -0.688726 0.298
NP_442497.1_10 Reverse -302 -311 17.601 0.00813
NP_442497.1_10 Forward -309 -300 10.4228 0.0087
NP_440821.1_4 Reverse -299 -309 17.9746 0.00497
NP_440821.1_4 Forward -312 -302 2.24165 0.131
NP_440227.1_2 Reverse -40 -56 9.10498 0.29
NP_441239.1_9 Reverse -113 -125 17.1486 0.0153
NP_441239.1_9 Forward -312 -300 13.0187 0.0389
NP_441239.1_9 Reverse -299 -311 7.11881 0.169
NP_441892.1_1 Forward -319 -302 11.0519 0.0584
NP_441892.1_1 Reverse -292 -309 8.88863 0.0757
NP_442669.1_1 Forward -210 -191 24.1889 0.00027
NP_442669.1_1 Reverse -95 -114 22.2223 0.000502
NP_442643.1_3 Forward -175 -156 -8.45701 0.295
NP_443012.1_7 Reverse -322 -341 12.6841 0.277
NP_442216.1_4 Forward -176 -168 8.1805 0.255
NP_442138.1_10 Reverse -301 -320 -0.688862 0.16
NP_442138.1_10 Forward -310 -291 -1.18052 0.171
NP_440546.1_4 Reverse -301 -311 13.5365 0.0459
NP_440546.1_4 Forward -310 -300 10.046 0.109
NP_440546.1_7 Forward -358 -348 15.8113 0.237
NP_440462.1_6 Forward -312 -302 18.7612 0.00454
NP_440462.1_6 Reverse -299 -309 10.3048 0.0396
NP_440868.1_4 Forward -314 -302 14.7886 0.0169
NP_440868.1_4 Reverse -297 -309 0.432302 0.212
NP_441249.1_1 Forward -158 -139 2.94938 0.197
NP_441474.1_1 Forward -320 -301 -0.29631 0.255
NP_442402.1_2 Forward -148 -134 10.2254 0.295
NP_442402.1_4 Forward -153 -134 -8.16275 0.278
NP_442402.1_10 Forward -145 -135 13.6475 0.2
NP_442402.1_10 Forward -144 -134 13.5492 0.2
NP_441084.1_6 Forward -312 -298 13.3194 0.135
NP_440696.1_3 Reverse -301 -319 -0.865831 0.249
NP_442882.1_8 Reverse -166 -185 22.0256 0.0151
NP_442039.1_4 Forward -309 -302 15.1821 0.0124
NP_442039.1_4 Reverse -302 -309 15.1821 0.0124
NP_442891.1_3 Reverse -141 -155 17.3052 0.211
NP_441926.1_3 Reverse -301 -317 7.13836 0.17
NP_442696.1_6 Reverse -112 -131 6.4893 0.051
NP_442696.1_6 Forward -183 -164 -11.7019 0.235
NP_442837.1_3 Forward -309 -302 15.7721 0.0124
NP_442837.1_3 Reverse -302 -309 15.7721 0.0124
NP_440160.1_9 Reverse -301 -320 12.2908 0.216
NP_439994.1_1 Forward -365 -346 7.57094 0.271
NP_439994.1_3 Forward -311 -292 9.41407 0.253
NP_442053.1_1 Forward -310 -301 18.3876 0.0007
NP_442053.1_1 Reverse -301 -310 18.3876 0.0007
NP_440505.1_3 Forward -312 -302 17.188 0.00332
NP_440505.1_3 Reverse -299 -309 16.598 0.00683
NP_440505.1_7 Reverse -294 -313 2.0644 0.237
NP_440351.1_1 Reverse -119 -138 4.32602 0.0788
NP_440351.1_5 Reverse -181 -200 22.0256 0.00394
NP_440351.1_8 Reverse -151 -169 11.4255 0.162
NP_441408.2_7 Forward -312 -293 -3.14714 0.272
NP_440914.1_1 Forward -310 -300 17.5935 0.000537
NP_440914.1_1 Reverse -301 -311 16.3248 0.00196
NP_441011.1_8 Reverse -302 -311 16.6177 0.00602
NP_441011.1_8 Forward -309 -300 8.25953 0.144
NP_442101.1_10 Forward -304 -285 -12.6852 0.274
NP_442101.1_10 Forward -318 -299 -12.8819 0.279
NP_442533.1_1 Forward -134 -115 -8.06369 0.201
NP_442533.1_6 Forward -310 -301 17.2076 0.00137
NP_442533.1_6 Reverse -301 -310 17.2076 0.00137
NP_442533.1_6 Forward -394 -385 2.26134 0.266
NP_441482.1_7 Forward -316 -302 -2.75368 0.0997
NP_439944.1_9 Forward -309 -299 19.1546 0.00329
NP_439944.1_9 Reverse -302 -312 9.12481 0.1
NP_441028.1_6 Forward -260 -250 7.35439 0.229
NP_441527.1_4 Forward -95 -76 -9.78835 0.262
NP_440115.1_6 Forward -313 -303 14.0414 0.0615
NP_440115.1_6 Reverse -298 -308 9.81313 0.115
NP_440007.1_9 Reverse -297 -311 1.76955 0.285
NP_440007.1_9 Forward -314 -300 0.786239 0.29
NP_441544.1_1 Reverse -222 -234 17.9352 0.196
NP_441602.1_10 Forward -331 -312 20.6481 0.0864
NP_441170.1_4 Reverse -308 -326 2.28076 0.285
NP_441972.1_5 Forward -309 -290 -0.0988766 0.161
NP_441106.1_1 Forward -311 -302 18.486 0.0028
NP_441106.1_1 Reverse -300 -309 9.63616 0.0311
NP_439903.1_6 Forward -313 -294 4.81688 0.189
NP_442588.1_6 Reverse -122 -141 -3.04881 0.296
NP_442588.1_8 Reverse -123 -142 4.62101 0.29
NP_441286.1_1 Forward -311 -299 12.232 0.00999
NP_441286.1_1 Reverse -300 -312 5.93884 0.0258
NP_442674.1_3 Reverse -293 -312 3.73524 0.294
NP_440670.1_8 Forward -310 -301 18.3876 0.000699
NP_440670.1_8 Reverse -301 -310 18.3876 0.000699
NP_440886.1_7 Forward -311 -301 8.04271 0.0805
NP_440886.1_7 Reverse -300 -310 7.94438 0.0805
NP_442072.1_9 Forward -311 -293 -2.43913 0.0317
NP_442072.1_9 Reverse -300 -318 -21.122 0.206
NP_440907.2_8 Forward -309 -299 10.8943 0.0969
NP_440907.2_8 Reverse -302 -312 9.616 0.103
NP_442459.1_2 Reverse -137 -156 12.1925 0.178
NP_441626.1_2 Forward -309 -302 15.7721 0.0124
NP_441626.1_2 Reverse -302 -309 15.7721 0.0124
NP_441460.1_2 Forward -360 -347 19.0949 0.0557
NP_442794.1_1 Reverse -297 -309 3.48056 0.286
NP_442615.1_1 Reverse -292 -310 -6.76569 0.26
NP_441962.1_4 Forward -309 -290 -9.53865 0.218
NP_440387.1_1 Forward -310 -294 -0.826444 0.142
NP_441431.1_2 Forward -313 -299 12.487 0.116
NP_441431.1_2 Reverse -367 -381 9.83206 0.176
NP_441431.1_2 Reverse -112 -126 5.60385 0.294
NP_441993.1_1 Reverse -295 -314 25.8237 0.00157
NP_441993.1_1 Forward -310 -291 14.0314 0.0786
NP_441993.1_1 Reverse -301 -320 2.53143 0.257
NP_440114.1_10 Reverse -301 -315 10.3243 0.148
NP_442090.1_10 Reverse -171 -184 12.999 0.179
NP_442323.1_7 Forward -315 -296 6.29183 0.195
NP_441272.1_4 Reverse -292 -311 8.35759 0.189
NP_440766.1_4 Reverse -297 -311 8.06273 0.0871
NP_441237.1_9 Forward -309 -299 14.9263 0.0242
NP_441246.1_6 Reverse -171 -189 11.4255 0.0609
NP_440457.1_1 Reverse -297 -309 5.34885 0.141
NP_440457.1_1 Forward -314 -302 0.727295 0.25
NP_440457.1_1 Forward -128 -116 0.0389777 0.25
NP_440798.1_6 Reverse -302 -315 10.5407 0.074
NP_440801.1_9 Reverse -90 -104 12.4475 0.288
NP_441984.1_3 Forward -314 -296 15.7521 0.118
NP_441436.1_6 Forward -310 -291 7.37428 0.26
NP_441436.1_8 Reverse -300 -319 7.37428 0.293
NP_442509.1_9 Forward -310 -300 8.14104 0.192
NP_442509.1_9 Reverse -301 -311 8.04271 0.192
NP_440554.1_4 Reverse -302 -312 17.9746 0.0131
NP_440554.1_4 Forward -309 -299 6.37155 0.123
NP_442862.1_1 Forward -382 -363 6.98095 0.297
NP_441885.1_5 Forward -310 -300 20.9245 0.000538
NP_441885.1_5 Reverse -301 -311 11.3864 0.00668
NP_440478.1_4 Forward -314 -295 10.4225 0.282
NP_440649.2_8 Reverse -175 -189 12.586 0.232
NP_442341.1_7 Forward -311 -297 11.8976 0.0502
NP_442341.1_9 Forward -312 -298 11.4053 0.127
NP_441756.1_5 Reverse -297 -316 5.80098 0.183
NP_441173.1_9 Forward -143 -135 11.3271 0.226
NP_441173.1_9 Forward -142 -134 11.3271 0.226
NP_442395.2_4 Forward -138 -119 1.6703 0.235
NP_442395.2_9 Reverse -183 -199 14.1199 0.226
NP_442534.1_7 Reverse -293 -312 6.68596 0.272
NP_440423.1_6 Reverse -293 -312 -11.5053 0.178
NP_440423.1_6 Forward -318 -299 -14.9469 0.229
NP_443000.1_7 Forward -312 -302 20.3345 0.00223
NP_443000.1_7 Reverse -299 -309 10.4031 0.0345
NP_441842.1_10 Reverse -294 -308 6.88276 0.271
NP_440275.1_3 Reverse -299 -309 17.6796 0.0102
NP_440275.1_3 Forward -312 -302 16.1063 0.0155
NP_440560.1_5 Forward -145 -126 14.8245 0.108
NP_440091.1_1 Reverse -297 -309 10.7571 0.0429
NP_441662.1_6 Reverse -76 -89 19.7832 0.116
NP_442451.1_2 Reverse -293 -312 -3.93378 0.2
NP_441122.1_1 Reverse -57 -72 11.1896 0.216
NP_439951.1_3 Forward -342 -325 11.7402 0.242
NP_440175.1_4 Forward -312 -293 -13.2752 0.246
NP_442495.1_5 Reverse -313 -332 11.5042 0.23
NP_441875.1_7 Forward -161 -151 15.418 0.227
NP_441105.1_3 Reverse -290 -309 4.22769 0.081
NP_441105.1_3 Forward -321 -302 -3.14714 0.173
NP_440216.1_1 Reverse -301 -315 24.9757 0.000528
NP_440216.1_1 Forward -310 -296 0.0979218 0.0284
NP_440216.1_9 Forward -232 -223 13.1761 0.205
NP_440172.1_1 Reverse -301 -311 17.5813 0.00421
NP_440172.1_1 Forward -310 -300 15.0247 0.00945
NP_440167.1_3 Reverse -291 -310 12.1925 0.201
NP_442015.1_3 Forward -320 -301 12.1917 0.265
NP_442015.1_10 Forward -314 -301 3.75586 0.178
NP_442015.1_10 Reverse -297 -310 3.65753 0.178
NP_441226.1_7 Forward -309 -302 14.4934 0.0123
NP_441226.1_7 Reverse -302 -309 14.4934 0.0123
NP_441111.1_7 Forward -309 -301 18.7023 0.00294
NP_441111.1_7 Reverse -302 -310 18.7023 0.00294
NP_442379.1_10 Reverse -294 -311 7.80699 0.102
NP_441766.1_2 Forward -310 -301 17.5026 0.00297
NP_441766.1_2 Reverse -301 -310 17.5026 0.00297
NP_442417.1_5 Reverse -301 -315 4.52282 0.292
NP_440416.1_1 Reverse -301 -320 -4.22878 0.128
NP_440416.1_9 Reverse -294 -313 -16.7168 0.22
NP_443052.1_9 Forward -325 -306 -4.03212 0.254
NP_442116.1_6 Reverse -202 -219 5.3042 0.299
NP_440591.1_9 Reverse -294 -312 8.57394 0.18
NP_442154.1_1 Reverse -307 -325 -17.3854 0.254
NP_440261.1_5 Reverse -302 -315 6.60746 0.0318
NP_440261.1_5 Forward -309 -296 -1.06236 0.0655
NP_440261.1_5 Forward -378 -365 -3.12731 0.115
NP_440261.1_5 Reverse -386 -399 -4.9956 0.183
NP_440261.1_7 Reverse -306 -325 -6.98204 0.296
NP_440988.1_10 Reverse -299 -313 5.67333 0.24
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

ACTGGGGCCCATCAACCTTTAACAGTTCGCCCCCAGTTAATTGTCCCTGGCGGATTAATTGATCAATTTGGCTGGCCGCATCCCGCACCAGGCGATCGCCACTGGCGGATTGTTCTCGGTTAAAGCCCACGTAGAGGGTATTTTCCCTCAGGTGCAAATGATAACTAACCATGGGAAGCTAAATCTTTGCTTAGAACCTGTTTATAAAGTCTGATTCTGCCCCCTAAATCCCCCAATACTGGGGGACTTTGACTTAGTTTCCCCCAAAACTTGGGGGGCCAGGGGGGCTTTTCAAACACGCTCTTAGCAAAGGGAATAATCACTATACTCAACAATAGAAAACCAGTTTTTCATGACCTTATAAAGTAGGGTTGGTTCAGCAACAACAATAATTTGCCCC

CDS

ATGGAATCTACGTTTGAATATTCTCCCACAGTCCCTCTACTTTCCCATCTGCTCCAGGGCAAGAGCTTGAAAAATCCCATCAATTTGGGCAAGGCGATACGGCTTTGGGTACTTCTGCGTTGCATCTATGGCCATGAATCTGACCCCATTTACTGCCATCTCAACGAGAGTTTTACCTACCCTGAGTGGCGTGACGCATTCTTCTTAGAACAAAAATTGTTTCATCAAAATTTTAATAGGGATAGTTTAGAACATAGTAATAACCAGTGTCCCTGCCATAAATCTATCCATCAATGGTTATTTGCCGACTATTTAGCAACGGATCAACAACAGTGGTATGAAGATTTTCGGGGAACTTGTTATCTGGCAGAAGATGCTGATATTCAAGGTTTTCTTGATACCTTAAGCTGGGAAAGAAGTAAATCTAATGATGGTAAAAATCGTTTATTTGCCTGTGTTCCTAGGACTATAAATAATAACCTTAAGGAGTTGGTCAAACTGGGTTATTTAGAAAAAATAGGTGATAAATTCCACAAGCTAGAGGAAATTGATTTTAGTTCTCTGGCCCAAAGTAAGCCGGTGGATGCTAACTTTAATTTTCCTAATTTGTCCTATATCCGCCACGAAGATCTCAGTGAAATACCGGATTTATTCCGGGCCACTATGGGCCAGAAACAGCGGTTTTTTATGCACGTTGATTATGTGGTAGCCAAAAGAGATCTAGATAATGATTGGCCCTACCGTTTTCAGCAACTGTGGCAGGAAAATGAGTTTCCCATCCTTAGGCTAGAGTATGACAGCGTAAGTTTACACCGCCTTGTTAAACGCATTACCTATCCGGTCTGCATCTATTATTACCAACGGGCTTTATATCTTTGTGCCTATGGCCAAGATCCCAAAGATAGAAATAAGTTGGATTGGTATAACTATCGCCTTGACCGTATTAAAGCCATGGCCAATTTAGATTGGTCTGATCCAGAAATTCCCTTGCCTTTACAGGAACAATACCAACAACAAAATTTGTTTACTGCTGATTACATTGATACCCAGTTAAGCCGAGGCTTTGGTTTTGATTTTTATAAACCCCTCAAAACCATGGTGCTCCGCTTTAATCAGGATTTTTCTGAGCGGTATATTGACGAAAGTTTCCGCCATGAAACCTTCAAAAAGTTTGACACTGTTCAGCAGTTATCCACTTGGTTAGGGCAACAACAGCTCCAGCCTACTGAAAAGGAACAGTTACAACGGGCAATTAAGCAATGGCAAGCCCAAGGGAAGCAAGAACCAACCCATAGTTATTTCCGCATGGACTATCGCGACCAGGACAATAACGTCATCATGCGTCTGCGAGCTTGGGGACCCAATGTGGAGGTGTTATTTCCCCTGGATTTACGGCAACGGATGGCGTCGGATGTGCAGGCCATGGCAGCCCTTTACTCCCATTAG

Protein

No sequence available