Your browser is old and dusty. Try Google Chrome!

Details for sll7070

ORF sll7070
Accession NP_942358.1
Symbol
Category
Definition
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_441061.1_2 Forward -289 -275 8.65272 0.0856
NP_441061.1_2 Reverse -282 -296 6.98109 0.11
NP_441061.1_8 Forward -126 -107 18.4386 0.0765
NP_440795.1_7 Forward -289 -282 14.6904 0.0123
NP_440795.1_7 Reverse -282 -289 14.6904 0.0123
NP_442100.1_1 Forward -99 -80 8.35512 0.24
NP_441418.1_6 Reverse -281 -300 -0.4922 0.0102
NP_441418.1_6 Forward -290 -271 -11.8986 0.0576
NP_441418.1_6 Reverse -233 -252 -29.7948 0.238
NP_440815.1_5 Reverse -330 -349 3.6377 0.286
NP_442291.1_5 Reverse -280 -296 3.10679 0.114
NP_441453.1_4 Reverse -281 -289 16.539 0.00633
NP_441453.1_4 Forward -290 -282 16.539 0.00633
NP_442151.1_6 Forward -290 -276 15.6342 0.0221
NP_441818.1_1 Forward -289 -278 13.1362 0.0861
NP_441818.1_1 Reverse -282 -293 9.69459 0.232
NP_441818.1_9 Reverse -334 -353 -10.817 0.299
NP_440226.1_1 Forward -290 -271 13.2741 0.0374
NP_440226.1_1 Reverse -281 -300 12.6841 0.0422
NP_441630.1_3 Reverse -273 -292 7.27595 0.122
NP_441630.1_3 Forward -347 -328 3.53937 0.19
NP_440931.1_5 Forward -389 -370 17.2074 0.192
NP_441976.1_2 Reverse -367 -386 11.3067 0.295
NP_443002.1_5 Forward -339 -321 9.35981 0.295
NP_442173.1_1 Forward -289 -281 15.4574 0.00633
NP_442173.1_1 Reverse -282 -290 15.4574 0.00633
NP_442752.1_4 Forward -290 -283 13.8055 0.0199
NP_442752.1_4 Reverse -281 -288 13.8055 0.0199
NP_442752.1_4 Forward -386 -379 7.90559 0.144
NP_442752.1_4 Reverse -233 -240 6.23397 0.161
NP_442752.1_4 Forward -381 -374 5.44732 0.202
NP_443027.1_4 Forward -292 -282 14.828 0.0437
NP_443027.1_4 Reverse -279 -289 13.1564 0.0521
NP_443027.1_4 Forward -244 -234 6.37155 0.283
NP_441812.1_3 Reverse -280 -294 17.8958 0.0479
NP_442975.1_10 Forward -294 -280 22.32 0.000414
NP_442975.1_10 Reverse -277 -291 2.75226 0.269
NP_441675.1_4 Forward -324 -305 2.26107 0.294
NP_440784.1_7 Forward -289 -282 15.9687 0.0123
NP_440784.1_7 Reverse -282 -289 15.9687 0.0123
NP_440061.1_9 Forward -292 -278 16.9119 0.0201
NP_440061.1_9 Reverse -375 -389 9.73373 0.14
NP_441054.1_2 Forward -389 -370 13.2741 0.203
NP_442062.1_3 Reverse -79 -98 4.22769 0.198
NP_442062.1_8 Reverse -281 -291 19.4496 0.000558
NP_442062.1_8 Forward -290 -280 17.3846 0.00193
NP_442062.1_8 Reverse -305 -315 5.87989 0.149
NP_442062.1_8 Forward -381 -371 4.69992 0.201
NP_440761.1_4 Reverse -228 -247 -14.5535 0.265
NP_441859.1_3 Forward -291 -272 12.6833 0.0928
NP_441859.1_3 Reverse -280 -299 5.70185 0.192
NP_440304.1_4 Forward -292 -282 10.8948 0.051
NP_440304.1_4 Reverse -279 -289 9.91146 0.051
NP_440304.1_4 Forward -244 -234 7.84651 0.099
NP_442242.1_4 Forward -289 -282 14.3954 0.0124
NP_442242.1_4 Reverse -282 -289 14.3954 0.0124
NP_440044.1_8 Reverse -282 -301 -2.16383 0.261
NP_441208.1_9 Reverse -359 -373 8.65272 0.219
NP_441208.1_9 Reverse -278 -292 5.40779 0.267
NP_440132.1_1 Forward -388 -370 18.8987 0.0313
NP_440132.1_1 Reverse -231 -249 15.8504 0.0953
NP_442110.1_7 Forward -290 -276 -0.492064 0.291
NP_442726.1_7 Reverse -274 -292 -1.35749 0.294
NP_441772.1_6 Reverse -304 -323 10.4225 0.251
NP_440273.1_1 Forward -99 -80 13.5117 0.243
NP_441083.1_5 Forward -290 -280 20.3345 0.00053
NP_441083.1_5 Reverse -281 -291 11.3864 0.0159
NP_441083.1_5 Reverse -233 -243 -1.10161 0.295
NP_442827.1_7 Reverse -303 -321 18.8004 0.235
NP_442827.1_8 Reverse -273 -292 11.6017 0.0516
NP_441434.1_1 Reverse -26 -40 7.26901 0.287
NP_441434.1_7 Forward -288 -274 4.22782 0.225
NP_441738.1_2 Forward -288 -281 15.28 0.0102
NP_441738.1_2 Reverse -283 -290 15.28 0.0102
NP_441738.1_2 Reverse -374 -381 10.2652 0.101
NP_441558.1_5 Forward -292 -273 13.6675 0.0561
NP_440209.1_1 Reverse -281 -289 18.1123 0.00295
NP_440209.1_1 Forward -290 -282 18.1123 0.00295
NP_440209.1_1 Forward -242 -234 5.0343 0.194
NP_442889.1_8 Forward -293 -279 13.4703 0.0588
NP_441713.1_1 Reverse -227 -246 -13.0786 0.252
NP_440178.1_5 Reverse -287 -296 18.6826 0.137
NP_440178.1_7 Forward -291 -272 -21.3384 0.218
NP_440178.1_7 Reverse -280 -299 -22.0267 0.249
NP_441792.1_5 Reverse -372 -388 10.3833 0.226
NP_441716.1_1 Reverse -215 -229 5.89945 0.211
NP_441327.1_1 Reverse -79 -98 8.53829 0.211
NP_440906.1_5 Forward -289 -282 15.8704 0.0124
NP_440906.1_5 Reverse -282 -289 15.8704 0.0124
NP_440747.1_10 Reverse -278 -290 7.4138 0.00422
NP_440747.1_10 Forward -293 -281 -2.02597 0.0196
NP_440747.1_10 Forward -245 -233 -11.8591 0.161
NP_441130.1_10 Forward -292 -278 11.2093 0.107
NP_441130.1_10 Reverse -279 -293 8.16106 0.14
NP_441486.1_1 Forward -293 -279 13.1759 0.00897
NP_441486.1_1 Reverse -278 -292 2.65453 0.079
NP_442634.1_4 Forward -388 -374 2.16287 0.144
NP_442634.1_4 Reverse -231 -245 -3.44199 0.161
NP_442634.1_4 Reverse -279 -293 -3.63866 0.161
NP_440470.1_5 Reverse -80 -99 7.4002 0.278
NP_440842.1_4 Reverse -89 -108 3.44851 0.207
NP_441695.1_4 Reverse -373 -391 15.9488 0.152
NP_441014.1_10 Reverse -280 -299 10.1267 0.122
NP_442848.1_1 Reverse -275 -289 -2.75368 0.263
NP_442848.1_1 Forward -296 -282 -2.95034 0.263
NP_442848.1_5 Reverse -177 -195 -3.71743 0.297
NP_443018.1_3 Forward -289 -282 14.8871 0.0123
NP_443018.1_3 Reverse -282 -289 14.8871 0.0123
NP_441316.1_7 Forward -292 -277 -3.26502 0.273
NP_441634.1_8 Reverse -279 -293 5.21113 0.114
NP_440376.1_1 Forward -290 -281 19.4693 0.000692
NP_440376.1_1 Reverse -281 -290 19.4693 0.000692
NP_440376.1_1 Reverse -233 -242 0.29472 0.281
NP_440376.1_1 Forward -381 -372 -0.0986038 0.285
NP_440376.1_1 Forward -242 -233 -0.196935 0.285
NP_441588.1_4 Reverse -283 -293 6.96153 0.178
NP_441588.1_4 Forward -288 -278 6.37155 0.2
NP_442687.1_7 Forward -291 -281 15.8113 0.0125
NP_442687.1_7 Reverse -280 -290 8.92815 0.0994
NP_441077.1_6 Forward -102 -86 6.27251 0.242
NP_442485.1_3 Reverse -366 -385 -2.55715 0.262
NP_441846.1_10 Forward -396 -377 -19.4701 0.256
NP_441846.1_10 Forward -397 -378 -22.6167 0.264
NP_441846.1_10 Forward -395 -376 -23.5016 0.289
NP_442770.1_10 Reverse -110 -124 19.5875 0.0525
NP_441422.1_7 Forward -292 -275 -1.14113 0.181
NP_441422.1_7 Reverse -370 -387 -6.25434 0.248
NP_440667.1_2 Reverse -328 -347 -8.65367 0.29
NP_440550.1_5 Forward -289 -270 17.109 0.188
NP_441950.1_7 Forward -389 -370 -7.76869 0.283
NP_442296.1_9 Reverse -282 -301 -3.3438 0.249
NP_442658.1_1 Forward -292 -282 15.9091 0.00966
NP_442658.1_1 Reverse -279 -289 9.616 0.147
NP_440662.1_2 Forward -354 -335 4.916 0.133
NP_440656.1_8 Forward -301 -282 -8.26035 0.273
NP_442953.1_2 Forward -103 -84 20.5781 0.0931
NP_441414.1_9 Reverse -281 -300 -7.17871 0.212
NP_441414.1_9 Forward -290 -271 -10.522 0.287
NP_441256.1_8 Forward -387 -368 8.45592 0.228
NP_442937.1_5 Reverse -276 -295 19.3707 0.0204
NP_442937.1_5 Forward -191 -172 8.55425 0.219
NP_442937.1_5 Forward -295 -276 6.29264 0.282
NP_442321.1_4 Reverse -351 -370 -6.09707 0.284
NP_442321.1_4 Reverse -339 -358 -8.45701 0.289
NP_442321.1_9 Reverse -12 -31 13.8641 0.265
NP_441317.1_4 Reverse -51 -65 14.0475 0.161
NP_441958.1_5 Forward -291 -281 12.2714 0.00183
NP_441958.1_5 Reverse -280 -290 12.2714 0.00183
NP_441958.1_5 Forward -243 -233 1.55333 0.095
NP_441958.1_5 Forward -382 -372 -1.88825 0.26
NP_441958.1_5 Reverse -232 -242 -6.90313 0.293
NP_440203.1_5 Forward -312 -302 12.1726 0.164
NP_440203.1_5 Reverse -374 -384 9.12434 0.271
NP_442816.1_7 Reverse -86 -105 3.48503 0.298
NP_439905.1_1 Forward -289 -276 7.39411 0.262
NP_440984.1_7 Reverse -276 -290 8.84938 0.134
NP_442690.1_1 Forward -130 -111 -0.590531 0.126
NP_442690.1_1 Reverse -90 -109 -3.3438 0.142
NP_442690.1_1 Reverse -109 -128 -8.26035 0.185
NP_442690.1_1 Reverse -80 -99 -12.3902 0.242
NP_442911.1_1 Reverse -89 -102 17.4413 0.159
NP_442911.1_2 Reverse -271 -290 0.392778 0.0675
NP_442911.1_2 Forward -300 -281 0.196116 0.069
NP_442571.1_9 Forward -219 -200 10.6192 0.277
NP_443055.1_6 Reverse -273 -291 20.1762 0.0417
NP_443055.1_6 Forward -298 -280 -1.45654 0.279
NP_442236.1_3 Forward -167 -148 10.5209 0.2
NP_440993.1_2 Forward -295 -279 6.05672 0.233
NP_440602.1_8 Reverse -281 -295 15.9292 0.115
NP_441099.1_5 Reverse -271 -290 -5.31042 0.151
NP_441099.1_5 Forward -300 -281 -12.1936 0.296
NP_442002.1_9 Forward -291 -284 10.7572 0.185
NP_441654.1_6 Reverse -80 -98 13.9438 0.296
NP_440809.1_9 Forward -299 -281 -7.84733 0.225
NP_441294.1_7 Forward -294 -280 16.6418 0.0133
NP_441646.1_1 Forward -267 -248 2.85105 0.211
NP_442438.1_10 Reverse -276 -290 3.73617 0.157
NP_442438.1_10 Forward -295 -281 1.76955 0.188
NP_442431.1_10 Forward -392 -374 2.37909 0.238
NP_441000.1_6 Reverse -280 -294 5.01447 0.0933
NP_441000.1_6 Forward -291 -277 -5.31028 0.273
NP_442771.1_1 Forward -292 -274 -6.86402 0.169
NP_441110.1_7 Forward -386 -367 23.3039 0.048
NP_440147.1_4 Forward -292 -279 12.8023 0.0326
NP_440147.1_4 Reverse -279 -292 0.805932 0.244
NP_441550.1_8 Reverse -279 -289 16.7941 0.00906
NP_441550.1_8 Forward -292 -282 6.0761 0.214
NP_441916.1_7 Reverse -281 -291 18.4663 0.00144
NP_441916.1_7 Forward -290 -280 10.3048 0.0261
NP_441916.1_7 Forward -242 -232 5.38824 0.134
NP_441041.1_4 Reverse -281 -300 -0.39387 0.0954
NP_441041.1_7 Forward -293 -281 10.916 0.0864
NP_441041.1_7 Reverse -230 -242 7.22324 0.171
NP_441041.1_9 Reverse -310 -324 18.8785 0.185
NP_442996.1_1 Reverse -81 -100 8.35512 0.21
NP_441725.1_5 Reverse -282 -292 11.2881 0.0247
NP_441725.1_5 Forward -289 -279 9.02648 0.0553
NP_439966.1_7 Forward -292 -282 18.4657 0.00473
NP_439966.1_7 Reverse -279 -289 14.8275 0.0177
NP_439966.1_9 Forward -213 -204 4.42462 0.253
NP_439966.1_9 Reverse -231 -240 1.1797 0.253
NP_439966.1_9 Forward -292 -283 0.983037 0.253
NP_439966.1_9 Reverse -279 -288 0.884706 0.253
NP_442941.1_3 Reverse -282 -292 11.4848 0.0116
NP_442941.1_3 Forward -289 -279 10.9931 0.0116
NP_442941.1_3 Reverse -234 -244 0.766681 0.171
NP_440289.1_2 Forward -293 -280 21.3571 0.00262
NP_440289.1_2 Reverse -230 -243 0.314277 0.168
NP_440289.1_2 Reverse -278 -291 -4.60227 0.29
NP_440260.1_8 Reverse -272 -290 -4.8974 0.273
NP_442281.1_1 Forward -295 -281 20.7467 0.00192
NP_442281.1_1 Reverse -276 -290 5.30886 0.163
NP_441079.1_7 Reverse -25 -44 6.29183 0.136
NP_441079.1_7 Reverse -81 -100 -0.984623 0.2
NP_442256.1_2 Reverse -279 -297 -0.964162 0.155
NP_440437.1_1 Forward -296 -277 1.86774 0.143
NP_440437.1_1 Forward -248 -229 -5.70374 0.292
NP_441556.1_4 Forward -299 -280 12.8009 0.204
NP_441556.1_6 Forward -133 -115 20.9016 0.177
NP_440498.1_1 Forward -251 -233 12.7038 0.0583
NP_440498.1_1 Forward -299 -281 6.80398 0.0845
NP_441644.1_6 Forward -290 -280 17.3841 0.00127
NP_441644.1_6 Reverse -281 -291 10.1076 0.0628
NP_442215.1_2 Reverse -279 -295 -4.95634 0.242
NP_440253.1_2 Reverse -281 -299 17.1287 0.0115
NP_440253.1_2 Forward -290 -272 11.8189 0.0302
NP_440929.1_8 Forward -290 -281 19.2726 0.000701
NP_440929.1_8 Reverse -281 -290 19.2726 0.000701
NP_440780.1_1 Forward -103 -84 13.0342 0.234
NP_442933.1_10 Forward -290 -281 17.601 0.00325
NP_442933.1_10 Reverse -281 -290 17.601 0.00325
NP_442933.1_10 Forward -242 -233 5.3096 0.203
NP_441751.2_8 Reverse -234 -248 -2.06536 0.132
NP_441751.2_8 Reverse -282 -296 -2.55701 0.132
NP_441751.2_8 Forward -289 -275 -4.32697 0.17
NP_442554.1_8 Forward -289 -279 18.0729 0.00543
NP_442554.1_8 Reverse -282 -292 13.8447 0.0145
NP_442554.1_8 Reverse -234 -244 4.89658 0.168
NP_442970.1_3 Reverse -81 -99 13.6192 0.197
NP_441762.1_7 Forward -291 -279 11.8387 0.0142
NP_441762.1_7 Reverse -280 -292 2.89058 0.0676
NP_441762.1_7 Forward -243 -231 -7.13918 0.285
NP_442142.1_4 Forward -293 -280 15.85 0.0264
NP_442142.1_4 Reverse -278 -291 6.80355 0.154
NP_442292.1_1 Forward -289 -280 18.486 0.00229
NP_442292.1_1 Reverse -282 -291 9.63616 0.0183
NP_442292.1_1 Reverse -234 -243 5.70292 0.135
NP_442476.1_6 Forward -289 -275 2.94952 0.169
NP_442381.1_8 Forward -293 -274 3.73603 0.0708
NP_442381.1_8 Reverse -278 -297 -14.8485 0.288
NP_441711.1_4 Reverse -272 -291 15.0441 0.05
NP_443009.1_5 Reverse -280 -291 18.3477 0.00265
NP_441865.1_3 Forward -220 -202 12.5072 0.287
NP_441715.1_4 Reverse -282 -292 16.303 0.0117
NP_441715.1_4 Forward -289 -279 7.84651 0.107
NP_440730.1_4 Forward -275 -256 -2.55715 0.294
NP_441613.1_6 Forward -348 -329 18.3865 0.183
NP_440379.1_5 Forward -228 -209 -8.26035 0.25
NP_440379.1_5 Forward -390 -371 -11.2103 0.291
NP_441468.1_1 Forward -289 -282 15.8704 0.0124
NP_441468.1_1 Reverse -282 -289 15.8704 0.0124
NP_441020.2_6 Reverse -279 -296 18.7217 0.0111
NP_441020.2_6 Forward -292 -275 10.8552 0.133
NP_441020.2_6 Reverse -231 -248 6.82368 0.251
NP_441020.2_6 Forward -227 -210 5.64371 0.293
NP_441673.1_1 Forward -290 -281 20.8459 0.000698
NP_441673.1_1 Reverse -281 -290 20.8459 0.000698
NP_441673.1_1 Reverse -233 -242 1.37636 0.114
NP_441673.1_1 Forward -242 -233 1.1797 0.163
NP_441244.1_1 Reverse -76 -94 14.0805 0.255
NP_441244.1_8 Forward -392 -373 3.73603 0.153
NP_441826.1_2 Forward -296 -282 1.27789 0.157
NP_442490.1_9 Reverse -269 -288 -8.06369 0.282
NP_441764.1_4 Forward -108 -91 21.5361 0.015
NP_441764.1_4 Reverse -87 -104 11.8915 0.204
NP_441764.1_8 Forward -103 -93 14.1818 0.284
NP_442868.1_6 Reverse -279 -289 17.4829 0.012
NP_442868.1_6 Forward -292 -282 0.963343 0.205
NP_442719.1_2 Reverse -363 -381 -5.58642 0.219
NP_441612.1_2 Forward -290 -280 8.54929 0.21
NP_443058.1_7 Reverse -280 -299 5.60432 0.237
NP_442361.1_3 Forward -296 -283 7.88576 0.285
NP_442808.1_1 Forward -291 -281 18.4657 0.00201
NP_442808.1_1 Reverse -280 -290 8.63269 0.0481
NP_442808.1_1 Reverse -385 -395 4.99446 0.178
NP_442808.1_1 Reverse -370 -380 1.84789 0.281
NP_440145.1_4 Reverse -373 -383 14.9258 0.231
NP_441906.1_5 Reverse -370 -389 15.5349 0.157
NP_442542.1_2 Reverse -279 -292 4.54251 0.3
NP_442050.1_5 Reverse -279 -289 15.6142 0.01
NP_442050.1_5 Forward -292 -282 9.12434 0.193
NP_442050.1_6 Reverse -359 -378 18.584 0.203
NP_442903.1_2 Forward -61 -42 10.8379 0.165
NP_442739.1_2 Reverse -83 -102 16.0358 0.246
NP_441114.1_3 Reverse -388 -397 17.1093 0.113
NP_442789.1_4 Reverse -331 -350 5.01433 0.148
NP_441518.1_3 Forward -300 -281 2.0644 0.0598
NP_441518.1_3 Reverse -271 -290 -4.22878 0.12
NP_441878.1_6 Forward -291 -281 10.4031 0.0176
NP_441878.1_6 Reverse -280 -290 10.4031 0.0176
NP_441878.1_6 Forward -225 -215 -7.49312 0.231
NP_441036.1_8 Forward -291 -281 17.7779 0.000554
NP_441036.1_8 Reverse -232 -242 15.2213 0.0116
NP_441036.1_8 Reverse -280 -290 8.33817 0.174
NP_441557.1_5 Forward -290 -281 19.9609 0.000699
NP_441557.1_5 Reverse -281 -290 19.9609 0.000699
NP_441557.1_5 Reverse -233 -242 0.491382 0.144
NP_441557.1_5 Forward -242 -233 0.29472 0.174
NP_441445.1_1 Reverse -272 -291 10.2259 0.0968
NP_441445.1_1 Forward -299 -280 6.09597 0.156
NP_441445.1_1 Forward -195 -176 5.80098 0.163
NP_442066.2_9 Reverse -229 -242 12.6056 0.154
NP_442066.2_9 Reverse -277 -290 10.344 0.154
NP_442419.1_2 Reverse -276 -295 7.07928 0.144
NP_440738.1_5 Reverse -191 -210 2.0644 0.289
NP_441308.1_8 Forward -292 -282 10.1081 0.22
NP_441458.1_8 Forward -101 -82 2.29213 0.295
NP_442183.1_1 Reverse -281 -295 19.4691 0.00583
NP_442183.1_1 Forward -290 -276 14.2576 0.0347
NP_442183.1_1 Reverse -233 -247 4.32615 0.266
NP_441819.1_2 Reverse -105 -124 17.6178 0.267
NP_441574.1_1 Reverse -269 -288 -0.4922 0.206
NP_441574.1_1 Reverse -281 -300 -5.40875 0.26
NP_442347.1_2 Forward -289 -280 12.4878 0.056
NP_442347.1_2 Reverse -282 -291 11.1111 0.056
NP_442347.1_2 Forward -241 -232 4.42462 0.284
NP_442645.1_2 Reverse -273 -292 -20.4534 0.288
NP_441037.1_4 Reverse -279 -289 9.55921 0.21
NP_441037.1_4 Forward -292 -282 7.02532 0.237
NP_442594.1_8 Forward -389 -370 9.93088 0.185
NP_442594.1_8 Forward -397 -378 3.04771 0.289
NP_441633.1_3 Forward -292 -279 6.01747 0.0481
NP_441633.1_3 Forward -360 -347 4.34585 0.0699
NP_441633.1_3 Reverse -279 -292 1.29759 0.109
NP_440136.1_2 Forward -289 -282 15.9687 0.0123
NP_440136.1_2 Reverse -282 -289 15.9687 0.0123
NP_442998.1_10 Forward -288 -281 15.5754 0.0102
NP_442998.1_10 Reverse -283 -290 15.5754 0.0102
NP_442998.1_10 Forward -240 -233 5.74231 0.255
NP_440899.1_8 Reverse -51 -70 -6.78538 0.235
NP_440299.1_1 Reverse -277 -290 12.605 0.0362
NP_440299.1_1 Forward -294 -281 2.28034 0.292
NP_441799.1_1 Reverse -277 -291 12.8803 0.0385
NP_441799.1_1 Forward -294 -280 8.75042 0.106
NP_441007.1_10 Reverse -276 -289 10.934 0.0646
NP_440256.1_1 Reverse -278 -297 4.22769 0.0459
NP_440256.1_1 Forward -293 -274 -3.73712 0.138
NP_441559.1_8 Reverse -382 -396 5.50613 0.0905
NP_441559.1_8 Reverse -367 -381 -4.4253 0.223
NP_440915.1_5 Reverse -279 -298 15.2009 0.283
NP_440915.1_6 Reverse -277 -291 3.53951 0.101
NP_440915.1_6 Reverse -229 -243 -2.95034 0.287
NP_440915.1_6 Forward -294 -280 -3.147 0.29
NP_441704.1_8 Reverse -270 -289 18.1898 0.0666
NP_441464.1_1 Reverse -373 -392 6.29264 0.297
NP_441464.1_8 Forward -290 -276 9.5377 0.189
NP_441464.1_10 Forward -166 -152 7.9644 0.287
NP_440306.1_8 Reverse -311 -330 -3.24622 0.281
NP_441939.1_3 Forward -289 -270 8.06259 0.184
NP_441199.1_6 Forward -294 -275 5.30933 0.153
NP_442993.1_1 Reverse -281 -297 1.73016 0.0502
NP_442993.1_1 Forward -242 -226 -10.1679 0.21
NP_440677.1_1 Forward -299 -280 6.39097 0.273
NP_442386.1_9 Forward -291 -282 15.7322 0.0144
NP_442386.1_9 Reverse -280 -289 13.8639 0.0289
NP_442386.1_9 Reverse -371 -380 6.39082 0.219
NP_441340.1_5 Forward -289 -282 15.6737 0.0124
NP_441340.1_5 Reverse -282 -289 15.6737 0.0124
NP_441340.1_9 Forward -103 -93 10.7618 0.236
NP_441947.1_4 Forward -353 -334 12.2908 0.234
NP_440168.1_9 Forward -388 -369 -4.81876 0.296
NP_440161.1_3 Reverse -279 -298 14.4541 0.121
NP_440586.1_8 Forward -289 -282 13.2151 0.026
NP_440586.1_8 Reverse -282 -289 13.2151 0.026
NP_442251.1_6 Forward -289 -282 15.2804 0.0124
NP_442251.1_6 Reverse -282 -289 15.2804 0.0124
NP_440684.1_9 Forward -296 -282 8.94771 0.221
NP_441262.1_3 Reverse -281 -288 14.7888 0.0223
NP_441262.1_3 Forward -290 -283 14.7888 0.0223
NP_443051.1_1 Reverse -280 -289 10.4228 0.00754
NP_443051.1_1 Forward -291 -282 10.4228 0.00754
NP_443051.1_1 Forward -243 -234 -0.0986038 0.256
NP_441232.1_10 Forward -301 -282 1.0811 0.289
NP_439984.1_8 Forward -133 -115 18.6037 0.265
NP_439937.1_9 Forward -340 -323 -8.22161 0.176
NP_440408.1_7 Forward -266 -247 8.94757 0.265
NP_440439.1_1 Reverse -278 -291 1.29759 0.157
NP_440439.1_1 Forward -293 -280 1.19926 0.159
NP_440439.1_1 Forward -384 -371 -0.177378 0.209
NP_440372.1_2 Forward -289 -282 16.3621 0.0124
NP_440372.1_2 Reverse -282 -289 16.3621 0.0124
NP_440770.1_3 Forward -211 -197 14.8476 0.261
NP_441789.1_7 Reverse -378 -397 2.55527 0.228
NP_441789.1_7 Reverse -370 -389 -1.96793 0.257
NP_440819.1_5 Forward -261 -253 7.98423 0.228
NP_440316.1_10 Forward -396 -386 7.15819 0.251
NP_439977.1_5 Forward -364 -345 -1.57384 0.256
NP_440139.1_1 Forward -296 -277 3.14526 0.214
NP_441572.1_1 Reverse -279 -298 6.39097 0.12
NP_440267.1_2 Forward -295 -281 9.43874 0.156
NP_440267.1_2 Forward -247 -233 6.78381 0.221
NP_440267.1_2 Reverse -210 -224 5.99717 0.248
NP_442384.1_10 Forward -224 -211 4.64084 0.151
NP_442384.1_10 Forward -290 -277 2.67422 0.216
NP_440472.1_1 Reverse -256 -275 10.4217 0.265
NP_442114.1_8 Reverse -191 -205 8.3571 0.234
NP_441877.1_7 Forward -295 -276 7.27514 0.218
NP_442262.1_10 Forward -289 -282 14.1988 0.0123
NP_442262.1_10 Reverse -282 -289 14.1988 0.0123
NP_442262.1_10 Reverse -234 -241 9.38056 0.202
NP_441689.1_5 Forward -292 -282 8.53436 0.132
NP_441689.1_5 Reverse -279 -289 5.87944 0.197
NP_441689.1_5 Forward -244 -234 5.68278 0.215
NP_440163.1_10 Forward -293 -283 15.2213 0.0762
NP_440344.1_10 Forward -297 -280 18.7217 0.00244
NP_440344.1_10 Reverse -274 -291 -3.99273 0.09
NP_440344.1_10 Reverse -380 -397 -11.6625 0.223
NP_440344.1_10 Reverse -323 -340 -12.5475 0.257
NP_440282.1_10 Forward -300 -281 -7.17871 0.251
NP_442123.1_3 Reverse -281 -300 16.2241 0.0904
NP_442123.1_3 Forward -290 -271 11.1109 0.258
NP_441335.1_8 Forward -398 -379 7.96426 0.264
NP_442126.1_9 Forward -389 -370 9.73422 0.227
NP_441640.1_8 Reverse -288 -307 -4.72043 0.266
NP_440297.1_9 Reverse -282 -292 9.32148 0.0917
NP_440297.1_9 Forward -289 -279 -0.216628 0.282
NP_440350.1_2 Reverse -280 -299 12.0942 0.184
NP_440350.1_5 Reverse -48 -67 1.27776 0.158
NP_440350.1_5 Reverse -42 -61 -7.08038 0.299
NP_441896.1_3 Reverse -272 -291 6.4893 0.102
NP_441896.1_3 Forward -367 -348 -2.55715 0.284
NP_441894.1_1 Forward -237 -218 -5.01543 0.258
NP_442067.1_4 Reverse -375 -394 13.8641 0.0813
NP_440999.1_9 Forward -294 -280 4.62115 0.116
NP_440999.1_9 Reverse -229 -243 0.589577 0.18
NP_440999.1_9 Forward -362 -348 -2.06536 0.257
NP_440888.1_2 Forward -290 -276 17.7968 0.00308
NP_440888.1_2 Reverse -281 -295 14.5519 0.0168
NP_440888.1_2 Reverse -362 -376 6.88214 0.217
NP_440888.1_2 Reverse -251 -265 6.29216 0.241
NP_440491.1_1 Forward -293 -274 8.0865 0.251
NP_442948.1_2 Reverse -280 -299 4.81767 0.258
NP_442948.1_2 Reverse -232 -251 3.53937 0.283
NP_442277.1_4 Reverse -206 -225 4.62021 0.189
NP_442277.1_7 Forward -68 -52 9.26952 0.175
NP_442033.1_10 Reverse -360 -379 -10.9153 0.245
NP_440575.1_1 Forward -344 -325 -3.44288 0.294
NP_441543.1_2 Reverse -282 -291 18.486 0.00236
NP_441543.1_2 Forward -289 -280 16.9127 0.00359
NP_441543.1_2 Reverse -234 -243 4.32629 0.26
NP_442845.1_2 Forward -387 -373 8.35772 0.195
NP_442845.1_2 Reverse -275 -289 6.78443 0.202
NP_441304.1_10 Reverse -358 -367 13.5694 0.239
NP_440982.1_1 Reverse -372 -391 4.12856 0.294
NP_442710.1_7 Forward -99 -80 8.63537 0.0963
NP_442710.1_7 Reverse -82 -101 8.53926 0.0963
NP_441469.1_8 Forward -291 -282 16.126 0.00797
NP_441469.1_8 Reverse -280 -289 6.48957 0.227
NP_442315.1_1 Forward -391 -373 3.55906 0.287
NP_443064.1_6 Forward -290 -280 12.5669 0.0796
NP_442578.1_7 Forward -289 -282 14.5921 0.026
NP_442578.1_7 Reverse -282 -289 14.5921 0.026
NP_440710.1_1 Reverse -207 -225 -7.65067 0.241
NP_441462.1_2 Forward -290 -280 11.5831 0.00406
NP_441462.1_2 Reverse -281 -291 11.5831 0.00406
NP_441462.1_2 Reverse -233 -243 1.16001 0.0976
NP_441462.1_4 Reverse -369 -388 -4.81876 0.279
NP_441621.1_7 Forward -292 -278 -3.147 0.188
NP_441621.1_7 Reverse -279 -293 -3.44199 0.188
NP_441621.1_7 Reverse -231 -245 -5.50694 0.254
NP_443062.1_1 Reverse -281 -299 18.3942 0.0224
NP_443062.1_6 Forward -298 -279 5.11266 0.209
NP_441560.1_8 Reverse -276 -295 13.1683 0.229
NP_441560.1_10 Forward -298 -279 5.11266 0.298
NP_440516.1_8 Forward -290 -281 16.9127 0.00442
NP_440516.1_8 Reverse -281 -290 16.9127 0.00442
NP_441785.1_1 Reverse -281 -295 14.3866 0.161
NP_441033.1_2 Forward -300 -281 -8.55534 0.293
NP_442428.1_5 Forward -289 -282 15.8704 0.0124
NP_442428.1_5 Reverse -282 -289 15.8704 0.0124
NP_441353.1_4 Reverse -328 -347 23.9922 0.0174
NP_440603.1_3 Forward -245 -226 11.4058 0.265
NP_440673.1_3 Forward -288 -281 12.4288 0.0426
NP_440673.1_3 Reverse -283 -290 12.4288 0.0426
NP_441052.1_2 Forward -290 -280 19.9412 0.00106
NP_441052.1_2 Reverse -281 -291 10.5014 0.0285
NP_442219.1_8 Reverse -271 -290 17.0574 0.0758
NP_442219.1_8 Forward -294 -275 6.23444 0.3
NP_442219.1_9 Forward -289 -280 17.7976 0.00718
NP_442219.1_9 Reverse -282 -291 8.35786 0.0681
NP_440436.1_4 Reverse -282 -291 18.1905 0.00233
NP_440436.1_4 Forward -289 -280 17.2072 0.00233
NP_441884.1_9 Forward -293 -274 -2.75381 0.0594
NP_440648.1_1 Forward -290 -271 3.14605 0.262
NP_441719.1_4 Forward -289 -282 16.3621 0.0124
NP_441719.1_4 Reverse -282 -289 16.3621 0.0124
NP_441719.1_4 Reverse -234 -241 3.77569 0.285
NP_441733.1_10 Reverse -278 -291 16.9322 0.0382
NP_441733.1_10 Forward -384 -371 4.24752 0.27
NP_441004.1_5 Forward -399 -385 7.07942 0.292
NP_442366.1_3 Reverse -280 -298 5.32902 0.0878
NP_442139.1_7 Forward -391 -372 10.8159 0.198
NP_440129.1_10 Forward -297 -283 13.2743 0.0557
NP_442873.1_9 Reverse -271 -290 5.01354 0.278
NP_440296.1_10 Reverse -327 -346 -14.3569 0.269
NP_442694.1_4 Forward -210 -201 15.536 0.164
NP_442694.1_4 Forward -380 -371 11.1111 0.279
NP_442206.1_10 Forward -386 -371 6.56807 0.178
NP_440094.1_9 Reverse -280 -299 0.196116 0.199
NP_443054.1_2 Reverse -279 -293 3.34284 0.24
NP_443054.1_2 Forward -292 -278 3.14618 0.24
NP_443054.1_2 Forward -244 -230 2.94952 0.24
NP_443054.1_2 Reverse -214 -228 2.2612 0.245
NP_442308.1_4 Forward -352 -333 12.4875 0.267
NP_442308.1_4 Reverse -260 -279 4.03102 0.267
NP_441851.1_9 Forward -393 -374 8.35759 0.267
NP_441851.1_10 Forward -291 -281 16.008 0.00552
NP_441851.1_10 Reverse -280 -290 15.8113 0.00552
NP_442622.1_5 Reverse -231 -250 -3.83545 0.187
NP_442622.1_8 Reverse -330 -348 -19.0571 0.296
NP_442515.1_1 Forward -291 -277 12.586 0.0337
NP_442515.1_1 Reverse -280 -294 2.75286 0.13
NP_441683.1_7 Forward -396 -377 -7.76869 0.284
NP_442709.1_4 Forward -101 -82 7.69039 0.163
NP_442689.1_8 Forward -126 -109 8.39697 0.138
NP_442689.1_8 Reverse -113 -130 -1.92778 0.225
NP_441349.1_10 Forward -300 -281 -8.35868 0.274
NP_441349.1_10 Forward -252 -233 -9.14533 0.284
NP_440874.1_2 Reverse -39 -58 10.2683 0.288
NP_440432.1_9 Forward -289 -274 10.2063 0.0419
NP_440432.1_9 Reverse -282 -297 0.471552 0.159
NP_442843.1_1 Reverse -331 -350 5.50599 0.144
NP_442843.1_1 Forward -389 -370 -11.2103 0.286
NP_440474.1_8 Reverse -282 -296 14.7486 0.0595
NP_440474.1_8 Forward -289 -275 9.04542 0.168
NP_440474.1_8 Forward -241 -227 4.8172 0.266
NP_440933.1_6 Forward -302 -283 9.83255 0.127
NP_440431.1_4 Forward -65 -46 -4.34531 0.224
NP_440431.1_4 Forward -103 -84 -8.83343 0.275
NP_442450.1_3 Reverse -110 -128 6.99988 0.214
NP_442450.1_5 Forward -292 -282 9.32148 0.115
NP_440040.1_8 Reverse -65 -84 3.77151 0.3
NP_440943.1_5 Forward -29 -15 10.6193 0.29
NP_441570.1_1 Reverse -281 -299 0.0191479 0.0424
NP_441570.1_1 Reverse -233 -251 -7.06068 0.0841
NP_441570.1_1 Forward -290 -272 -8.92897 0.124
NP_441078.1_4 Forward -290 -281 19.6659 0.0007
NP_441078.1_4 Reverse -281 -290 19.6659 0.0007
NP_441078.1_4 Reverse -233 -242 0.196389 0.205
NP_441078.1_4 Forward -242 -233 0.196389 0.205
NP_442729.1_8 Reverse -277 -290 10.4424 0.125
NP_441539.1_1 Forward -131 -117 13.8636 0.284
NP_441663.1_7 Reverse -278 -297 6.39097 0.226
NP_442348.1_2 Forward -381 -372 15.3394 0.146
NP_442348.1_2 Forward -211 -202 14.2577 0.165
NP_442443.1_1 Forward -365 -346 -5.31042 0.282
NP_440793.1_1 Reverse -45 -59 14.2569 0.26
NP_440526.1_3 Forward -289 -278 10.7762 0.0646
NP_440526.1_3 Forward -338 -327 5.95804 0.223
NP_440526.1_3 Reverse -282 -293 1.92649 0.267
NP_441432.1_8 Reverse -280 -289 16.8143 0.00595
NP_441432.1_8 Forward -291 -282 8.25953 0.0755
NP_441432.1_9 Reverse -86 -99 8.50141 0.289
NP_441333.1_1 Reverse -52 -62 12.9245 0.217
NP_442320.1_8 Reverse -275 -289 15.1426 0.011
NP_442320.1_8 Forward -296 -282 12.8809 0.016
NP_442344.1_7 Reverse -282 -301 -0.4922 0.117
NP_442344.1_7 Forward -289 -270 -7.08038 0.177
NP_441732.1_2 Forward -294 -278 -6.7263 0.0495
NP_441732.1_2 Forward -246 -230 -17.641 0.281
NP_440760.1_1 Forward -290 -271 -14.5535 0.133
NP_440199.1_10 Forward -293 -283 14.533 0.0861
NP_439900.1_4 Forward -313 -299 18.6818 0.136
NP_442489.1_2 Forward -301 -282 15.1424 0.126
NP_442489.1_7 Forward -290 -281 20.1576 0.000695
NP_442489.1_7 Reverse -281 -290 20.1576 0.000695
NP_442489.1_7 Forward -242 -233 7.47288 0.0613
NP_442489.1_7 Reverse -233 -242 0.688044 0.152
NP_442079.1_7 Reverse -282 -301 0.687771 0.275
NP_440559.1_1 Forward -289 -280 17.4043 0.00658
NP_440559.1_1 Reverse -282 -291 8.75118 0.0586
NP_441659.2_8 Forward -290 -280 18.1713 0.00133
NP_441659.2_8 Reverse -281 -291 11.9764 0.0147
NP_441659.2_8 Reverse -233 -243 1.65166 0.233
NP_441800.1_7 Reverse -363 -381 -1.45582 0.242
NP_440779.1_5 Reverse -281 -298 -6.25434 0.17
NP_440779.1_5 Forward -290 -273 -14.1208 0.243
NP_442346.1_5 Reverse -280 -290 16.6963 0.00248
NP_442346.1_5 Forward -291 -281 9.02648 0.118
NP_442346.1_5 Forward -225 -215 6.66654 0.195
NP_440545.1_3 Reverse -277 -294 -5.46769 0.25
NP_440025.1_1 Reverse -277 -296 5.40766 0.296
NP_441126.1_2 Reverse -292 -311 19.764 0.257
NP_441653.1_2 Forward -301 -282 9.32764 0.157
NP_440010.1_4 Forward -294 -275 -2.75457 0.289
NP_440010.1_10 Reverse -269 -288 5.70265 0.23
NP_441943.1_8 Forward -366 -347 -13.1769 0.261
NP_441943.1_8 Forward -270 -251 -13.5702 0.28
NP_441233.1_2 Reverse -273 -292 12.8808 0.246
NP_441888.1_7 Forward -295 -281 2.35953 0.225
NP_441948.1_4 Forward -297 -279 5.91901 0.0698
NP_441833.1_4 Forward -289 -282 15.9687 0.0124
NP_441833.1_4 Reverse -282 -289 15.9687 0.0124
NP_441329.1_1 Forward -29 -10 4.43995 0.291
NP_441329.1_6 Forward -71 -52 3.48503 0.216
NP_441329.1_6 Forward -67 -48 0.524783 0.253
NP_441329.1_6 Forward -65 -46 -1.48055 0.293
NP_442162.1_9 Forward -289 -282 16.2637 0.0124
NP_442162.1_9 Reverse -282 -289 16.2637 0.0124
NP_440671.1_4 Forward -296 -282 8.55439 0.195
NP_442404.1_9 Forward -355 -341 8.06211 0.296
NP_442943.1_1 Reverse -122 -137 4.44547 0.235
NP_440772.1_6 Reverse -282 -301 7.7676 0.292
NP_442073.1_6 Reverse -321 -340 0.294447 0.25
NP_442199.1_5 Forward -298 -279 13.3725 0.0466
NP_442199.1_5 Reverse -273 -292 0.392778 0.173
NP_442199.1_5 Forward -342 -323 -2.36049 0.185
NP_442140.1_3 Forward -289 -279 13.5497 0.0542
NP_442140.1_3 Reverse -282 -292 8.33817 0.119
NP_440875.1_9 Reverse -283 -293 8.37203 0.233
NP_440875.1_9 Forward -240 -230 7.88535 0.255
NP_441813.1_5 Forward -292 -282 17.188 0.00979
NP_441813.1_5 Reverse -279 -289 8.73149 0.0367
NP_442028.1_1 Forward -89 -76 8.84703 0.275
NP_442089.1_1 Forward -293 -274 6.39097 0.142
NP_440590.1_4 Forward -289 -276 9.65572 0.0341
NP_440590.1_4 Reverse -282 -295 -3.81562 0.255
NP_440590.1_4 Forward -241 -228 -5.48725 0.28
NP_440567.1_1 Forward -289 -275 9.63603 0.0422
NP_440567.1_1 Reverse -282 -296 5.80112 0.0959
NP_442497.1_10 Forward -289 -280 10.4228 0.0087
NP_442497.1_10 Reverse -282 -291 10.4228 0.0087
NP_440821.1_4 Forward -292 -282 19.0562 0.00399
NP_440821.1_4 Reverse -279 -289 17.9746 0.00497
NP_440821.1_4 Reverse -231 -241 -0.511621 0.269
NP_441239.1_9 Forward -292 -280 13.3137 0.037
NP_441239.1_9 Reverse -279 -291 9.67541 0.0987
NP_441239.1_9 Reverse -375 -387 4.26721 0.256
NP_441239.1_9 Reverse -384 -396 2.98891 0.3
NP_442568.1_8 Forward -101 -87 9.43936 0.257
NP_441727.1_3 Forward -297 -278 4.32602 0.264
NP_441727.1_3 Reverse -274 -293 2.75272 0.299
NP_441892.1_1 Reverse -272 -289 -1.82945 0.214
NP_441892.1_1 Forward -299 -282 -5.46769 0.281
NP_442082.1_2 Forward -302 -283 4.52188 0.261
NP_440604.1_6 Reverse -233 -252 -0.197208 0.173
NP_440796.1_3 Forward -297 -279 6.90155 0.295
NP_441017.1_6 Forward -294 -280 12.487 0.217
NP_441541.1_1 Reverse -88 -106 -3.34023 0.264
NP_440833.1_6 Forward -348 -334 16.2235 0.134
NP_441526.1_6 Forward -389 -370 3.44104 0.271
NP_440949.1_7 Forward -298 -279 17.2065 0.144
NP_440354.1_7 Reverse -275 -293 17.7187 0.167
NP_442138.1_10 Reverse -281 -300 1.86774 0.12
NP_441782.1_5 Reverse -273 -292 14.3558 0.107
NP_440546.1_4 Reverse -281 -291 11.8882 0.0679
NP_440546.1_4 Forward -290 -280 10.046 0.109
NP_440546.1_4 Reverse -273 -283 8.97947 0.16
NP_440675.1_3 Reverse -281 -300 10.5209 0.186
NP_440462.1_6 Forward -292 -282 15.418 0.0142
NP_440462.1_6 Reverse -279 -289 10.3048 0.0396
NP_440462.1_6 Reverse -231 -241 5.38824 0.156
NP_442899.1_4 Reverse -82 -98 10.8742 0.232
NP_440705.1_4 Forward -389 -370 8.75091 0.296
NP_440868.1_4 Forward -294 -282 8.49544 0.0602
NP_440868.1_4 Reverse -277 -289 7.11881 0.0756
NP_440868.1_4 Forward -246 -234 1.80894 0.174
NP_441204.1_1 Forward -299 -280 8.06259 0.25
NP_442479.1_9 Forward -129 -110 -9.047 0.266
NP_441582.1_5 Forward -373 -354 2.85027 0.281
NP_441474.1_1 Forward -300 -281 -1.67294 0.262
NP_441848.1_7 Reverse -371 -390 -4.32786 0.289
NP_440653.1_10 Reverse -294 -313 11.7992 0.126
NP_442923.1_6 Forward -100 -86 12.8075 0.203
NP_442039.1_4 Forward -289 -282 15.1821 0.0124
NP_442039.1_4 Reverse -282 -289 15.1821 0.0124
NP_441811.1_8 Reverse -275 -289 5.99778 0.289
NP_442837.1_3 Forward -289 -282 15.7721 0.0124
NP_442837.1_3 Reverse -282 -289 15.7721 0.0124
NP_440160.1_2 Forward -260 -241 -2.16383 0.245
NP_442053.1_1 Forward -290 -281 18.3876 0.0007
NP_442053.1_1 Reverse -281 -290 18.3876 0.0007
NP_442053.1_1 Forward -242 -233 12.6844 0.0251
NP_440505.1_3 Reverse -279 -289 16.598 0.00683
NP_440505.1_3 Forward -292 -282 13.8447 0.0247
NP_440505.1_3 Forward -383 -373 10.0098 0.12
NP_440520.1_1 Forward -397 -378 -3.44213 0.218
NP_441252.1_6 Forward -398 -391 14.3954 0.168
NP_442532.1_1 Forward -66 -52 13.0289 0.215
NP_442532.1_1 Forward -102 -88 11.0854 0.23
NP_442532.1_7 Forward -290 -276 5.70279 0.171
NP_440914.1_1 Forward -290 -280 17.5935 0.000537
NP_440914.1_1 Reverse -372 -382 10.5669 0.132
NP_440914.1_1 Reverse -281 -291 8.6151 0.186
NP_441011.1_8 Reverse -282 -291 16.9127 0.00602
NP_441011.1_8 Forward -289 -280 8.25953 0.144
NP_442533.1_1 Forward -389 -370 -3.3438 0.14
NP_442533.1_6 Forward -290 -281 17.2076 0.00137
NP_442533.1_6 Reverse -281 -290 17.2076 0.00137
NP_440263.1_5 Forward -125 -111 7.17775 0.294
NP_442322.1_4 Reverse -369 -386 -8.51661 0.286
NP_442229.1_1 Reverse -279 -293 8.94708 0.184
NP_443016.1_1 Forward -345 -326 -1.37718 0.222
NP_441482.1_7 Reverse -275 -289 -10.6202 0.211
NP_441482.1_7 Forward -296 -282 -10.9151 0.222
NP_439944.1_9 Forward -289 -279 19.1546 0.00329
NP_439944.1_9 Reverse -282 -292 10.3048 0.0887
NP_442203.1_3 Forward -100 -81 3.16327 0.291
NP_441697.1_5 Forward -101 -82 11.3154 0.111
NP_441697.1_5 Reverse -81 -100 -3.1994 0.217
NP_441697.1_5 Forward -99 -80 -10.4568 0.279
NP_441697.1_5 Reverse -35 -54 -10.5523 0.28
NP_441527.1_4 Forward -64 -45 7.30471 0.0947
NP_441527.1_4 Forward -67 -48 -1.28956 0.146
NP_441527.1_4 Forward -55 -36 -3.86785 0.175
NP_441527.1_4 Forward -101 -82 -11.7937 0.284
NP_441527.1_4 Forward -58 -39 -12.0802 0.285
NP_441527.1_4 Reverse -67 -86 -12.9396 0.296
NP_440115.1_6 Reverse -278 -288 9.7148 0.115
NP_441347.1_9 Reverse -89 -102 20.4944 0.129
NP_440608.1_1 Forward -67 -48 6.4985 0.256
NP_441602.1_3 Reverse -276 -295 -3.54046 0.249
NP_441170.1_4 Reverse -272 -290 9.75391 0.181
NP_441972.1_5 Forward -301 -282 -6.98204 0.24
NP_441972.1_5 Forward -289 -270 -9.047 0.278
NP_441106.1_1 Forward -291 -282 18.191 0.0028
NP_441106.1_1 Reverse -280 -289 9.63616 0.0311
NP_441825.1_4 Forward -211 -201 13.5497 0.249
NP_442306.1_10 Reverse -367 -386 -12.2919 0.166
NP_442306.1_10 Forward -295 -276 -18.5851 0.197
NP_441286.1_1 Reverse -280 -292 14.4936 0.00418
NP_441286.1_1 Forward -291 -279 12.1337 0.0104
NP_441286.1_1 Forward -340 -328 -6.15587 0.251
NP_440670.1_8 Forward -290 -281 18.3876 0.000699
NP_440670.1_8 Reverse -281 -290 18.3876 0.000699
NP_440670.1_8 Forward -242 -233 5.89959 0.131
NP_441930.1_2 Forward -396 -386 15.6147 0.19
NP_441930.1_2 Reverse -386 -396 11.8781 0.271
NP_440886.1_7 Forward -291 -281 17.7774 0.0011
NP_440886.1_7 Reverse -280 -290 7.94438 0.0805
NP_440799.1_10 Forward -101 -82 14.4541 0.234
NP_442072.1_9 Reverse -280 -298 -22.007 0.216
NP_441753.1_10 Forward -299 -280 7.66927 0.186
NP_440907.2_8 Forward -289 -279 10.8943 0.0969
NP_440907.2_8 Reverse -282 -292 7.84605 0.117
NP_440907.2_8 Reverse -373 -383 6.86274 0.144
NP_441021.1_1 Forward -289 -270 -10.1286 0.229
NP_441021.1_8 Forward -295 -277 3.55906 0.226
NP_440841.1_4 Forward -292 -273 -6.1954 0.215
NP_441463.1_2 Reverse -84 -102 4.11894 0.193
NP_441463.1_3 Forward -300 -281 28.7121 0.000659
NP_441463.1_3 Reverse -271 -290 8.65258 0.0487
NP_441463.1_6 Forward -292 -278 8.63851 0.25
NP_441626.1_2 Forward -289 -282 15.7721 0.0124
NP_441626.1_2 Reverse -282 -289 15.7721 0.0124
NP_442365.1_7 Reverse -368 -387 1.57275 0.168
NP_441205.1_5 Forward -126 -107 15.5349 0.295
NP_440107.1_5 Forward -291 -272 -2.36049 0.178
NP_442794.1_1 Forward -300 -288 3.48056 0.286
NP_442615.1_1 Reverse -272 -290 6.41066 0.0348
NP_442615.1_1 Forward -299 -281 -1.45582 0.128
NP_441962.1_4 Reverse -276 -295 1.67108 0.103
NP_440387.1_1 Forward -290 -274 6.25339 0.0282
NP_440387.1_1 Reverse -281 -297 -1.12144 0.142
NP_440387.1_1 Reverse -233 -249 -3.97304 0.171
NP_441431.1_2 Forward -293 -279 5.70218 0.291
NP_441993.1_1 Reverse -275 -294 4.67549 0.215
NP_440114.1_10 Reverse -281 -295 15.7325 0.0234
NP_440114.1_10 Forward -290 -276 7.86607 0.223
NP_441425.1_2 Forward -100 -81 11.3136 0.291
NP_440492.1_9 Reverse -118 -132 13.5406 0.294
NP_441510.2_7 Forward -296 -282 12.3887 0.28
NP_441237.1_9 Forward -289 -279 14.9263 0.0242
NP_442930.1_1 Forward -89 -79 9.22267 0.289
NP_439910.1_2 Forward -298 -281 -2.3211 0.0305
NP_442867.1_8 Reverse -379 -398 4.71934 0.277
NP_440457.1_1 Forward -294 -282 0.0389777 0.25
NP_440473.1_9 Forward -301 -282 -11.2103 0.291
NP_442509.1_9 Reverse -281 -291 16.2041 0.00739
NP_442509.1_9 Forward -290 -280 8.14104 0.192
NP_442509.1_9 Forward -358 -348 7.0594 0.24
NP_442936.1_10 Reverse -312 -326 10.3166 0.246
NP_440554.1_4 Reverse -282 -292 14.6313 0.02
NP_440554.1_4 Forward -289 -279 6.37155 0.123
NP_440554.1_4 Reverse -234 -244 3.12662 0.242
NP_441845.1_6 Reverse -221 -239 -1.84914 0.299
NP_441885.1_5 Forward -290 -280 20.9245 0.000538
NP_441885.1_5 Reverse -281 -291 11.4848 0.00668
NP_440628.1_1 Forward -64 -54 13.6803 0.279
NP_441428.1_8 Reverse -273 -292 3.34271 0.251
NP_442341.1_7 Reverse -280 -294 10.0294 0.0682
NP_442341.1_7 Forward -291 -277 9.93102 0.0692
NP_442341.1_7 Forward -243 -229 9.63603 0.0726
NP_441173.1_9 Reverse -115 -123 9.85212 0.275
NP_440423.1_6 Forward -389 -370 -19.7651 0.244
NP_443000.1_7 Reverse -279 -289 10.4031 0.0345
NP_443000.1_7 Forward -292 -282 8.73149 0.0437
NP_440507.2_3 Reverse -272 -291 9.63507 0.218
NP_440507.2_3 Forward -299 -280 8.94676 0.237
NP_442513.1_5 Reverse -273 -292 13.2733 0.265
NP_441842.1_10 Forward -297 -283 15.0442 0.0474
NP_441842.1_10 Reverse -274 -288 12.1926 0.107
NP_441842.1_10 Reverse -226 -240 6.88276 0.271
NP_440275.1_3 Reverse -279 -289 17.6796 0.0102
NP_440275.1_3 Forward -292 -282 8.4365 0.0602
NP_440091.1_1 Forward -294 -282 18.3285 0.0114
NP_440091.1_1 Reverse -277 -289 8.9871 0.0567
NP_442275.1_1 Forward -381 -362 0.491109 0.285
NP_441635.1_2 Forward -72 -53 12.5568 0.241
NP_440175.1_4 Reverse -328 -347 -11.2103 0.185
NP_440149.1_8 Forward -290 -271 5.01433 0.0783
NP_440149.1_8 Reverse -281 -300 -5.70374 0.231
NP_441105.1_3 Reverse -239 -258 -6.98204 0.243
NP_440216.1_1 Reverse -281 -295 6.29277 0.0156
NP_440216.1_1 Forward -290 -276 -2.85201 0.0608
NP_440216.1_1 Forward -224 -210 -11.8001 0.219
NP_440172.1_1 Forward -290 -280 15.0247 0.00945
NP_440172.1_1 Reverse -281 -291 8.73149 0.0586
NP_442418.1_1 Forward -99 -80 21.9273 0.078
NP_442015.1_10 Forward -294 -281 0.904263 0.216
NP_442015.1_10 Forward -362 -349 -0.669033 0.277
NP_441226.1_7 Forward -289 -282 14.4934 0.0123
NP_441226.1_7 Reverse -282 -289 14.4934 0.0123
NP_441111.1_7 Forward -289 -281 18.7023 0.00294
NP_441111.1_7 Reverse -282 -290 18.7023 0.00294
NP_441766.1_2 Forward -290 -281 17.5026 0.00297
NP_441766.1_2 Reverse -281 -290 17.5026 0.00297
NP_441766.1_2 Forward -242 -233 3.93297 0.2
NP_441766.1_5 Reverse -244 -263 20.1564 0.276
NP_442252.1_3 Forward -297 -279 14.7688 0.0882
NP_440416.1_9 Forward -297 -278 -21.7317 0.296
NP_440416.1_9 Reverse -370 -389 -22.0267 0.3
NP_443052.1_8 Forward -300 -281 -1.18052 0.0784
NP_443052.1_8 Reverse -271 -290 -6.1954 0.141
NP_443052.1_9 Reverse -370 -389 1.86774 0.18
NP_442403.1_8 Reverse -283 -302 3.73603 0.226
NP_442154.1_1 Forward -388 -370 -16.1071 0.232
NP_440261.1_5 Forward -289 -276 -10.5021 0.201
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

TATTGGGCAATGCGGGTGAGGGGATTGGTGGCAAACTGCCCCTGTAAACGGCCCCGAAATTGACCATCCCGCCGCAAAAAAATGGTTTCAATGCCCTGATCCATCAAAACGGCGATCGCCACATCGGTTAACTGCACGCCGGGAAAGAGCACTAGCAAGTCGATCTCCGCTAAGCGGGTAATGACCTGCCGGGATTTTTGTTTGATCTGTAGTTGCTGATTGTGATAACTGACCTTGGTTCCGGGTTCTGTCAGGTAAATACTAGTCATTAAACATTTTTGCTAAAGTTCTATTTAGAAATAAAAGTTAATAAATATTTTTCTATTACCTTGTAATATAAAGAGAAAAAAGAAGTTTAACAACTATAGTATTTTGTCAAAGCGGTTTTAAACTACTAATT

CDS

ATGGAAAACCCTAATCAATACCAAAACTATGCCCAGCAAATGGATAAAGAAAAATCAGAGCGACTAGTTCGTAAAACTTTGTATATTTCTCGTCGAGCCATTTGGGTGAACATTCTTTTGTCCATTTTGATCTCTTACGTTGCAGGTTATATTCACACCCGCCGCTGGAAAGCTTTGGGGATTGTTGTTGTGGGGACTTTCGTATTTGGTTTCTTGACTGCCTCAGAAAATGAAAGCCTTGAAGAAGCGGTGGAAAGAGGGATAACTCTTTCTCCTTTATTTGGTTTGATTGGGACTATTGATAACAGCTTGGCCATTCGTCGGGCCCGCCAAACAGTAGCCAATGGTAATGTTGACGCCCCGGGGAACCAATGA

Protein

No sequence available