Your browser is old and dusty. Try Google Chrome!

Details for sll7064

ORF sll7064
Accession NP_942352.1
Symbol
Category
Definition
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_441061.1_2 Forward -128 -114 0.392915 0.211
NP_441061.1_2 Forward -248 -234 -1.27871 0.255
NP_440795.1_7 Forward -248 -241 14.6904 0.0123
NP_440795.1_7 Reverse -241 -248 14.6904 0.0123
NP_440795.1_7 Forward -335 -328 9.77388 0.169
NP_440795.1_7 Forward -190 -183 8.8889 0.188
NP_441418.1_6 Forward -249 -230 -3.44213 0.0238
NP_441418.1_6 Reverse -240 -259 -30.4831 0.28
NP_442291.1_5 Reverse -239 -255 -2.30141 0.215
NP_442291.1_5 Forward -250 -234 -2.98973 0.232
NP_441453.1_4 Reverse -240 -248 16.539 0.00633
NP_441453.1_4 Forward -249 -241 16.539 0.00633
NP_441453.1_4 Forward -17 -9 4.93597 0.224
NP_441623.1_1 Forward -140 -122 -5.09406 0.283
NP_442151.1_1 Reverse -120 -139 3.93269 0.287
NP_442151.1_6 Reverse -182 -196 12.3893 0.0749
NP_442151.1_6 Forward -249 -235 5.89945 0.256
NP_442838.1_7 Forward -254 -235 -1.18052 0.121
NP_441818.1_1 Forward -248 -237 14.2178 0.0541
NP_441818.1_1 Reverse -241 -252 9.30127 0.246
NP_440226.1_1 Reverse -240 -259 17.5024 0.0184
NP_440226.1_1 Forward -249 -230 4.12936 0.202
NP_441630.1_3 Forward -257 -238 -1.08219 0.291
NP_442287.1_1 Forward -135 -125 14.9258 0.25
NP_442287.1_3 Forward -257 -240 18.0326 0.108
NP_442173.1_1 Forward -248 -240 15.4574 0.00633
NP_442173.1_1 Reverse -241 -249 15.4574 0.00633
NP_442752.1_4 Forward -249 -242 13.8055 0.0199
NP_442752.1_4 Reverse -240 -247 13.8055 0.0199
NP_442752.1_4 Reverse -120 -127 9.47889 0.109
NP_442752.1_4 Reverse -8 -15 5.25066 0.256
NP_443027.1_4 Forward -251 -241 11.8781 0.0872
NP_443027.1_4 Reverse -238 -248 7.35486 0.24
NP_443027.1_4 Reverse -6 -16 5.78156 0.298
NP_442975.1_10 Forward -253 -239 4.91554 0.234
NP_442975.1_10 Reverse -236 -250 3.8339 0.252
NP_440784.1_7 Forward -248 -241 15.9687 0.0123
NP_440784.1_7 Reverse -241 -248 15.9687 0.0123
NP_440061.1_9 Forward -251 -237 10.422 0.124
NP_442062.1_8 Reverse -240 -250 19.4496 0.000558
NP_442062.1_8 Forward -249 -239 17.6796 0.00193
NP_442062.1_8 Reverse -125 -135 5.68323 0.157
NP_442062.1_8 Forward -24 -14 4.60159 0.206
NP_442062.1_8 Forward -303 -293 3.02829 0.289
NP_441859.1_3 Forward -250 -231 4.12856 0.228
NP_440304.1_4 Reverse -238 -248 18.9579 0.00406
NP_440304.1_4 Reverse -292 -302 3.71661 0.293
NP_440304.1_4 Forward -251 -241 1.84832 0.299
NP_442242.1_4 Forward -248 -241 14.3954 0.0124
NP_442242.1_4 Reverse -241 -248 14.3954 0.0124
NP_441546.1_2 Reverse -186 -205 16.2241 0.254
NP_442110.1_7 Reverse -327 -341 -0.000409212 0.27
NP_440856.1_4 Forward -256 -237 6.68596 0.0735
NP_441083.1_5 Forward -249 -239 19.3512 0.000718
NP_441083.1_5 Reverse -240 -250 11.3864 0.0159
NP_441083.1_5 Reverse -370 -380 3.42162 0.172
NP_441083.1_5 Reverse -8 -18 -1.10161 0.295
NP_442827.1_8 Reverse -325 -344 -2.75457 0.288
NP_441738.1_2 Forward -247 -240 15.28 0.0102
NP_441738.1_2 Reverse -242 -249 15.28 0.0102
NP_441738.1_2 Forward -15 -8 8.00357 0.235
NP_441558.1_5 Reverse -6 -25 5.01433 0.265
NP_440209.1_1 Reverse -240 -248 18.1123 0.00295
NP_440209.1_1 Forward -249 -241 18.1123 0.00295
NP_442889.1_8 Forward -252 -238 12.6836 0.0611
NP_442889.1_8 Reverse -179 -193 5.89884 0.211
NP_441713.1_1 Reverse -114 -133 -9.34199 0.173
NP_441713.1_3 Reverse -231 -250 2.75272 0.274
NP_440178.1_7 Reverse -239 -258 -21.6334 0.232
NP_442570.1_3 Reverse -123 -142 2.55606 0.186
NP_441716.1_1 Forward -249 -235 8.35772 0.143
NP_442111.1_4 Reverse -181 -195 3.44117 0.244
NP_441624.1_7 Forward -197 -183 7.86607 0.241
NP_441163.1_1 Forward -385 -368 6.13464 0.267
NP_440343.1_10 Reverse -369 -387 14.9646 0.169
NP_440906.1_5 Forward -248 -241 15.8704 0.0124
NP_440906.1_5 Reverse -241 -248 15.8704 0.0124
NP_440747.1_10 Forward -252 -240 7.31547 0.00577
NP_440747.1_10 Reverse -237 -249 -2.02597 0.0196
NP_440747.1_10 Forward -306 -294 -4.68091 0.115
NP_441130.1_10 Reverse -238 -252 17.8958 0.0144
NP_441130.1_10 Forward -353 -339 5.60446 0.223
NP_442973.1_5 Reverse -285 -304 10.9142 0.259
NP_441486.1_1 Forward -252 -238 11.8976 0.0137
NP_441486.1_1 Reverse -237 -251 -4.7203 0.205
NP_442145.1_6 Forward -237 -218 4.22769 0.253
NP_442634.1_4 Forward -251 -237 -2.06536 0.149
NP_442634.1_4 Reverse -118 -132 -4.03198 0.179
NP_442634.1_4 Reverse -325 -339 -4.22864 0.19
NP_440403.1_4 Forward -258 -239 -4.52377 0.213
NP_441014.1_8 Reverse -376 -395 -9.53865 0.296
NP_442848.1_9 Reverse -363 -382 -0.39387 0.278
NP_443018.1_3 Forward -248 -241 14.8871 0.0123
NP_443018.1_3 Reverse -241 -248 14.8871 0.0123
NP_443018.1_3 Reverse -132 -139 8.49558 0.141
NP_443018.1_3 Forward -11 -4 5.34899 0.212
NP_443018.1_3 Reverse -183 -190 4.56234 0.241
NP_443018.1_3 Forward -190 -183 4.46401 0.244
NP_441634.1_8 Reverse -238 -252 2.5562 0.167
NP_440376.1_1 Forward -249 -240 19.4693 0.000692
NP_440376.1_1 Reverse -240 -249 19.4693 0.000692
NP_440376.1_1 Forward -24 -15 3.63797 0.2
NP_440376.1_1 Reverse -8 -17 3.34298 0.206
NP_440376.1_1 Reverse -125 -134 1.76968 0.242
NP_441588.1_4 Reverse -242 -252 7.05986 0.178
NP_442687.1_7 Reverse -239 -249 18.5646 0.0028
NP_442687.1_7 Forward -250 -240 15.8113 0.0125
NP_442687.1_7 Reverse -181 -191 4.3066 0.255
NP_442485.1_3 Reverse -171 -190 -4.32711 0.28
NP_440741.1_4 Forward -336 -317 13.7658 0.215
NP_442296.1_5 Forward -138 -119 0.982764 0.288
NP_442658.1_1 Forward -251 -241 17.0891 0.00615
NP_442658.1_1 Reverse -238 -248 14.8275 0.0188
NP_442782.1_2 Reverse -120 -134 19.7641 0.114
NP_440656.1_8 Reverse -229 -248 -8.16202 0.273
NP_442544.1_2 Forward -142 -128 -0.983719 0.254
NP_441414.1_9 Reverse -240 -259 -10.4236 0.284
NP_442937.1_5 Forward -254 -235 7.96426 0.237
NP_441958.1_5 Reverse -239 -249 20.5312 0.000966
NP_441958.1_5 Forward -250 -240 12.2714 0.00183
NP_441958.1_5 Reverse -7 -17 -0.609952 0.215
NP_440984.1_7 Reverse -365 -379 6.6861 0.204
NP_440984.1_7 Forward -254 -240 5.89945 0.235
NP_439990.1_5 Reverse -115 -128 7.59077 0.19
NP_442911.1_2 Reverse -230 -249 7.96426 0.0225
NP_440153.1_5 Reverse -241 -255 0.392915 0.299
NP_442571.1_9 Reverse -187 -206 11.2092 0.258
NP_440369.1_5 Reverse -107 -126 8.16093 0.296
NP_443055.1_2 Reverse -360 -379 12.5858 0.206
NP_443055.1_6 Reverse -232 -250 10.8348 0.117
NP_442002.1_9 Reverse -239 -246 14.1004 0.074
NP_442002.1_9 Forward -250 -243 10.7572 0.185
NP_442002.1_9 Reverse -14 -21 9.08556 0.289
NP_441294.1_7 Forward -253 -239 15.0099 0.0328
NP_441294.1_7 Reverse -11 -25 12.0343 0.117
NP_441294.1_7 Forward -21 -7 10.1145 0.207
NP_443020.1_4 Forward -144 -125 17.8948 0.232
NP_441646.1_1 Reverse -8 -27 4.81767 0.189
NP_441646.1_1 Forward -309 -290 2.55606 0.218
NP_442438.1_10 Forward -341 -327 3.73617 0.157
NP_440879.1_6 Forward -170 -151 -4.6221 0.29
NP_441000.1_6 Reverse -239 -253 24.0907 0.0119
NP_441000.1_6 Forward -250 -236 -5.40861 0.275
NP_442771.1_1 Forward -251 -233 -5.48739 0.166
NP_440147.1_4 Reverse -238 -251 10.344 0.0355
NP_440147.1_4 Forward -251 -238 10.2457 0.0355
NP_440147.1_4 Reverse -13 -26 0.117615 0.265
NP_441125.1_6 Forward -266 -253 10.934 0.253
NP_441550.1_8 Reverse -238 -248 15.4175 0.0132
NP_441550.1_8 Forward -251 -241 8.82935 0.112
NP_441916.1_7 Reverse -240 -250 18.4663 0.00144
NP_441916.1_7 Forward -249 -239 16.893 0.00407
NP_441041.1_4 Reverse -120 -139 0.392778 0.0881
NP_441041.1_4 Reverse -327 -346 -13.7669 0.295
NP_441041.1_7 Forward -252 -240 17.9128 0.00663
NP_442004.1_6 Reverse -120 -134 2.45787 0.264
NP_441725.1_5 Forward -248 -238 21.0229 0.00533
NP_441725.1_5 Reverse -241 -251 2.04498 0.115
NP_441725.1_5 Forward -190 -180 0.865012 0.143
NP_439966.1_7 Forward -251 -241 17.9741 0.00631
NP_439966.1_7 Reverse -238 -248 9.12434 0.119
NP_439966.1_9 Forward -251 -242 0.884706 0.253
NP_442941.1_3 Forward -248 -238 11.3864 0.0116
NP_442941.1_3 Reverse -241 -251 10.7964 0.0116
NP_442941.1_3 Forward -335 -325 4.99491 0.132
NP_442941.1_3 Reverse -9 -19 -0.904945 0.274
NP_440289.1_2 Forward -252 -239 23.5204 0.00258
NP_440289.1_2 Reverse -237 -250 6.4108 0.0596
NP_440260.1_8 Reverse -122 -140 -2.63579 0.245
NP_442281.1_1 Forward -254 -240 20.3534 0.00192
NP_442281.1_1 Reverse -235 -249 12.6836 0.035
NP_442281.1_1 Reverse -289 -303 5.30886 0.163
NP_442281.1_1 Forward -79 -65 4.52221 0.192
NP_442256.1_2 Forward -251 -233 -7.65067 0.214
NP_442256.1_2 Reverse -180 -198 -7.65067 0.214
NP_440647.1_9 Forward -251 -233 4.14905 0.257
NP_440498.1_1 Reverse -231 -249 -1.35749 0.223
NP_441644.1_6 Forward -249 -239 15.7125 0.0048
NP_441644.1_6 Reverse -240 -250 10.1076 0.0628
NP_441644.1_6 Forward -17 -7 6.66608 0.152
NP_442215.1_2 Forward -305 -289 3.59845 0.094
NP_442247.1_8 Forward -251 -237 12.1926 0.247
NP_440253.1_2 Reverse -240 -258 16.1454 0.0145
NP_440253.1_2 Forward -249 -231 11.2289 0.0335
NP_440929.1_8 Forward -249 -240 19.2726 0.000701
NP_440929.1_8 Reverse -240 -249 19.2726 0.000701
NP_440929.1_8 Forward -17 -8 4.81794 0.176
NP_442933.1_1 Reverse -96 -115 12.6523 0.242
NP_442933.1_10 Forward -249 -240 17.601 0.00325
NP_442933.1_10 Reverse -240 -249 17.601 0.00325
NP_441751.2_8 Forward -248 -234 -2.36035 0.132
NP_441751.2_8 Reverse -241 -255 -3.93365 0.157
NP_441751.2_8 Forward -16 -2 -4.22864 0.166
NP_441751.2_8 Forward -302 -288 -6.68692 0.277
NP_442554.1_8 Forward -248 -238 14.828 0.0108
NP_442554.1_8 Reverse -241 -251 14.1397 0.0144
NP_442554.1_8 Reverse -183 -193 6.17489 0.125
NP_442554.1_8 Reverse -9 -19 3.51995 0.222
NP_442554.1_8 Forward -302 -292 2.14332 0.281
NP_441762.1_7 Reverse -239 -251 11.5437 0.0142
NP_441762.1_7 Forward -250 -238 2.20226 0.0676
NP_442142.1_4 Reverse -237 -250 8.47516 0.113
NP_442142.1_4 Forward -252 -239 7.19687 0.144
NP_442292.1_1 Reverse -241 -250 9.63616 0.0183
NP_442292.1_1 Forward -248 -239 9.53783 0.0183
NP_442292.1_1 Reverse -183 -192 4.81794 0.17
NP_442292.1_1 Reverse -9 -18 -0.590259 0.258
NP_442476.1_6 Reverse -241 -255 3.34284 0.158
NP_442381.1_8 Forward -252 -233 22.2223 0.0114
NP_442381.1_8 Reverse -229 -248 -3.3438 0.126
NP_441711.1_4 Reverse -231 -250 6.98095 0.144
NP_443009.1_5 Reverse -239 -250 20.6093 0.001
NP_443009.1_5 Forward -250 -239 9.10461 0.0965
NP_443009.1_5 Forward -25 -14 4.08976 0.263
NP_442406.1_9 Reverse -124 -143 0.58944 0.29
NP_442301.1_2 Forward -138 -119 5.01354 0.269
NP_442408.2_1 Forward -249 -230 5.11266 0.143
NP_441715.1_4 Reverse -241 -251 18.8596 0.00741
NP_441715.1_4 Forward -248 -238 7.25653 0.108
NP_440183.1_9 Forward -301 -282 -17.3068 0.276
NP_441198.1_8 Reverse -238 -248 13.076 0.108
NP_441468.1_1 Forward -248 -241 15.8704 0.0124
NP_441468.1_1 Reverse -241 -248 15.8704 0.0124
NP_441468.1_1 Forward -190 -183 3.97235 0.277
NP_441020.2_6 Forward -251 -234 13.4119 0.0736
NP_441020.2_6 Reverse -238 -255 6.62702 0.26
NP_441015.1_10 Forward -390 -371 7.17762 0.0996
NP_441673.1_1 Forward -249 -240 20.8459 0.000698
NP_441673.1_1 Reverse -240 -249 20.8459 0.000698
NP_441764.1_8 Forward -266 -256 10.8322 0.297
NP_442868.1_6 Forward -251 -241 10.3048 0.038
NP_442868.1_6 Reverse -238 -248 9.22315 0.0527
NP_442719.1_2 Forward -213 -195 -9.61797 0.267
NP_442808.1_1 Forward -250 -240 18.4657 0.00201
NP_442808.1_1 Reverse -239 -249 8.73102 0.0481
NP_440145.1_3 Forward -259 -240 -2.0655 0.161
NP_442542.1_2 Forward -251 -238 17.4239 0.0432
NP_442050.1_5 Reverse -238 -248 15.8108 0.0091
NP_442050.1_5 Forward -251 -241 6.96107 0.27
NP_442903.1_2 Forward -271 -252 2.62561 0.273
NP_441114.1_3 Reverse -295 -304 14.5527 0.193
NP_440558.1_2 Forward -138 -119 5.60432 0.142
NP_440558.1_2 Reverse -122 -141 0.196116 0.194
NP_440558.1_2 Forward -306 -287 -2.55715 0.229
NP_440558.1_2 Reverse -318 -337 -2.95047 0.232
NP_440111.2_2 Forward -79 -60 -0.197208 0.215
NP_441518.1_3 Forward -259 -240 -14.2585 0.273
NP_441878.1_6 Reverse -239 -249 20.2362 0.0046
NP_441878.1_6 Forward -250 -240 10.4031 0.0176
NP_441878.1_6 Reverse -293 -303 2.24165 0.0462
NP_441878.1_6 Reverse -181 -191 1.25834 0.108
NP_441878.1_6 Forward -192 -182 -7.49312 0.231
NP_441036.1_3 Forward -169 -150 -0.295539 0.181
NP_441036.1_8 Forward -250 -240 17.7779 0.000554
NP_441036.1_8 Reverse -7 -17 12.6647 0.0726
NP_441036.1_8 Reverse -239 -249 8.4365 0.174
NP_441557.1_5 Forward -249 -240 19.9609 0.000699
NP_441557.1_5 Reverse -240 -249 19.9609 0.000699
NP_441445.1_1 Forward -258 -239 1.37609 0.257
NP_442066.2_9 Forward -253 -240 8.77074 0.185
NP_440738.1_5 Forward -215 -196 4.71934 0.246
NP_441308.1_8 Reverse -6 -16 12.4681 0.218
NP_442183.1_1 Forward -249 -235 18.8791 0.00656
NP_442183.1_1 Reverse -240 -254 10.6193 0.0821
NP_442183.1_1 Forward -17 -3 8.55439 0.113
NP_442183.1_1 Forward -191 -177 6.88276 0.157
NP_442397.1_9 Forward -249 -230 4.32602 0.254
NP_440356.1_2 Forward -340 -321 0.982764 0.263
NP_440233.1_2 Forward -281 -262 4.81767 0.25
NP_441549.1_9 Reverse -116 -134 -9.81395 0.261
NP_442347.1_2 Reverse -241 -250 11.1111 0.056
NP_442347.1_2 Reverse -328 -337 6.19458 0.182
NP_442347.1_2 Forward -248 -239 3.34298 0.284
NP_442645.1_2 Reverse -123 -142 -9.14533 0.136
NP_441037.1_4 Reverse -238 -248 9.65667 0.21
NP_441037.1_4 Forward -193 -183 9.46176 0.214
NP_441037.1_4 Forward -251 -241 6.92787 0.237
NP_440932.1_5 Forward -85 -66 4.62101 0.239
NP_441633.1_3 Forward -251 -238 15.0639 0.0109
NP_441633.1_3 Reverse -238 -251 -5.78224 0.236
NP_441633.1_3 Reverse -13 -26 -7.06055 0.288
NP_440136.1_2 Forward -248 -241 15.9687 0.0123
NP_440136.1_2 Reverse -241 -248 15.9687 0.0123
NP_440136.1_2 Reverse -9 -16 3.97235 0.288
NP_442998.1_10 Forward -247 -240 15.5754 0.0102
NP_442998.1_10 Reverse -242 -249 15.5754 0.0102
NP_440299.1_1 Reverse -236 -249 9.85179 0.0646
NP_440299.1_1 Reverse -178 -191 4.14862 0.217
NP_440299.1_1 Reverse -378 -391 2.18201 0.294
NP_441799.1_1 Reverse -236 -250 13.5686 0.0311
NP_441799.1_1 Forward -253 -239 3.44058 0.298
NP_440640.1_6 Reverse -107 -126 7.37428 0.174
NP_441007.1_10 Reverse -235 -248 -0.767364 0.293
NP_442334.1_2 Forward -388 -371 -5.07437 0.2
NP_440256.1_1 Reverse -237 -256 3.24438 0.0553
NP_440256.1_1 Forward -252 -233 -2.85214 0.123
NP_440256.1_1 Forward -306 -287 -9.14533 0.275
NP_441559.1_8 Reverse -322 -336 1.57289 0.155
NP_441559.1_8 Forward -254 -240 -5.90027 0.271
NP_442756.1_10 Reverse -24 -43 23.6972 0.0257
NP_441270.1_5 Reverse -107 -126 13.6774 0.211
NP_442302.1_6 Reverse -110 -129 13.1758 0.27
NP_440915.1_6 Forward -253 -239 11.406 0.0263
NP_440915.1_6 Reverse -116 -130 0.786239 0.153
NP_442158.1_4 Reverse -201 -211 12.7631 0.242
NP_440717.1_1 Reverse -183 -202 5.40766 0.272
NP_440717.1_3 Reverse -371 -385 8.84875 0.255
NP_441464.1_8 Forward -249 -235 7.07942 0.219
NP_441939.1_3 Reverse -183 -202 6.39097 0.239
NP_442993.1_1 Forward -249 -233 -7.41462 0.146
NP_442993.1_1 Reverse -240 -256 -7.70961 0.146
NP_442386.1_9 Forward -250 -241 15.7322 0.0144
NP_442386.1_9 Forward -18 -9 7.2758 0.219
NP_442386.1_9 Reverse -239 -248 6.39082 0.219
NP_440570.1_5 Forward -195 -176 -2.95047 0.283
NP_441340.1_5 Forward -248 -241 15.6737 0.0124
NP_441340.1_5 Reverse -241 -248 15.6737 0.0124
NP_441340.1_5 Reverse -183 -190 11.0522 0.0749
NP_441340.1_9 Forward -265 -255 16.8354 0.194
NP_440251.1_8 Reverse -176 -190 13.4709 0.202
NP_440059.1_3 Reverse -172 -191 6.1935 0.266
NP_440161.1_3 Reverse -238 -257 15.6341 0.111
NP_440161.1_3 Forward -251 -232 14.4541 0.121
NP_440586.1_8 Forward -248 -241 13.2151 0.026
NP_440586.1_8 Reverse -241 -248 13.2151 0.026
NP_442251.1_6 Forward -248 -241 15.2804 0.0124
NP_442251.1_6 Reverse -241 -248 15.2804 0.0124
NP_442251.1_6 Forward -164 -157 7.11894 0.274
NP_440684.1_9 Reverse -234 -248 6.58777 0.298
NP_441262.1_3 Reverse -240 -247 14.7888 0.0223
NP_441262.1_3 Forward -249 -242 14.7888 0.0223
NP_441262.1_3 Reverse -8 -15 5.15232 0.265
NP_443051.1_1 Reverse -239 -248 18.0926 0.00402
NP_443051.1_1 Forward -250 -241 10.4228 0.00754
NP_443051.1_1 Reverse -7 -16 4.81794 0.105
NP_443051.1_1 Forward -192 -183 -0.000272808 0.245
NP_439937.1_9 Reverse -239 -256 -7.13998 0.157
NP_441595.1_5 Reverse -233 -251 8.27895 0.222
NP_441740.2_10 Reverse -125 -144 6.29264 0.297
NP_440439.1_1 Forward -252 -239 12.2123 0.0269
NP_440439.1_1 Reverse -237 -250 0.117615 0.202
NP_440439.1_1 Reverse -5 -18 -2.04567 0.293
NP_440372.1_2 Forward -248 -241 16.3621 0.0124
NP_440372.1_2 Reverse -241 -248 16.3621 0.0124
NP_440372.1_2 Reverse -9 -16 4.07068 0.262
NP_441789.1_7 Forward -145 -126 -5.31116 0.297
NP_440316.1_10 Forward -192 -182 6.46988 0.257
NP_441803.1_2 Reverse -333 -352 3.73603 0.191
NP_439977.1_5 Forward -135 -116 0.786102 0.201
NP_439977.1_5 Forward -255 -236 -1.27885 0.245
NP_440139.1_1 Forward -255 -236 8.65176 0.109
NP_440139.1_1 Reverse -234 -253 4.32522 0.187
NP_440267.1_2 Forward -254 -240 12.2903 0.125
NP_440267.1_2 Reverse -235 -249 7.76712 0.192
NP_440267.1_2 Forward -134 -120 6.19383 0.239
NP_442384.1_10 Forward -249 -236 9.36073 0.054
NP_442384.1_10 Reverse -240 -253 2.87088 0.21
NP_442114.1_4 Reverse -240 -251 9.20345 0.17
NP_441877.1_7 Forward -145 -126 3.83357 0.218
NP_441018.1_3 Forward -245 -226 16.0265 0.286
NP_442790.1_4 Forward -258 -239 -8.45701 0.17
NP_442790.1_4 Forward -342 -323 -14.7502 0.281
NP_442790.1_4 Reverse -231 -250 -15.0452 0.284
NP_442262.1_10 Forward -248 -241 14.1988 0.0123
NP_442262.1_10 Reverse -241 -248 14.1988 0.0123
NP_442262.1_10 Reverse -132 -139 8.59391 0.22
NP_442262.1_10 Reverse -183 -190 7.90559 0.266
NP_442262.1_10 Forward -11 -4 7.6106 0.274
NP_441689.1_5 Reverse -238 -248 8.63269 0.132
NP_441689.1_5 Reverse -6 -16 5.97777 0.197
NP_440344.1_10 Forward -256 -239 2.39878 0.0282
NP_440344.1_10 Reverse -233 -250 -3.79607 0.0876
NP_440282.1_3 Forward -196 -177 -2.85214 0.298
NP_440282.1_10 Reverse -172 -191 4.22769 0.125
NP_440282.1_10 Forward -145 -126 -6.09707 0.25
NP_442910.1_1 Forward -256 -237 -7.27704 0.254
NP_440297.1_9 Forward -248 -238 19.0562 0.0359
NP_440297.1_9 Forward -190 -180 16.7946 0.0711
NP_440297.1_9 Reverse -241 -251 -0.118297 0.282
NP_441592.1_4 Forward -303 -284 -1.27885 0.253
NP_440937.1_5 Reverse -170 -189 11.0125 0.275
NP_442078.1_9 Reverse -210 -227 12.8219 0.264
NP_440999.1_9 Forward -253 -239 9.14437 0.0676
NP_440999.1_9 Reverse -172 -186 -3.44199 0.293
NP_440888.1_2 Reverse -240 -254 13.8636 0.0231
NP_440888.1_2 Reverse -125 -139 12.487 0.0442
NP_440888.1_2 Forward -249 -235 7.07881 0.208
NP_440888.1_2 Forward -129 -115 7.07881 0.208
NP_441345.1_4 Forward -127 -108 12.2908 0.277
NP_440575.1_1 Reverse -255 -274 1.96529 0.258
NP_441543.1_2 Reverse -241 -250 18.486 0.00236
NP_441543.1_2 Reverse -183 -192 10.6195 0.0691
NP_441543.1_2 Forward -248 -239 9.34117 0.0818
NP_442845.1_2 Forward -135 -121 9.2427 0.178
NP_442845.1_2 Reverse -2 -16 6.88276 0.201
NP_441469.1_8 Forward -250 -241 16.126 0.00797
NP_441469.1_8 Reverse -239 -248 13.3727 0.073
NP_443064.1_6 Forward -249 -239 13.8273 0.0796
NP_442578.1_7 Forward -248 -241 14.5921 0.026
NP_442578.1_7 Reverse -241 -248 14.5921 0.026
NP_440071.1_6 Reverse -115 -129 13.9018 0.252
NP_441462.1_2 Forward -249 -239 20.1379 0.000967
NP_441462.1_2 Reverse -240 -250 11.5831 0.00406
NP_441621.1_7 Reverse -238 -252 -5.21195 0.248
NP_443062.1_1 Reverse -240 -258 11.1786 0.103
NP_443062.1_1 Reverse -65 -83 4.2556 0.268
NP_443062.1_6 Forward -257 -238 1.27776 0.276
NP_441410.1_3 Reverse -231 -250 8.06259 0.218
NP_440519.1_3 Forward -202 -183 7.86593 0.285
NP_442204.1_1 Forward -195 -184 7.63016 0.123
NP_442204.1_1 Forward -399 -388 4.87689 0.231
NP_442204.1_1 Reverse -323 -334 0.0586712 0.284
NP_440544.1_5 Reverse -259 -266 13.8024 0.28
NP_440516.1_8 Forward -249 -240 16.9127 0.00442
NP_440516.1_8 Reverse -240 -249 16.9127 0.00442
NP_442428.1_5 Forward -248 -241 15.8704 0.0124
NP_442428.1_5 Reverse -241 -248 15.8704 0.0124
NP_442428.1_5 Forward -190 -183 4.36568 0.271
NP_441443.1_2 Reverse -361 -380 -5.11376 0.29
NP_442120.1_10 Forward -191 -172 -14.1602 0.288
NP_440673.1_3 Forward -247 -240 12.4288 0.0426
NP_440673.1_3 Reverse -242 -249 12.4288 0.0426
NP_441052.1_2 Reverse -240 -250 10.5014 0.0285
NP_441052.1_2 Forward -249 -239 10.4031 0.0285
NP_442219.1_9 Reverse -241 -250 8.35786 0.0681
NP_442219.1_9 Forward -248 -239 8.25953 0.0681
NP_440436.1_4 Reverse -241 -250 18.1905 0.00233
NP_440436.1_4 Forward -248 -239 15.9289 0.00508
NP_440436.1_4 Forward -128 -119 8.65242 0.0997
NP_441884.1_8 Reverse -64 -83 -3.83545 0.143
NP_441884.1_8 Reverse -239 -258 -8.45701 0.262
NP_441884.1_9 Forward -252 -233 -24.0916 0.284
NP_441719.1_4 Forward -248 -241 16.3621 0.0124
NP_441719.1_4 Reverse -241 -248 16.3621 0.0124
NP_441733.1_10 Forward -252 -239 8.37742 0.14
NP_441733.1_10 Reverse -237 -250 6.90245 0.166
NP_441004.1_1 Forward -191 -172 -9.83364 0.212
NP_441004.1_1 Forward -384 -365 -16.0285 0.281
NP_442366.1_3 Reverse -181 -199 -1.55415 0.215
NP_442366.1_3 Reverse -239 -257 -3.52077 0.251
NP_442366.1_3 Forward -250 -232 -5.19239 0.284
NP_442366.1_5 Forward -20 -10 11.1893 0.207
NP_442206.1_10 Forward -17 -2 13.3529 0.0799
NP_443054.1_2 Reverse -238 -252 14.4542 0.0722
NP_441851.1_10 Reverse -239 -249 17.4829 0.0027
NP_441851.1_10 Forward -250 -240 16.008 0.00552
NP_441851.1_10 Reverse -119 -129 4.99491 0.233
NP_441851.1_10 Forward -18 -8 3.91327 0.296
NP_442622.1_8 Reverse -240 -258 -19.0571 0.296
NP_442515.1_1 Forward -250 -236 12.8809 0.0308
NP_442515.1_1 Reverse -239 -253 2.94952 0.128
NP_442689.1_8 Reverse -93 -110 -8.41762 0.294
NP_440940.1_7 Reverse -230 -248 3.45998 0.274
NP_441349.1_10 Forward -259 -240 1.47442 0.0833
NP_441409.1_6 Reverse -234 -253 -15.0452 0.275
NP_441394.1_10 Reverse -359 -377 11.7197 0.263
NP_440432.1_9 Forward -248 -233 9.518 0.0423
NP_440432.1_9 Reverse -241 -256 5.48643 0.055
NP_442843.1_1 Forward -190 -171 -11.2103 0.286
NP_439960.1_6 Forward -135 -116 12.0942 0.186
NP_440474.1_8 Reverse -241 -255 6.58715 0.222
NP_440474.1_8 Forward -248 -234 4.52221 0.276
NP_440431.1_4 Forward -269 -250 -0.716613 0.207
NP_442450.1_5 Reverse -238 -248 19.1546 0.0103
NP_442450.1_5 Forward -349 -339 4.79825 0.287
NP_439950.1_1 Forward -222 -213 13.4711 0.277
NP_441873.1_2 Forward -74 -55 21.1406 0.0179
NP_441570.1_1 Reverse -327 -345 -11.9772 0.206
NP_441570.1_1 Reverse -240 -258 -16.7954 0.254
NP_441570.1_1 Forward -249 -231 -17.0904 0.264
NP_440078.1_10 Reverse -327 -346 9.93088 0.189
NP_441078.1_4 Forward -249 -240 19.6659 0.0007
NP_441078.1_4 Reverse -240 -249 19.6659 0.0007
NP_441078.1_4 Forward -191 -182 6.09625 0.0863
NP_441078.1_4 Reverse -294 -303 -1.47524 0.266
NP_441078.1_4 Reverse -15 -24 -1.86856 0.272
NP_441078.1_4 Reverse -182 -191 -2.06522 0.295
NP_442729.1_8 Reverse -236 -249 10.4424 0.125
NP_442348.1_2 Reverse -195 -204 14.7494 0.146
NP_442443.1_1 Forward -385 -366 -5.31042 0.282
NP_440526.1_3 Forward -128 -117 10.0879 0.0669
NP_440526.1_3 Reverse -241 -252 2.02482 0.267
NP_440526.1_3 Forward -248 -237 1.6315 0.267
NP_440526.1_3 Reverse -16 -27 0.156538 0.297
NP_441432.1_8 Forward -192 -183 12.7828 0.0354
NP_441432.1_8 Reverse -239 -248 8.35786 0.0755
NP_441432.1_8 Forward -250 -241 8.25953 0.0755
NP_442320.1_8 Forward -255 -241 14.4542 0.0132
NP_442320.1_8 Reverse -234 -248 3.73617 0.0578
NP_440760.1_1 Forward -191 -172 -12.3902 0.0929
NP_442797.1_7 Forward -142 -124 -0.374176 0.282
NP_441057.1_3 Reverse -285 -304 -11.9969 0.25
NP_442353.1_4 Forward -146 -127 8.25844 0.156
NP_442489.1_7 Forward -249 -240 20.1576 0.000695
NP_442489.1_7 Reverse -240 -249 20.1576 0.000695
NP_442489.1_7 Forward -24 -15 5.01461 0.0832
NP_442489.1_7 Forward -191 -182 -1.6719 0.235
NP_442489.1_7 Reverse -294 -303 -1.6719 0.235
NP_442489.1_7 Forward -303 -294 -1.96689 0.28
NP_440559.1_1 Forward -248 -239 17.306 0.00658
NP_440559.1_1 Reverse -241 -250 8.75118 0.0586
NP_440559.1_1 Reverse -9 -18 4.91628 0.175
NP_441659.2_8 Forward -249 -239 19.3512 0.000966
NP_441659.2_8 Reverse -240 -250 11.9764 0.0147
NP_441659.2_8 Forward -17 -7 4.60159 0.13
NP_442008.1_2 Forward -382 -363 4.03102 0.245
NP_441800.1_3 Forward -190 -172 5.23069 0.286
NP_440779.1_5 Forward -249 -232 -14.5141 0.246
NP_442346.1_5 Reverse -239 -249 17.9746 0.00128
NP_442346.1_5 Forward -192 -182 10.5014 0.0934
NP_442346.1_5 Forward -250 -240 9.02648 0.118
NP_442346.1_5 Reverse -293 -303 4.79825 0.272
NP_440545.1_3 Forward -195 -178 0.432165 0.139
NP_440025.1_4 Reverse -361 -380 11.7008 0.234
NP_440831.1_3 Forward -388 -369 13.9592 0.118
NP_442603.1_7 Forward -249 -235 7.17714 0.211
NP_442603.1_7 Reverse -327 -341 5.80051 0.273
NP_441888.1_7 Forward -254 -240 12.0943 0.0743
NP_441050.1_5 Reverse -117 -135 -1.06249 0.26
NP_441948.1_4 Reverse -233 -251 5.91901 0.0698
NP_441833.1_4 Forward -248 -241 15.9687 0.0124
NP_441833.1_4 Reverse -241 -248 15.9687 0.0124
NP_442162.1_9 Forward -248 -241 16.2637 0.0124
NP_442162.1_9 Reverse -241 -248 16.2637 0.0124
NP_440671.1_4 Forward -255 -241 6.29277 0.252
NP_441973.1_1 Reverse -129 -144 1.06154 0.235
NP_442140.1_3 Reverse -241 -251 14.238 0.0486
NP_442140.1_3 Forward -248 -238 5.68323 0.198
NP_440875.1_9 Reverse -242 -252 16.6457 0.0145
NP_441813.1_5 Forward -251 -241 19.4496 0.00647
NP_441813.1_5 Reverse -238 -248 16.1063 0.01
NP_440590.1_4 Reverse -9 -22 7.6891 0.05
NP_440590.1_4 Reverse -241 -254 4.8375 0.0585
NP_440590.1_4 Reverse -387 -400 -5.09393 0.274
NP_440567.1_1 Forward -248 -234 3.73617 0.137
NP_440567.1_1 Reverse -241 -255 1.17956 0.214
NP_442497.1_10 Forward -248 -239 19.8626 0.00532
NP_442497.1_10 Reverse -241 -250 10.4228 0.0087
NP_440821.1_4 Reverse -238 -248 19.8429 0.00399
NP_440821.1_4 Forward -251 -241 10.2065 0.0163
NP_440821.1_4 Reverse -180 -190 -0.314959 0.251
NP_441239.1_9 Forward -251 -239 17.7386 0.0146
NP_441239.1_9 Reverse -238 -250 14.297 0.0288
NP_441239.1_9 Reverse -180 -192 3.38223 0.285
NP_441892.1_1 Forward -200 -183 -0.846137 0.192
NP_440604.1_6 Reverse -120 -139 -3.44213 0.225
NP_440796.1_3 Reverse -233 -251 10.0481 0.204
NP_440354.1_7 Reverse -234 -252 5.72234 0.297
NP_442138.1_10 Reverse -240 -259 2.55606 0.119
NP_440546.1_4 Forward -249 -239 12.8578 0.0572
NP_440546.1_4 Reverse -240 -250 11.8882 0.0679
NP_440462.1_6 Forward -251 -241 17.2863 0.00752
NP_440462.1_6 Reverse -238 -248 7.84651 0.0699
NP_440462.1_6 Forward -323 -313 2.7333 0.278
NP_442465.1_1 Reverse -256 -275 1.47442 0.229
NP_441184.1_3 Reverse -324 -343 1.0811 0.296
NP_440868.1_4 Forward -253 -241 10.3637 0.0388
NP_440868.1_4 Reverse -61 -73 2.59558 0.151
NP_440868.1_4 Reverse -236 -248 -0.846001 0.282
NP_441497.1_3 Forward -141 -122 -0.000545616 0.2
NP_442923.1_4 Forward -191 -172 3.6377 0.134
NP_442039.1_4 Forward -248 -241 15.1821 0.0124
NP_442039.1_4 Reverse -241 -248 15.1821 0.0124
NP_442039.1_7 Forward -329 -319 7.64985 0.273
NP_441926.1_3 Forward -249 -233 5.46674 0.17
NP_441926.1_3 Reverse -15 -31 4.28677 0.193
NP_442837.1_3 Forward -248 -241 15.7721 0.0124
NP_442837.1_3 Reverse -241 -248 15.7721 0.0124
NP_442053.1_1 Forward -249 -240 18.3876 0.0007
NP_442053.1_1 Reverse -240 -249 18.3876 0.0007
NP_440505.1_3 Forward -251 -241 15.9097 0.00857
NP_440505.1_3 Reverse -238 -248 7.55152 0.151
NP_441203.1_1 Forward -248 -229 -3.73712 0.0718
NP_440914.1_1 Reverse -294 -304 12.0308 0.0684
NP_440914.1_1 Forward -17 -7 11.5428 0.0887
NP_440914.1_1 Forward -134 -124 9.49342 0.186
NP_440914.1_1 Reverse -240 -250 8.6151 0.186
NP_440914.1_1 Forward -249 -239 8.51751 0.186
NP_441011.1_8 Reverse -241 -250 16.9127 0.00602
NP_441011.1_8 Forward -248 -239 14.356 0.0249
NP_442101.1_10 Forward -257 -238 -13.1769 0.288
NP_442533.1_6 Forward -249 -240 17.2076 0.00137
NP_442533.1_6 Reverse -240 -249 17.2076 0.00137
NP_442533.1_6 Forward -17 -8 4.22796 0.186
NP_442533.1_6 Reverse -120 -129 1.76968 0.289
NP_442322.1_4 Forward -137 -120 -1.04349 0.226
NP_441482.1_7 Reverse -234 -248 5.99778 0.0364
NP_441482.1_7 Forward -255 -241 -12.1934 0.29
NP_439944.1_9 Forward -248 -238 17.3846 0.00516
NP_439944.1_9 Forward -190 -180 9.91146 0.0963
NP_442202.1_10 Reverse -181 -195 3.73617 0.278
NP_440007.1_9 Reverse -323 -337 8.94771 0.171
NP_440007.1_9 Forward -21 -7 7.17775 0.213
NP_441680.1_4 Forward -340 -321 0.786102 0.246
NP_441972.1_3 Forward -337 -318 13.5691 0.228
NP_441106.1_1 Forward -250 -241 18.191 0.0028
NP_441106.1_1 Reverse -239 -248 9.73449 0.0311
NP_441106.1_1 Forward -192 -183 5.50626 0.145
NP_440429.1_2 Forward -23 -4 8.35759 0.272
NP_442306.1_10 Forward -254 -235 -20.3551 0.208
NP_441286.1_1 Forward -250 -238 14.3953 0.00424
NP_441286.1_1 Reverse -239 -251 -3.40261 0.145
NP_440670.1_8 Forward -249 -240 18.3876 0.000699
NP_440670.1_8 Reverse -240 -249 18.3876 0.000699
NP_440670.1_8 Reverse -8 -17 5.11294 0.171
NP_440670.1_8 Forward -17 -8 4.12963 0.204
NP_440886.1_7 Forward -250 -240 17.7774 0.0011
NP_440886.1_7 Reverse -239 -249 8.04271 0.0805
NP_440886.1_7 Reverse -166 -176 3.91283 0.26
NP_442072.1_9 Reverse -239 -257 -21.5153 0.209
NP_441753.1_10 Reverse -231 -250 14.8474 0.0707
NP_440907.2_8 Forward -248 -238 9.81266 0.103
NP_440907.2_8 Reverse -241 -251 7.94438 0.117
NP_440907.2_8 Reverse -16 -26 5.38779 0.203
NP_440907.2_8 Forward -16 -6 4.89613 0.235
NP_441021.1_1 Forward -248 -229 -10.0303 0.227
NP_441021.1_8 Reverse -235 -253 6.50899 0.205
NP_441021.1_8 Forward -254 -236 3.75572 0.226
NP_440841.1_4 Reverse -238 -257 -4.22878 0.185
NP_441463.1_3 Forward -259 -240 -0.787193 0.133
NP_441463.1_3 Reverse -230 -249 -5.60541 0.23
NP_441463.1_5 Reverse -239 -253 10.816 0.263
NP_441626.1_2 Forward -248 -241 15.7721 0.0124
NP_441626.1_2 Reverse -241 -248 15.7721 0.0124
NP_442615.1_1 Reverse -231 -249 -2.3408 0.143
NP_442615.1_1 Forward -26 -8 -4.30741 0.183
NP_441962.1_4 Forward -380 -361 -9.93197 0.222
NP_441962.1_4 Forward -190 -171 -13.0786 0.268
NP_440387.1_1 Forward -249 -233 8.515 0.0282
NP_441431.1_2 Forward -252 -238 9.14375 0.192
NP_441993.1_1 Forward -309 -290 0.874656 0.29
NP_440814.1_8 Forward -377 -358 1.47442 0.269
NP_440114.1_10 Reverse -240 -254 15.7325 0.0234
NP_440114.1_10 Forward -249 -235 13.9626 0.0464
NP_440114.1_10 Forward -191 -177 10.0294 0.155
NP_440114.1_10 Forward -241 -227 5.99778 0.289
NP_442323.1_7 Forward -196 -177 5.30853 0.207
NP_440287.1_5 Reverse -371 -390 8.06178 0.286
NP_440766.1_4 Forward -399 -385 8.16106 0.0871
NP_440766.1_4 Reverse -61 -75 7.07942 0.097
NP_441237.1_9 Reverse -9 -19 11.3864 0.184
NP_442930.1_1 Forward -205 -195 15.9091 0.19
NP_442930.1_1 Forward -285 -275 10.501 0.276
NP_439910.1_2 Forward -257 -240 -12.4492 0.0863
NP_439910.1_2 Reverse -232 -249 -21.4956 0.183
NP_440457.1_1 Reverse -236 -248 9.87208 0.092
NP_440457.1_1 Forward -253 -241 -0.649339 0.271
NP_442509.1_9 Forward -249 -239 17.3841 0.00128
NP_442509.1_9 Reverse -240 -250 16.2041 0.00739
NP_440554.1_4 Reverse -241 -251 16.4996 0.0189
NP_440554.1_4 Forward -248 -238 6.96153 0.107
NP_440554.1_4 Forward -16 -6 4.60159 0.185
NP_441845.1_5 Reverse -214 -233 20.0644 0.121
NP_441885.1_5 Reverse -240 -250 11.4848 0.00668
NP_441885.1_5 Forward -249 -239 11.3864 0.00668
NP_441885.1_5 Reverse -8 -18 -0.904945 0.241
NP_440649.2_8 Forward -383 -369 9.93102 0.265
NP_442341.1_7 Forward -250 -236 6.3911 0.127
NP_442341.1_7 Forward -186 -172 4.32615 0.194
NP_442341.1_9 Reverse -6 -20 13.5686 0.0798
NP_442341.1_9 Forward -251 -237 11.1104 0.13
NP_440423.1_6 Reverse -232 -251 -13.8652 0.224
NP_443000.1_7 Forward -251 -241 11.5831 0.0344
NP_443000.1_7 Reverse -238 -248 8.82982 0.0437
NP_440507.2_3 Reverse -231 -250 14.3549 0.13
NP_441842.1_10 Reverse -233 -247 10.6193 0.157
NP_441842.1_10 Forward -198 -184 10.226 0.167
NP_440275.1_3 Forward -251 -241 15.418 0.0178
NP_440275.1_3 Reverse -238 -248 10.0098 0.0454
NP_440091.1_1 Forward -253 -241 10.7571 0.0429
NP_440091.1_1 Reverse -236 -248 -0.354346 0.273
NP_441902.1_3 Forward -270 -260 11.7184 0.293
NP_443010.1_10 Reverse -153 -170 2.86743 0.269
NP_442451.1_2 Reverse -148 -167 -1.47551 0.172
NP_441122.1_1 Reverse -127 -142 4.30646 0.28
NP_441207.1_7 Forward -263 -249 12.3534 0.241
NP_440149.1_8 Forward -249 -230 -5.11376 0.219
NP_441105.1_3 Forward -260 -241 2.55606 0.102
NP_441105.1_3 Forward -202 -183 -6.1954 0.23
NP_440216.1_1 Reverse -240 -254 16.1259 0.00307
NP_440216.1_1 Forward -249 -235 5.30946 0.0215
NP_440216.1_1 Forward -303 -289 -11.9968 0.236
NP_440216.1_9 Forward -138 -129 7.17789 0.286
NP_440172.1_1 Forward -249 -239 16.303 0.00854
NP_440172.1_1 Reverse -240 -250 8.73149 0.0586
NP_440172.1_1 Reverse -294 -304 7.15819 0.0897
NP_440249.1_2 Forward -290 -280 15.7125 0.268
NP_442015.1_10 Forward -340 -327 6.60746 0.111
NP_442015.1_10 Forward -253 -240 3.16588 0.185
NP_442015.1_10 Reverse -236 -249 1.39592 0.204
NP_441226.1_7 Forward -248 -241 14.4934 0.0123
NP_441226.1_7 Reverse -241 -248 14.4934 0.0123
NP_441226.1_7 Forward -16 -9 8.59356 0.197
NP_441757.1_3 Forward -250 -231 6.58763 0.138
NP_441111.1_7 Forward -248 -240 18.7023 0.00294
NP_441111.1_7 Reverse -241 -249 18.7023 0.00294
NP_441766.1_2 Forward -249 -240 17.5026 0.00297
NP_441766.1_2 Reverse -240 -249 17.5026 0.00297
NP_442252.1_3 Forward -256 -238 17.7187 0.0602
NP_440416.1_1 Reverse -240 -259 -5.80207 0.158
NP_440416.1_9 Forward -310 -291 -18.9784 0.267
NP_440416.1_9 Reverse -375 -394 -20.2567 0.283
NP_443052.1_8 Reverse -230 -249 1.76941 0.0593
NP_443052.1_8 Forward -259 -240 -11.3086 0.226
NP_443052.1_9 Reverse -364 -383 -5.70374 0.273
NP_441974.1_3 Reverse -188 -205 13.8538 0.3
NP_440591.1_9 Reverse -233 -251 9.36059 0.155
NP_441430.1_6 Reverse -115 -134 9.93088 0.288
NP_440261.1_5 Forward -248 -235 -10.2071 0.201
NP_440261.1_5 Reverse -241 -254 -12.1738 0.272
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

TCGCTGTAGATCGGTGGACAGGGGGAGCTGCCGAAGGAATGCTTTACAGCGTGCTCGAACCCATTGGGGTCACCTGGGAACCGATCCAAGTTCACTTGGACATTGCCCGTCTCAAAAATTATTACCACGGTAAGGAAGAAAAACTTAAACCGGCGATCGCCCTATTGCTTCTTGTATTGCGGGATTTAGCTAACAAAAAAATTCCCGTAGGCTATGGCACTAACCGCGGTATGGGAACGATTACTGTCAGTCAAATCACCCTCAATGGCAAAGCCCTCCCCACTGAACTTGAACCTTTAAACAAAACAATGACTTGTCCTAATCTCACCGATCTAGATGAGGCATTTCGTCAGGACTTAAGCACTGCTTGGAAAGAGTGGATTGCCGATCCCATTGATCT

CDS

ATGCCAGCAGGAGGCCGCCTAATGAAGAACCTTTACCACTACCACCAATATGAAATTACCCTCGAATCCGCCGTCGATTCTTGCAAAAACCATCTCCAAGCGGCGATCGGGCTGTTGTATTCTCCCCAAAAGTGTGAACTAGTCAAACTGGATAACTCAGGCAAGTTAGTTGATTCTTACAATCGTCTTAAGTTCAATAACCTAGGCGTATTTGAAGCCCGCTTCTTTAATCTCAATTGTGAACTGCGATGGGTCAATGAATCTAATGGTAATGGCACTGCCGTCTTGCTTTCAGAATCGGATATTACCTTAACTGGTTTTGAGAAAGGTTTACAGGAATTTATTACGGCGATCGACCAACAGTATTTACTCTGGGGTGAACCCGCTAAACATCCCCCTAATGCTGATGGCTGGCAACGACTAGCGGAAGCAAGGATCGGGAAACTCGATATTCCCCTCGATAACCCGTTAAAACCCAAAGATCGAGTTTTTCTCACCAGCGAAGAGTACATTGCTGAAGTAGATGATTTTGGTAATTGTGCCGTTATTGACGAACGTTTAATTAAATTGGAGGTTAAGTAA

Protein

No sequence available