Your browser is old and dusty. Try Google Chrome!

Details for sll7033

ORF sll7033
Accession NP_942321.1
Symbol
Category
Definition
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_441061.1_2 Forward -399 -385 -0.000409212 0.219
NP_440795.1_7 Forward -399 -392 14.6904 0.0123
NP_440795.1_7 Reverse -392 -399 14.6904 0.0123
NP_440795.1_7 Forward -311 -304 14.6904 0.0123
NP_440795.1_7 Reverse -304 -311 14.6904 0.0123
NP_441418.1_6 Forward -400 -381 -18.9784 0.0841
NP_441418.1_6 Forward -59 -40 -22.3217 0.175
NP_442291.1_5 Forward -313 -297 -2.39974 0.215
NP_442291.1_5 Reverse -302 -318 -4.36636 0.272
NP_440897.1_6 Forward -400 -381 2.9486 0.156
NP_441453.1_4 Reverse -391 -399 16.539 0.00633
NP_441453.1_4 Reverse -303 -311 16.539 0.00633
NP_441453.1_4 Forward -400 -392 16.539 0.00633
NP_441453.1_4 Forward -312 -304 16.539 0.00633
NP_442151.1_6 Forward -400 -386 11.111 0.108
NP_442151.1_6 Forward -312 -298 8.45605 0.172
NP_442151.1_6 Reverse -303 -317 6.6861 0.224
NP_441818.1_1 Forward -311 -300 10.1862 0.232
NP_441818.1_1 Reverse -304 -315 9.20294 0.25
NP_440226.1_1 Forward -312 -293 7.57094 0.103
NP_441465.1_8 Reverse -366 -384 7.00065 0.246
NP_442744.1_8 Forward -400 -381 -6.29373 0.297
NP_442173.1_1 Forward -399 -391 15.4574 0.00633
NP_442173.1_1 Forward -311 -303 15.4574 0.00633
NP_442173.1_1 Reverse -392 -400 15.4574 0.00633
NP_442173.1_1 Reverse -304 -312 15.4574 0.00633
NP_442752.1_4 Forward -400 -393 13.8055 0.0199
NP_442752.1_4 Reverse -391 -398 13.8055 0.0199
NP_442752.1_4 Forward -312 -305 13.8055 0.0199
NP_442752.1_4 Reverse -303 -310 13.8055 0.0199
NP_442752.1_4 Forward -191 -184 7.90559 0.144
NP_443027.1_4 Forward -314 -304 13.2547 0.0521
NP_443027.1_4 Reverse -389 -399 5.87989 0.294
NP_441812.1_3 Reverse -302 -316 10.9143 0.215
NP_442975.1_10 Reverse -299 -313 10.9137 0.0516
NP_442975.1_10 Forward -316 -302 3.93223 0.249
NP_440784.1_7 Forward -399 -392 15.9687 0.0123
NP_440784.1_7 Reverse -392 -399 15.9687 0.0123
NP_440784.1_7 Forward -311 -304 15.9687 0.0123
NP_440784.1_7 Reverse -304 -311 15.9687 0.0123
NP_442909.1_8 Reverse -131 -144 20.8655 0.254
NP_441934.1_9 Reverse -35 -54 13.2741 0.227
NP_440110.1_4 Reverse -380 -399 1.57275 0.278
NP_441054.1_2 Forward -122 -103 11.7992 0.257
NP_440878.1_9 Reverse -381 -400 5.01433 0.174
NP_442062.1_8 Forward -400 -390 19.4496 0.000558
NP_442062.1_8 Forward -312 -302 17.3846 0.00193
NP_442062.1_8 Reverse -303 -313 10.3048 0.0493
NP_441900.1_2 Reverse -14 -32 -3.42315 0.279
NP_440304.1_4 Forward -314 -304 10.8948 0.051
NP_440304.1_4 Reverse -389 -399 1.84832 0.299
NP_440304.1_4 Reverse -301 -311 1.84832 0.299
NP_442242.1_4 Forward -399 -392 14.3954 0.0124
NP_442242.1_4 Reverse -392 -399 14.3954 0.0124
NP_442242.1_4 Forward -311 -304 14.3954 0.0124
NP_442242.1_4 Reverse -304 -311 14.3954 0.0124
NP_440044.1_8 Forward -311 -292 8.94757 0.0723
NP_441781.1_7 Forward -312 -293 2.85105 0.199
NP_441581.1_1 Reverse -128 -145 17.8367 0.157
NP_440011.1_1 Forward -288 -269 11.5042 0.27
NP_439918.1_2 Forward -159 -140 -3.63879 0.258
NP_441935.1_1 Forward -379 -360 20.354 0.0873
NP_440307.1_4 Reverse -205 -224 10.5209 0.287
NP_441208.1_9 Reverse -300 -314 13.6676 0.103
NP_442742.1_9 Reverse -362 -381 -13.1769 0.269
NP_442742.1_9 Reverse -17 -36 -13.5702 0.274
NP_442110.1_7 Forward -400 -386 3.34284 0.21
NP_441925.1_4 Reverse -134 -153 -14.8492 0.263
NP_441083.1_5 Forward -312 -302 20.3345 0.00053
NP_441083.1_5 Forward -400 -390 11.3864 0.0159
NP_441083.1_5 Reverse -303 -313 11.2881 0.0159
NP_442827.1_10 Reverse -125 -144 18.289 0.248
NP_441434.1_7 Reverse -305 -319 6.09611 0.225
NP_441738.1_2 Forward -398 -391 15.28 0.0102
NP_441738.1_2 Reverse -393 -400 15.28 0.0102
NP_441738.1_2 Forward -310 -303 15.28 0.0102
NP_441738.1_2 Reverse -305 -312 15.28 0.0102
NP_441558.1_5 Forward -314 -295 12.5858 0.0675
NP_440209.1_1 Reverse -391 -399 18.1123 0.00295
NP_440209.1_1 Reverse -303 -311 18.1123 0.00295
NP_440209.1_1 Forward -400 -392 18.1123 0.00295
NP_440209.1_1 Forward -312 -304 18.1123 0.00295
NP_442889.1_1 Forward -261 -242 -2.95047 0.145
NP_442889.1_8 Forward -315 -301 20.3534 0.00446
NP_440447.1_6 Forward -91 -73 1.69077 0.261
NP_441713.1_8 Forward -88 -70 11.1305 0.244
NP_441770.1_1 Reverse -233 -252 11.2084 0.277
NP_440178.1_7 Reverse -62 -81 -20.65 0.196
NP_440178.1_7 Reverse -302 -321 -21.4367 0.223
NP_440178.1_7 Forward -313 -294 -22.0267 0.249
NP_441716.1_1 Forward -53 -39 8.25939 0.145
NP_441327.1_4 Reverse -296 -310 14.5526 0.282
NP_442111.1_4 Reverse -302 -316 4.32615 0.212
NP_441163.1_1 Reverse -383 -400 8.69123 0.226
NP_441495.1_1 Reverse -36 -55 14.6508 0.193
NP_440343.1_3 Reverse -236 -254 2.96833 0.285
NP_440851.1_1 Reverse -111 -130 14.6499 0.257
NP_440906.1_5 Forward -399 -392 15.8704 0.0124
NP_440906.1_5 Reverse -392 -399 15.8704 0.0124
NP_440906.1_5 Forward -311 -304 15.8704 0.0124
NP_440906.1_5 Reverse -304 -311 15.8704 0.0124
NP_440747.1_10 Reverse -388 -400 15.1819 0.00196
NP_440747.1_10 Reverse -300 -312 14.9853 0.00221
NP_440747.1_10 Forward -315 -303 7.4138 0.00422
NP_440747.1_10 Reverse -135 -147 -12.0557 0.199
NP_441130.1_10 Reverse -301 -315 6.98109 0.173
NP_441486.1_1 Reverse -300 -314 6.29277 0.0344
NP_441486.1_1 Forward -315 -301 6.19444 0.0344
NP_442634.1_4 Forward -314 -300 -1.96703 0.149
NP_441265.1_3 Reverse -385 -399 2.85119 0.181
NP_440403.1_4 Forward -321 -302 -8.94866 0.264
NP_441014.1_8 Reverse -269 -288 -2.36049 0.232
NP_441014.1_8 Reverse -378 -397 -7.17871 0.276
NP_441014.1_10 Reverse -302 -321 2.16195 0.216
NP_442848.1_1 Reverse -297 -311 -2.36035 0.263
NP_443018.1_3 Forward -399 -392 14.8871 0.0123
NP_443018.1_3 Reverse -392 -399 14.8871 0.0123
NP_443018.1_3 Forward -311 -304 14.8871 0.0123
NP_443018.1_3 Reverse -304 -311 14.8871 0.0123
NP_441634.1_8 Forward -314 -300 -4.32697 0.295
NP_441634.1_8 Reverse -301 -315 -4.62196 0.295
NP_440376.1_1 Forward -400 -391 19.4693 0.000692
NP_440376.1_1 Reverse -391 -400 19.4693 0.000692
NP_440376.1_1 Forward -312 -303 19.4693 0.000692
NP_440376.1_1 Reverse -303 -312 19.4693 0.000692
NP_441588.1_4 Forward -310 -300 18.1713 0.0143
NP_441588.1_4 Forward -398 -388 7.35486 0.178
NP_441588.1_4 Reverse -305 -315 6.76487 0.185
NP_440580.1_4 Forward -148 -129 5.99764 0.261
NP_442687.1_7 Reverse -390 -400 15.8113 0.0125
NP_442687.1_7 Forward -313 -303 9.02648 0.0994
NP_442687.1_7 Reverse -302 -312 8.92815 0.0994
NP_441797.1_7 Forward -50 -32 10.0489 0.292
NP_441846.1_10 Forward -279 -260 -23.7966 0.298
NP_442958.1_3 Forward -323 -304 -1.96717 0.293
NP_442530.1_1 Forward -248 -229 4.62101 0.291
NP_440642.1_10 Reverse -375 -389 15.1419 0.119
NP_441746.1_9 Reverse -127 -146 21.6323 0.0987
NP_441950.1_7 Forward -65 -46 -8.94866 0.287
NP_442296.1_5 Reverse -252 -271 0.392778 0.289
NP_442296.1_9 Forward -311 -292 1.47442 0.197
NP_442658.1_1 Reverse -389 -399 15.9091 0.00966
NP_442658.1_1 Forward -314 -304 14.2375 0.0237
NP_442658.1_1 Reverse -301 -311 6.76441 0.214
NP_442782.1_2 Reverse -256 -270 0.982901 0.282
NP_440656.1_8 Forward -323 -304 -2.0655 0.184
NP_441414.1_9 Forward -312 -293 -3.83545 0.143
NP_441414.1_9 Forward -400 -381 -9.73531 0.266
NP_440720.1_1 Reverse -380 -399 2.16274 0.263
NP_442937.1_5 Forward -199 -180 11.9958 0.123
NP_442937.1_5 Reverse -298 -317 9.0459 0.204
NP_441958.1_5 Forward -313 -303 21.2195 0.000805
NP_441958.1_5 Reverse -390 -400 12.2714 0.00183
NP_441958.1_5 Reverse -302 -312 12.2714 0.00183
NP_441127.1_1 Reverse -216 -230 7.66941 0.3
NP_442836.1_5 Forward -318 -299 9.93088 0.123
NP_442836.1_5 Reverse -297 -316 1.57275 0.28
NP_439905.1_1 Reverse -304 -317 9.06573 0.224
NP_439905.1_2 Reverse -127 -141 10.521 0.214
NP_440984.1_7 Reverse -386 -400 9.63603 0.127
NP_440984.1_7 Forward -317 -303 9.34103 0.127
NP_440984.1_7 Reverse -298 -312 5.30946 0.259
NP_440984.1_7 Reverse -264 -278 5.01447 0.276
NP_439990.1_5 Forward -317 -304 15.5556 0.0534
NP_442911.1_2 Reverse -293 -312 -9.14533 0.25
NP_442911.1_2 Reverse -381 -400 -9.63698 0.26
NP_440153.1_8 Reverse -240 -253 -2.24233 0.235
NP_442064.1_1 Forward -178 -159 -6.58872 0.223
NP_443055.1_3 Forward -379 -360 14.9422 0.111
NP_443055.1_6 Reverse -295 -313 2.96833 0.201
NP_441099.1_5 Reverse -293 -312 -11.8986 0.291
NP_442002.1_1 Reverse -195 -213 -6.86402 0.249
NP_442002.1_1 Forward -131 -113 -9.0273 0.272
NP_442002.1_9 Forward -26 -19 11.1505 0.185
NP_442002.1_9 Reverse -390 -397 10.7572 0.185
NP_441294.1_7 Reverse -299 -313 14.434 0.0428
NP_441294.1_7 Forward -316 -302 9.92255 0.219
NP_441646.1_1 Reverse -202 -221 3.34271 0.207
NP_442438.1_10 Reverse -386 -400 11.111 0.0463
NP_441000.1_6 Reverse -302 -316 -3.44199 0.221
NP_441000.1_6 Forward -313 -299 -4.52363 0.245
NP_440147.1_4 Reverse -301 -314 18.4072 0.00407
NP_440147.1_4 Forward -314 -301 10.344 0.0355
NP_441550.1_8 Forward -314 -304 15.8108 0.0132
NP_441550.1_8 Reverse -301 -311 14.6309 0.0132
NP_441550.1_8 Reverse -389 -399 8.3377 0.124
NP_441550.1_8 Reverse -382 -392 4.7978 0.283
NP_441916.1_7 Reverse -303 -313 18.9579 0.00144
NP_441916.1_7 Forward -400 -390 18.4663 0.00144
NP_441916.1_7 Forward -312 -302 10.3048 0.0261
NP_440465.1_10 Reverse -203 -222 -0.39387 0.29
NP_441041.1_4 Forward -400 -381 -6.09707 0.163
NP_441041.1_4 Forward -255 -236 -6.98204 0.179
NP_441041.1_4 Forward -312 -293 -13.1769 0.282
NP_441041.1_7 Forward -315 -303 16.6495 0.0131
NP_441041.1_7 Reverse -388 -400 15.6777 0.0222
NP_441041.1_7 Reverse -300 -312 11.8878 0.0689
NP_441725.1_5 Forward -399 -389 2.04498 0.115
NP_441725.1_5 Forward -311 -301 2.04498 0.115
NP_441725.1_5 Reverse -304 -314 1.94665 0.115
NP_439966.1_7 Forward -314 -304 14.3359 0.0203
NP_439966.1_7 Reverse -389 -399 9.91099 0.0968
NP_439966.1_7 Reverse -301 -311 7.25606 0.15
NP_439966.1_8 Reverse -12 -31 6.58763 0.271
NP_439966.1_9 Reverse -389 -398 0.884706 0.253
NP_440736.1_3 Forward -314 -295 -0.0988766 0.282
NP_440202.1_8 Forward -320 -301 13.7941 0.243
NP_442941.1_3 Reverse -304 -314 19.2529 0.00262
NP_442941.1_3 Forward -311 -301 11.0914 0.0116
NP_442941.1_3 Forward -399 -389 2.63497 0.14
NP_440289.1_2 Forward -315 -302 12.704 0.0139
NP_440289.1_2 Reverse -300 -313 -2.24233 0.253
NP_440289.1_4 Forward -374 -355 16.2241 0.126
NP_440983.1_5 Reverse -185 -204 10.3242 0.151
NP_440983.1_8 Forward -149 -130 18.4857 0.1
NP_440260.1_8 Reverse -382 -400 -7.35568 0.295
NP_441678.1_9 Forward -72 -53 0.491109 0.225
NP_442281.1_1 Reverse -386 -400 20.4518 0.00192
NP_442281.1_1 Reverse -298 -312 18.5835 0.00414
NP_442281.1_1 Forward -317 -303 7.76712 0.0927
NP_440437.1_1 Forward -318 -299 -0.000545616 0.173
NP_439983.1_7 Forward -116 -98 9.55725 0.287
NP_441087.1_5 Reverse -239 -258 2.26028 0.242
NP_441556.1_7 Reverse -360 -379 7.17681 0.171
NP_441556.1_10 Reverse -386 -400 13.0446 0.182
NP_440498.1_1 Reverse -294 -312 7.39397 0.0836
NP_440498.1_1 Reverse -382 -400 -0.669169 0.218
NP_442982.1_5 Reverse -381 -400 -2.36049 0.286
NP_441644.1_6 Reverse -303 -313 19.0557 0.000803
NP_441644.1_6 Forward -312 -302 17.3841 0.00127
NP_441644.1_6 Forward -400 -390 10.1076 0.0628
NP_442215.1_2 Forward -149 -133 -2.20308 0.193
NP_442215.1_2 Reverse -301 -317 -2.89139 0.206
NP_442215.1_2 Reverse -382 -398 -6.23465 0.266
NP_442029.1_6 Reverse -198 -217 2.65439 0.291
NP_440253.1_2 Reverse -303 -321 5.91901 0.0877
NP_440253.1_2 Forward -312 -294 5.42735 0.0933
NP_440929.1_8 Forward -400 -391 19.2726 0.000701
NP_440929.1_8 Reverse -391 -400 19.2726 0.000701
NP_440929.1_8 Forward -312 -303 19.2726 0.000701
NP_440929.1_8 Reverse -303 -312 19.2726 0.000701
NP_442933.1_10 Forward -400 -391 17.601 0.00325
NP_442933.1_10 Reverse -391 -400 17.601 0.00325
NP_442933.1_10 Forward -312 -303 17.601 0.00325
NP_442933.1_10 Reverse -303 -312 17.601 0.00325
NP_441751.2_8 Reverse -304 -318 9.83269 0.0311
NP_441751.2_8 Forward -311 -297 -3.147 0.134
NP_442554.1_8 Reverse -304 -314 17.2863 0.00543
NP_442554.1_8 Forward -311 -301 15.3197 0.00882
NP_442554.1_8 Forward -399 -389 13.2547 0.0187
NP_442554.1_8 Reverse -51 -61 1.74999 0.298
NP_441762.1_7 Forward -313 -301 0.530633 0.0747
NP_441762.1_7 Reverse -302 -314 -6.84419 0.284
NP_442142.1_4 Forward -315 -302 11.6217 0.054
NP_442142.1_4 Reverse -300 -313 11.5234 0.0552
NP_442292.1_1 Forward -311 -302 18.486 0.00229
NP_442292.1_1 Reverse -304 -313 17.5026 0.00435
NP_442292.1_1 Forward -399 -390 9.63616 0.0183
NP_442381.1_8 Forward -315 -296 -6.98204 0.175
NP_443009.1_5 Reverse -302 -313 14.5128 0.02
NP_443009.1_5 Forward -313 -302 10.1862 0.0792
NP_441715.1_4 Reverse -304 -314 16.7946 0.0106
NP_441715.1_4 Forward -399 -389 9.41981 0.097
NP_441715.1_4 Forward -311 -301 7.94484 0.107
NP_441448.1_2 Reverse -140 -159 -0.984623 0.266
NP_440183.1_9 Forward -57 -38 -5.31042 0.198
NP_440464.1_10 Forward -311 -301 13.0082 0.169
NP_441468.1_1 Forward -399 -392 15.8704 0.0124
NP_441468.1_1 Reverse -392 -399 15.8704 0.0124
NP_441468.1_1 Forward -311 -304 15.8704 0.0124
NP_441468.1_1 Reverse -304 -311 15.8704 0.0124
NP_441015.1_10 Forward -146 -127 -1.27885 0.172
NP_441015.1_10 Reverse -204 -223 -4.6221 0.209
NP_441015.1_10 Forward -152 -133 -11.6036 0.298
NP_441673.1_1 Forward -400 -391 20.8459 0.000698
NP_441673.1_1 Reverse -391 -400 20.8459 0.000698
NP_441673.1_1 Forward -312 -303 20.8459 0.000698
NP_441673.1_1 Reverse -303 -312 20.8459 0.000698
NP_441826.1_2 Reverse -385 -399 5.01447 0.0978
NP_441826.1_2 Forward -53 -39 2.45787 0.127
NP_441637.1_9 Forward -111 -93 -3.71743 0.296
NP_442868.1_6 Forward -314 -304 10.4031 0.038
NP_442868.1_6 Reverse -301 -311 9.81313 0.038
NP_442868.1_6 Reverse -389 -399 0.865012 0.205
NP_442719.1_2 Reverse -262 -280 -3.61981 0.2
NP_442719.1_2 Reverse -362 -380 -10.9946 0.286
NP_441612.1_2 Forward -312 -302 8.54929 0.21
NP_442361.1_3 Reverse -385 -398 17.6205 0.0481
NP_442427.1_8 Forward -321 -302 8.16093 0.203
NP_442808.1_1 Reverse -390 -400 18.4657 0.00201
NP_442808.1_1 Forward -313 -303 8.73102 0.0481
NP_442808.1_1 Reverse -302 -312 8.63269 0.0481
NP_441101.1_10 Reverse -127 -146 -0.787193 0.19
NP_441101.1_10 Reverse -241 -260 -3.73712 0.262
NP_440031.1_10 Forward -205 -186 11.6025 0.151
NP_442692.1_10 Forward -111 -98 14.5901 0.277
NP_440145.1_3 Forward -322 -303 -0.39387 0.14
NP_440145.1_3 Reverse -293 -312 -2.26216 0.166
NP_442050.1_1 Forward -272 -253 7.17762 0.275
NP_442050.1_5 Forward -314 -304 15.9091 0.0091
NP_442050.1_5 Reverse -301 -311 7.64939 0.243
NP_441493.2_10 Reverse -292 -311 5.50599 0.27
NP_441114.1_3 Reverse -146 -155 7.37455 0.239
NP_441114.1_3 Reverse -180 -189 6.39124 0.277
NP_441518.1_3 Reverse -293 -312 -14.1602 0.269
NP_441878.1_6 Forward -313 -303 10.5014 0.0176
NP_441878.1_6 Reverse -390 -400 10.4031 0.0176
NP_441878.1_6 Reverse -302 -312 10.4031 0.0176
NP_441878.1_6 Forward -60 -50 -7.68978 0.255
NP_441036.1_8 Reverse -390 -400 17.7779 0.000554
NP_441036.1_8 Forward -313 -303 15.713 0.00724
NP_441036.1_8 Reverse -302 -312 8.33817 0.174
NP_441557.1_5 Forward -400 -391 19.9609 0.000699
NP_441557.1_5 Reverse -391 -400 19.9609 0.000699
NP_441557.1_5 Forward -312 -303 19.9609 0.000699
NP_441557.1_5 Reverse -303 -312 19.9609 0.000699
NP_441557.1_8 Reverse -272 -282 11.9759 0.236
NP_441590.1_4 Reverse -235 -254 3.14526 0.29
NP_442066.2_4 Forward -400 -381 -6.88371 0.254
NP_442066.2_9 Forward -316 -303 19.6855 0.00844
NP_442192.1_4 Reverse -7 -26 10.2251 0.29
NP_442183.1_1 Forward -312 -298 7.76774 0.131
NP_442183.1_1 Reverse -303 -317 3.73617 0.299
NP_442166.1_7 Forward -399 -385 7.86607 0.264
NP_442397.1_9 Forward -312 -293 5.70265 0.246
NP_441116.1_9 Forward -340 -326 11.5043 0.277
NP_441574.1_1 Reverse -203 -222 -3.04881 0.234
NP_441549.1_9 Forward -197 -179 -10.6006 0.281
NP_442347.1_2 Forward -311 -302 12.4878 0.056
NP_442347.1_2 Forward -399 -390 11.1111 0.056
NP_442347.1_2 Reverse -304 -313 3.34298 0.284
NP_442645.1_2 Forward -320 -301 -12.3902 0.144
NP_442965.1_2 Forward -145 -126 -4.72043 0.255
NP_441037.1_4 Reverse -389 -399 14.7245 0.028
NP_441037.1_4 Reverse -301 -311 7.9999 0.237
NP_441037.1_4 Forward -314 -304 7.22024 0.237
NP_442594.1_8 Forward -388 -369 8.25926 0.206
NP_440151.1_2 Reverse -276 -294 14.0797 0.277
NP_442317.1_6 Forward -317 -298 4.22769 0.247
NP_441633.1_3 Reverse -301 -314 1.10092 0.109
NP_441633.1_3 Forward -314 -301 -3.71729 0.177
NP_440136.1_2 Forward -399 -392 15.9687 0.0123
NP_440136.1_2 Reverse -392 -399 15.9687 0.0123
NP_440136.1_2 Forward -311 -304 15.9687 0.0123
NP_440136.1_2 Reverse -304 -311 15.9687 0.0123
NP_442998.1_5 Forward -27 -17 9.22315 0.248
NP_442998.1_10 Forward -398 -391 15.5754 0.0102
NP_442998.1_10 Reverse -393 -400 15.5754 0.0102
NP_442998.1_10 Forward -310 -303 15.5754 0.0102
NP_442998.1_10 Reverse -305 -312 15.5754 0.0102
NP_440899.1_2 Forward -323 -304 17.5998 0.0462
NP_440899.1_5 Reverse -175 -194 4.62101 0.242
NP_440299.1_1 Reverse -387 -400 20.1765 0.00128
NP_440299.1_1 Reverse -299 -312 4.44361 0.207
NP_441799.1_1 Forward -316 -302 14.7486 0.0222
NP_441799.1_1 Reverse -299 -313 14.5519 0.0228
NP_441007.1_10 Forward -317 -304 4.8375 0.182
NP_441007.1_10 Reverse -298 -311 0.412608 0.23
NP_440256.1_1 Reverse -300 -319 8.55425 0.0235
NP_440256.1_1 Forward -315 -296 -2.55715 0.12
NP_441559.1_8 Reverse -386 -400 2.35953 0.145
NP_441559.1_8 Forward -317 -303 2.16287 0.147
NP_441559.1_8 Reverse -366 -380 1.86788 0.153
NP_441559.1_8 Reverse -308 -322 1.67122 0.155
NP_441559.1_8 Reverse -58 -72 -3.24533 0.199
NP_441559.1_8 Reverse -267 -281 -6.78525 0.279
NP_440915.1_6 Reverse -299 -313 3.93283 0.1
NP_440915.1_6 Forward -316 -302 1.67122 0.132
NP_442158.1_4 Forward -288 -278 10.8948 0.283
NP_440717.1_3 Reverse -272 -286 8.65209 0.26
NP_442785.1_7 Forward -314 -300 10.6193 0.228
NP_441464.1_1 Reverse -242 -261 7.96426 0.261
NP_441464.1_8 Forward -312 -298 4.91614 0.26
NP_442993.1_1 Reverse -303 -319 -2.10475 0.107
NP_442993.1_1 Forward -312 -296 -7.31629 0.146
NP_440677.1_6 Forward -125 -106 11.1109 0.25
NP_442386.1_9 Reverse -390 -399 15.7322 0.0144
NP_442386.1_9 Reverse -302 -311 13.8639 0.0289
NP_442386.1_9 Forward -313 -304 6.39082 0.219
NP_441340.1_5 Forward -399 -392 15.6737 0.0124
NP_441340.1_5 Reverse -392 -399 15.6737 0.0124
NP_441340.1_5 Forward -311 -304 15.6737 0.0124
NP_441340.1_5 Reverse -304 -311 15.6737 0.0124
NP_440327.1_6 Forward -165 -146 2.75272 0.29
NP_442240.1_1 Reverse -260 -279 5.80018 0.261
NP_442240.1_2 Forward -399 -380 -20.65 0.295
NP_440586.1_8 Forward -399 -392 13.2151 0.026
NP_440586.1_8 Forward -311 -304 13.2151 0.026
NP_440586.1_8 Reverse -392 -399 13.2151 0.026
NP_440586.1_8 Reverse -304 -311 13.2151 0.026
NP_440586.1_8 Reverse -171 -178 8.98688 0.188
NP_442251.1_6 Forward -399 -392 15.2804 0.0124
NP_442251.1_6 Reverse -392 -399 15.2804 0.0124
NP_442251.1_6 Forward -311 -304 15.2804 0.0124
NP_442251.1_6 Reverse -304 -311 15.2804 0.0124
NP_442959.1_5 Forward -113 -94 4.71934 0.3
NP_441912.1_2 Forward -141 -122 22.9 0.0293
NP_441912.1_3 Forward -134 -115 7.47261 0.27
NP_440684.1_9 Reverse -297 -311 12.0943 0.168
NP_440684.1_9 Forward -379 -365 9.73436 0.216
NP_441262.1_3 Reverse -391 -398 14.7888 0.0223
NP_441262.1_3 Reverse -303 -310 14.7888 0.0223
NP_441262.1_3 Forward -400 -393 14.7888 0.0223
NP_441262.1_3 Forward -312 -305 14.7888 0.0223
NP_440027.1_3 Forward -322 -304 8.27817 0.195
NP_443051.1_1 Forward -313 -304 19.5676 0.00335
NP_443051.1_1 Reverse -390 -399 10.4228 0.00754
NP_443051.1_1 Reverse -302 -311 10.4228 0.00754
NP_439937.1_9 Reverse -268 -285 -1.53514 0.124
NP_440439.1_1 Forward -315 -302 3.75586 0.11
NP_440372.1_2 Forward -399 -392 16.3621 0.0124
NP_440372.1_2 Reverse -392 -399 16.3621 0.0124
NP_440372.1_2 Forward -311 -304 16.3621 0.0124
NP_440372.1_2 Reverse -304 -311 16.3621 0.0124
NP_439977.1_5 Forward -219 -200 1.17943 0.195
NP_442384.1_8 Reverse -128 -147 11.4058 0.283
NP_442384.1_10 Forward -400 -387 15.7522 0.00946
NP_442384.1_10 Reverse -303 -316 9.65572 0.0508
NP_442384.1_10 Forward -312 -299 1.10092 0.268
NP_442262.1_10 Forward -399 -392 14.1988 0.0123
NP_442262.1_10 Reverse -392 -399 14.1988 0.0123
NP_442262.1_10 Forward -311 -304 14.1988 0.0123
NP_442262.1_10 Reverse -304 -311 14.1988 0.0123
NP_441689.1_5 Forward -314 -304 8.3377 0.132
NP_441689.1_5 Reverse -301 -311 5.78111 0.197
NP_440344.1_10 Forward -319 -302 -7.82764 0.119
NP_440344.1_10 Reverse -296 -313 -9.00761 0.137
NP_440282.1_10 Reverse -115 -134 -5.40875 0.25
NP_440282.1_10 Reverse -40 -59 -7.86702 0.254
NP_440531.1_6 Forward -320 -301 13.7658 0.0413
NP_442910.1_1 Reverse -296 -315 -6.1954 0.254
NP_442910.1_6 Reverse -378 -392 7.66941 0.24
NP_440562.1_3 Reverse -304 -321 5.84037 0.153
NP_440297.1_9 Forward -399 -389 -0.118297 0.282
NP_440297.1_9 Forward -311 -301 -0.118297 0.282
NP_440297.1_9 Reverse -304 -314 -0.216628 0.282
NP_442280.1_10 Reverse -128 -146 7.30503 0.268
NP_441592.1_4 Reverse -138 -157 6.39097 0.124
NP_441592.1_4 Forward -400 -381 -3.14714 0.275
NP_441896.1_3 Forward -321 -302 7.17762 0.0973
NP_440894.1_10 Reverse -264 -283 9.43923 0.16
NP_440894.1_10 Forward -108 -89 7.27595 0.205
NP_440999.1_9 Forward -316 -302 8.16106 0.0788
NP_440888.1_2 Reverse -303 -317 12.8803 0.0369
NP_440888.1_2 Forward -400 -386 9.83206 0.113
NP_440888.1_2 Forward -312 -298 7.66879 0.186
NP_440888.1_2 Reverse -272 -286 6.68548 0.223
NP_440888.1_2 Reverse -209 -223 6.19383 0.243
NP_440792.1_5 Forward -311 -292 5.99764 0.24
NP_442147.1_7 Reverse -204 -223 13.3725 0.223
NP_440052.1_3 Reverse -28 -47 15.7324 0.27
NP_440052.1_5 Reverse -380 -399 -2.55715 0.213
NP_442225.1_10 Reverse -381 -400 6.98015 0.281
NP_442948.1_2 Forward -313 -294 3.44104 0.283
NP_441543.1_2 Forward -399 -390 18.486 0.00236
NP_441543.1_2 Forward -311 -302 16.9127 0.00359
NP_441543.1_2 Reverse -304 -313 15.9293 0.00518
NP_442845.1_2 Reverse -297 -311 9.2427 0.178
NP_441469.1_8 Reverse -390 -399 16.126 0.00797
NP_441469.1_8 Forward -313 -304 6.5879 0.227
NP_441469.1_8 Reverse -302 -311 6.48957 0.227
NP_443064.1_6 Forward -312 -302 12.5669 0.0796
NP_443064.1_6 Reverse -182 -192 11.0156 0.13
NP_443064.1_6 Reverse -303 -313 10.8217 0.13
NP_442578.1_7 Forward -399 -392 14.5921 0.026
NP_442578.1_7 Forward -311 -304 14.5921 0.026
NP_442578.1_7 Reverse -392 -399 14.5921 0.026
NP_442578.1_7 Reverse -304 -311 14.5921 0.026
NP_440220.1_4 Reverse -100 -119 4.71854 0.212
NP_441462.1_2 Reverse -303 -313 20.2362 0.000805
NP_441462.1_2 Forward -400 -390 11.5831 0.00406
NP_441462.1_2 Forward -312 -302 11.5831 0.00406
NP_443062.1_1 Forward -312 -294 6.20575 0.206
NP_442204.1_1 Reverse -387 -398 8.7118 0.0852
NP_442204.1_1 Forward -36 -25 2.12362 0.266
NP_442204.1_1 Forward -316 -305 1.92696 0.266
NP_442204.1_5 Reverse -381 -400 13.2741 0.059
NP_440255.1_7 Forward -123 -106 10.3636 0.277
NP_440516.1_2 Forward -318 -300 2.96908 0.159
NP_440516.1_6 Forward -59 -45 9.24208 0.238
NP_440516.1_8 Forward -400 -391 16.9127 0.00442
NP_440516.1_8 Reverse -391 -400 16.9127 0.00442
NP_440516.1_8 Forward -312 -303 16.9127 0.00442
NP_440516.1_8 Reverse -303 -312 16.9127 0.00442
NP_440516.1_8 Forward -278 -269 -0.196935 0.185
NP_442428.1_5 Forward -399 -392 15.8704 0.0124
NP_442428.1_5 Reverse -392 -399 15.8704 0.0124
NP_442428.1_5 Forward -311 -304 15.8704 0.0124
NP_442428.1_5 Reverse -304 -311 15.8704 0.0124
NP_441443.1_1 Forward -389 -370 2.26107 0.194
NP_442823.1_8 Forward -83 -64 10.4225 0.297
NP_441867.1_2 Forward -123 -104 -16.4218 0.291
NP_440673.1_2 Forward -322 -303 7.95079 0.286
NP_440673.1_3 Forward -398 -391 12.4288 0.0426
NP_440673.1_3 Forward -310 -303 12.4288 0.0426
NP_440673.1_3 Reverse -393 -400 12.4288 0.0426
NP_440673.1_3 Reverse -305 -312 12.4288 0.0426
NP_441052.1_2 Forward -312 -302 19.9412 0.00106
NP_441052.1_2 Forward -400 -390 10.5014 0.0285
NP_441052.1_2 Reverse -303 -313 10.4031 0.0285
NP_442219.1_8 Reverse -205 -224 6.42771 0.298
NP_442219.1_9 Forward -311 -302 17.7976 0.00718
NP_442219.1_9 Forward -399 -390 8.35786 0.0681
NP_442219.1_9 Reverse -304 -313 8.25953 0.0681
NP_440592.1_2 Reverse -291 -310 -0.39387 0.271
NP_440436.1_4 Forward -399 -390 18.1905 0.00233
NP_440436.1_4 Forward -311 -302 17.2072 0.00233
NP_440436.1_4 Reverse -304 -313 9.24241 0.0871
NP_440314.1_9 Forward -311 -292 -0.590531 0.112
NP_442414.1_9 Reverse -371 -390 10.2259 0.292
NP_441719.1_4 Forward -399 -392 16.3621 0.0124
NP_441719.1_4 Reverse -392 -399 16.3621 0.0124
NP_441719.1_4 Forward -311 -304 16.3621 0.0124
NP_441719.1_4 Reverse -304 -311 16.3621 0.0124
NP_441004.1_1 Forward -159 -140 -3.83545 0.164
NP_441004.1_1 Forward -65 -46 -5.99873 0.18
NP_441004.1_2 Forward -82 -63 -2.45882 0.264
NP_441004.1_4 Forward -156 -146 10.9931 0.254
NP_442813.1_4 Reverse -376 -395 -1.7705 0.251
NP_442366.1_5 Reverse -300 -310 14.8275 0.0375
NP_442366.1_5 Reverse -388 -398 11.9759 0.148
NP_442366.1_5 Reverse -243 -253 10.0093 0.292
NP_442873.1_9 Reverse -258 -277 3.9319 0.287
NP_442206.1_10 Forward -400 -385 2.43817 0.201
NP_443054.1_2 Forward -314 -300 9.04604 0.102
NP_442430.1_10 Reverse -381 -400 9.43841 0.29
NP_441851.1_10 Reverse -390 -400 16.008 0.00552
NP_441851.1_10 Reverse -302 -312 15.8113 0.00552
NP_441851.1_10 Forward -313 -303 8.53483 0.114
NP_442515.1_1 Reverse -302 -316 4.22782 0.108
NP_441046.1_2 Forward -270 -251 0.982764 0.262
NP_441349.1_10 Reverse -293 -312 16.7157 0.0105
NP_441349.1_10 Forward -322 -303 -3.63879 0.147
NP_441409.1_6 Forward -318 -299 -6.39206 0.124
NP_440432.1_9 Reverse -304 -319 4.20813 0.0746
NP_440432.1_9 Forward -311 -296 -1.79006 0.167
NP_442843.1_1 Forward -121 -102 -0.39387 0.186
NP_442450.1_5 Reverse -389 -399 7.55152 0.13
NP_442450.1_5 Reverse -301 -311 7.55152 0.13
NP_442168.1_5 Forward -311 -292 -2.26216 0.264
NP_442006.1_2 Forward -394 -377 -0.0594896 0.13
NP_442006.1_2 Forward -142 -125 -14.8091 0.21
NP_442006.1_2 Forward -388 -371 -17.5624 0.279
NP_442006.1_3 Forward -284 -266 -4.8974 0.298
NP_441570.1_1 Forward -312 -294 -8.83064 0.122
NP_441570.1_1 Forward -265 -247 -12.3706 0.213
NP_441570.1_1 Reverse -303 -321 -15.2222 0.228
NP_440078.1_10 Forward -400 -381 3.93269 0.256
NP_441078.1_4 Forward -400 -391 19.6659 0.0007
NP_441078.1_4 Reverse -391 -400 19.6659 0.0007
NP_441078.1_4 Forward -312 -303 19.6659 0.0007
NP_441078.1_4 Reverse -303 -312 19.6659 0.0007
NP_442729.1_5 Forward -395 -385 10.9931 0.235
NP_442443.1_1 Forward -251 -232 -1.08219 0.23
NP_442443.1_5 Forward -140 -122 12.6055 0.163
NP_440793.1_1 Reverse -374 -388 12.192 0.279
NP_440526.1_3 Forward -311 -300 10.2846 0.0646
NP_440526.1_3 Reverse -304 -315 1.92649 0.267
NP_441432.1_8 Reverse -302 -311 16.8143 0.00595
NP_441432.1_8 Forward -313 -304 16.8143 0.00595
NP_441432.1_8 Reverse -390 -399 8.25953 0.0755
NP_442320.1_8 Reverse -297 -311 13.1759 0.0144
NP_442320.1_8 Reverse -385 -399 -3.04867 0.105
NP_442344.1_7 Forward -399 -380 3.73603 0.0638
NP_441732.1_2 Forward -316 -300 -15.6744 0.155
NP_442815.1_2 Reverse -84 -102 4.54237 0.243
NP_440760.1_1 Reverse -303 -322 -12.8819 0.0954
NP_440760.1_1 Reverse -63 -82 -22.6167 0.263
NP_440199.1_10 Reverse -300 -310 7.25653 0.231
NP_440913.1_1 Reverse -301 -319 3.65739 0.295
NP_442751.1_1 Reverse -125 -144 14.8761 0.272
NP_441072.1_2 Reverse -292 -311 10.6192 0.199
NP_442489.1_7 Forward -400 -391 20.1576 0.000695
NP_442489.1_7 Reverse -391 -400 20.1576 0.000695
NP_442489.1_7 Forward -312 -303 20.1576 0.000695
NP_442489.1_7 Reverse -303 -312 20.1576 0.000695
NP_441706.1_10 Reverse -300 -319 7.17762 0.292
NP_440559.1_1 Forward -311 -302 17.4043 0.00658
NP_440559.1_1 Forward -399 -390 8.75118 0.0586
NP_440559.1_1 Reverse -304 -313 8.65285 0.0586
NP_441659.2_8 Reverse -303 -313 20.9245 0.000805
NP_441659.2_8 Forward -312 -302 18.1713 0.00133
NP_441659.2_8 Forward -400 -390 11.9764 0.0147
NP_442913.1_10 Forward -321 -302 -1.47551 0.171
NP_442913.1_10 Reverse -294 -313 -2.26216 0.183
NP_442913.1_10 Reverse -35 -54 -3.93378 0.221
NP_441040.1_2 Forward -202 -183 -14.8485 0.286
NP_442008.1_2 Reverse -129 -148 6.78429 0.217
NP_440708.1_6 Reverse -8 -27 -1.27885 0.201
NP_440708.1_6 Reverse -128 -147 -5.21209 0.232
NP_441800.1_7 Reverse -98 -116 -2.93078 0.268
NP_442346.1_2 Reverse -350 -369 4.52268 0.289
NP_442346.1_5 Reverse -302 -312 16.6963 0.00248
NP_442346.1_5 Forward -313 -303 16.303 0.00248
NP_442346.1_5 Reverse -390 -400 9.02648 0.118
NP_440545.1_3 Reverse -299 -316 1.12048 0.125
NP_440545.1_3 Reverse -242 -259 -2.51776 0.187
NP_440025.1_3 Forward -75 -61 14.4833 0.235
NP_441629.1_1 Reverse -295 -314 6.78429 0.253
NP_440555.1_1 Forward -323 -304 3.24438 0.294
NP_441126.1_5 Forward -279 -260 1.0811 0.299
NP_440847.1_3 Reverse -378 -392 11.4053 0.263
NP_442603.1_7 Reverse -185 -199 6.19383 0.253
NP_441888.1_7 Reverse -386 -400 3.73617 0.225
NP_441050.1_7 Reverse -52 -70 7.88563 0.269
NP_442070.1_1 Forward -296 -277 11.8975 0.261
NP_441833.1_4 Forward -399 -392 15.9687 0.0124
NP_441833.1_4 Reverse -392 -399 15.9687 0.0124
NP_441833.1_4 Forward -311 -304 15.9687 0.0124
NP_441833.1_4 Reverse -304 -311 15.9687 0.0124
NP_442162.1_9 Forward -399 -392 16.2637 0.0124
NP_442162.1_9 Reverse -392 -399 16.2637 0.0124
NP_442162.1_9 Forward -311 -304 16.2637 0.0124
NP_442162.1_9 Reverse -304 -311 16.2637 0.0124
NP_440671.1_4 Forward -271 -257 5.80112 0.271
NP_440671.1_4 Reverse -297 -311 5.21113 0.289
NP_442140.1_3 Forward -399 -389 16.2046 0.0255
NP_442140.1_3 Forward -311 -301 12.2714 0.0632
NP_442140.1_3 Reverse -304 -314 4.69992 0.238
NP_442723.1_1 Reverse -262 -281 2.55527 0.286
NP_442021.1_3 Forward -234 -215 -6.1954 0.257
NP_442021.1_3 Forward -78 -59 -6.29373 0.257
NP_441671.1_1 Reverse -265 -284 -2.0655 0.295
NP_440875.1_9 Reverse -305 -315 15.867 0.0233
NP_440875.1_9 Forward -398 -388 9.15072 0.233
NP_441813.1_3 Forward -39 -20 16.3704 0.238
NP_441813.1_5 Forward -314 -304 18.1713 0.00743
NP_441813.1_5 Reverse -389 -399 9.91146 0.021
NP_441813.1_5 Reverse -301 -311 8.63316 0.0367
NP_440594.1_8 Reverse -304 -317 11.4251 0.153
NP_440590.1_4 Forward -399 -386 11.6223 0.019
NP_440590.1_4 Reverse -304 -317 4.93583 0.0585
NP_440590.1_4 Forward -311 -298 2.2809 0.0939
NP_440567.1_1 Forward -399 -385 14.2576 0.0187
NP_440567.1_1 Forward -311 -297 6.09611 0.0894
NP_442497.1_10 Reverse -304 -313 17.601 0.00813
NP_442497.1_10 Forward -399 -390 10.4228 0.0087
NP_442497.1_10 Forward -311 -302 10.4228 0.0087
NP_440821.1_4 Reverse -389 -399 10.2065 0.0163
NP_440821.1_4 Reverse -301 -311 9.41981 0.0286
NP_440821.1_4 Forward -314 -304 2.24165 0.131
NP_441239.1_9 Forward -314 -302 13.0187 0.0389
NP_441239.1_9 Reverse -130 -142 4.46387 0.253
NP_441239.1_9 Reverse -301 -313 3.38223 0.285
NP_441951.1_9 Forward -223 -204 1.0811 0.254
NP_440156.1_4 Reverse -106 -116 13.2542 0.176
NP_442897.1_7 Forward -120 -101 17.7974 0.221
NP_440706.1_1 Reverse -299 -318 2.45773 0.218
NP_440665.1_1 Forward -212 -193 -12.2919 0.244
NP_440665.1_1 Reverse -185 -204 -16.7168 0.293
NP_440604.1_6 Forward -400 -381 -6.09707 0.289
NP_442270.1_9 Reverse -380 -399 -10.3253 0.253
NP_440833.1_6 Reverse -104 -118 13.7653 0.157
NP_440412.1_2 Reverse -1 -20 5.80098 0.283
NP_440546.1_4 Reverse -303 -313 13.5365 0.0459
NP_440546.1_4 Forward -400 -390 11.8882 0.0679
NP_440546.1_4 Forward -312 -302 10.046 0.109
NP_440675.1_1 Forward -75 -56 5.50599 0.218
NP_440462.1_6 Forward -314 -304 18.7612 0.00454
NP_440462.1_6 Reverse -389 -399 9.02648 0.0498
NP_440462.1_6 Reverse -301 -311 1.35667 0.294
NP_442611.1_1 Forward -400 -381 8.65258 0.127
NP_440705.1_4 Forward -389 -370 7.27595 0.296
NP_440868.1_4 Forward -316 -304 10.0687 0.0405
NP_440868.1_4 Reverse -387 -399 8.6921 0.0582
NP_440868.1_4 Reverse -299 -311 5.93884 0.0879
NP_441249.1_8 Forward -135 -116 7.07928 0.227
NP_441474.1_1 Forward -210 -191 4.22689 0.221
NP_442402.1_4 Reverse -9 -28 -8.26108 0.278
NP_442402.1_10 Reverse -272 -282 12.9592 0.204
NP_441084.1_6 Forward -314 -300 15.0646 0.0931
NP_440653.1_10 Reverse -51 -70 3.93269 0.259
NP_440696.1_3 Reverse -367 -385 1.39578 0.217
NP_442039.1_4 Forward -399 -392 15.1821 0.0124
NP_442039.1_4 Reverse -392 -399 15.1821 0.0124
NP_442039.1_4 Forward -311 -304 15.1821 0.0124
NP_442039.1_4 Reverse -304 -311 15.1821 0.0124
NP_440825.1_7 Forward -311 -301 12.9096 0.152
NP_440825.1_7 Forward -399 -389 12.4217 0.155
NP_442837.1_3 Forward -399 -392 15.7721 0.0124
NP_442837.1_3 Reverse -392 -399 15.7721 0.0124
NP_442837.1_3 Forward -311 -304 15.7721 0.0124
NP_442837.1_3 Reverse -304 -311 15.7721 0.0124
NP_440160.1_2 Forward -147 -128 0.0977854 0.228
NP_442053.1_1 Forward -400 -391 18.3876 0.0007
NP_442053.1_1 Reverse -391 -400 18.3876 0.0007
NP_442053.1_1 Forward -312 -303 18.3876 0.0007
NP_442053.1_1 Reverse -303 -312 18.3876 0.0007
NP_440505.1_3 Forward -314 -304 17.188 0.00332
NP_440505.1_3 Reverse -301 -311 9.22315 0.122
NP_440505.1_3 Forward -382 -372 8.04317 0.147
NP_440505.1_3 Reverse -389 -399 6.76487 0.169
NP_441203.1_1 Forward -399 -380 -9.93197 0.137
NP_440914.1_1 Forward -312 -302 17.5935 0.000537
NP_440914.1_1 Reverse -303 -313 16.3248 0.00196
NP_440914.1_1 Forward -400 -390 8.6151 0.186
NP_441011.1_8 Forward -399 -390 16.9127 0.00602
NP_441011.1_8 Reverse -304 -313 16.6177 0.00602
NP_441011.1_8 Forward -311 -302 8.25953 0.144
NP_442533.1_6 Forward -400 -391 17.2076 0.00137
NP_442533.1_6 Reverse -391 -400 17.2076 0.00137
NP_442533.1_6 Forward -312 -303 17.2076 0.00137
NP_442533.1_6 Reverse -303 -312 17.2076 0.00137
NP_442533.1_6 Forward -370 -361 5.99792 0.121
NP_442541.1_10 Forward -218 -204 0.785655 0.298
NP_443050.1_7 Forward -136 -122 18.6825 0.253
NP_442322.1_4 Reverse -269 -286 1.21811 0.21
NP_442322.1_4 Reverse -232 -249 -5.37003 0.266
NP_441482.1_7 Forward -318 -304 -2.75368 0.0997
NP_441482.1_7 Reverse -385 -399 -8.5552 0.193
NP_439944.1_9 Forward -311 -301 10.5014 0.0887
NP_439944.1_9 Reverse -304 -314 9.12481 0.1
NP_442269.1_10 Forward -103 -84 3.14605 0.255
NP_441028.1_6 Reverse -273 -283 4.01116 0.278
NP_440116.1_8 Forward -311 -292 -1.57384 0.12
NP_440116.1_8 Forward -399 -380 -7.76869 0.237
NP_440115.1_6 Forward -315 -305 4.89658 0.28
NP_440007.1_9 Forward -316 -302 7.27608 0.213
NP_442890.1_2 Reverse -128 -147 12.3892 0.271
NP_441972.1_5 Forward -311 -292 -3.73712 0.201
NP_441106.1_1 Forward -313 -304 18.486 0.0028
NP_441106.1_1 Reverse -390 -399 18.191 0.0028
NP_441106.1_1 Reverse -302 -311 9.63616 0.0311
NP_441815.1_3 Reverse -137 -156 18.289 0.0536
NP_441869.1_2 Forward -319 -300 8.45592 0.284
NP_440302.1_4 Forward -153 -134 16.8141 0.283
NP_442306.1_10 Forward -317 -298 -10.1286 0.11
NP_441286.1_1 Reverse -302 -314 5.93884 0.0258
NP_441286.1_1 Forward -313 -301 3.48056 0.0467
NP_440670.1_8 Forward -400 -391 18.3876 0.000699
NP_440670.1_8 Reverse -391 -400 18.3876 0.000699
NP_440670.1_8 Forward -312 -303 18.3876 0.000699
NP_440670.1_8 Reverse -303 -312 18.3876 0.000699
NP_440886.1_7 Reverse -390 -400 17.7774 0.0011
NP_440886.1_7 Forward -313 -303 8.04271 0.0805
NP_440886.1_7 Reverse -302 -312 7.94438 0.0805
NP_440886.1_7 Reverse -270 -280 4.99446 0.205
NP_442614.1_2 Reverse -303 -317 6.98109 0.276
NP_442072.1_9 Reverse -302 -320 -22.6953 0.253
NP_440907.2_8 Forward -399 -389 14.2375 0.0312
NP_440907.2_8 Reverse -304 -314 9.616 0.103
NP_440907.2_8 Forward -311 -301 7.64939 0.117
NP_441021.1_1 Forward -311 -292 -6.98204 0.181
NP_440841.1_4 Forward -34 -15 -10.227 0.275
NP_441463.1_3 Reverse -293 -312 -0.295539 0.132
NP_441626.1_2 Forward -399 -392 15.7721 0.0124
NP_441626.1_2 Reverse -392 -399 15.7721 0.0124
NP_441626.1_2 Forward -311 -304 15.7721 0.0124
NP_441626.1_2 Reverse -304 -311 15.7721 0.0124
NP_442365.1_7 Forward -177 -158 -3.54046 0.221
NP_441460.1_2 Reverse -382 -395 13.8833 0.268
NP_442238.1_3 Forward -270 -251 7.17762 0.215
NP_442794.1_1 Reverse -387 -399 12.4287 0.0721
NP_442794.1_1 Reverse -299 -311 2.69391 0.286
NP_442615.1_1 Reverse -382 -400 14.7688 0.00922
NP_442615.1_1 Reverse -294 -312 3.55906 0.0536
NP_442615.1_1 Forward -321 -303 -5.97904 0.231
NP_441962.1_10 Reverse -81 -100 18.289 0.17
NP_440387.1_1 Forward -400 -384 14.6115 0.00635
NP_440387.1_1 Forward -312 -296 -1.41643 0.142
NP_441431.1_2 Forward -315 -301 13.7653 0.0806
NP_442020.1_1 Reverse -97 -116 2.06362 0.255
NP_441993.1_1 Reverse -297 -316 1.16703 0.284
NP_440114.1_10 Reverse -303 -317 16.9125 0.0141
NP_440114.1_10 Forward -312 -298 9.5377 0.169
NP_440754.1_5 Forward -373 -354 12.1925 0.232
NP_440293.1_3 Forward -288 -269 -6.39206 0.288
NP_440766.1_4 Forward -282 -268 8.25939 0.0871
NP_441237.1_9 Forward -311 -301 14.828 0.0242
NP_442743.1_4 Forward -399 -380 -7.27704 0.279
NP_441311.1_2 Reverse -385 -399 14.5519 0.229
NP_439910.1_2 Reverse -295 -312 -12.6459 0.0924
NP_440457.1_1 Forward -282 -270 0.333971 0.25
NP_440457.1_1 Reverse -387 -399 -0.452677 0.263
NP_440457.1_1 Forward -316 -304 -0.649339 0.271
NP_440798.1_6 Forward -399 -386 13.0973 0.0445
NP_442680.1_5 Forward -29 -10 -0.904675 0.297
NP_441984.1_3 Reverse -121 -139 5.32902 0.287
NP_442509.1_9 Forward -400 -390 16.2041 0.00739
NP_442509.1_9 Forward -312 -302 8.14104 0.192
NP_442509.1_9 Reverse -303 -313 8.04271 0.192
NP_441253.1_8 Reverse -298 -312 15.113 0.122
NP_440524.1_2 Forward -51 -32 -0.39387 0.27
NP_442514.1_5 Reverse -376 -395 5.80018 0.134
NP_442514.1_5 Reverse -269 -288 -7.3761 0.276
NP_440554.1_4 Reverse -304 -314 17.9746 0.0131
NP_440554.1_4 Forward -399 -389 7.35486 0.103
NP_441885.1_5 Forward -312 -302 20.9245 0.000538
NP_441885.1_5 Forward -400 -390 11.4848 0.00668
NP_441885.1_5 Reverse -303 -313 11.3864 0.00668
NP_442341.1_7 Forward -60 -46 3.04785 0.237
NP_442341.1_7 Reverse -49 -63 1.57289 0.286
NP_442341.1_9 Forward -314 -300 20.0584 0.00907
NP_441756.1_5 Reverse -128 -147 3.53937 0.199
NP_440423.1_6 Forward -320 -301 -16.4218 0.232
NP_443000.1_7 Forward -314 -304 20.3345 0.00223
NP_443000.1_7 Reverse -301 -311 10.3048 0.0345
NP_443000.1_7 Reverse -389 -399 1.94665 0.226
NP_441842.1_10 Reverse -384 -398 9.2427 0.195
NP_441842.1_10 Reverse -296 -310 8.45605 0.221
NP_441842.1_10 Forward -285 -271 6.78443 0.272
NP_440275.1_3 Forward -314 -304 16.1063 0.0155
NP_440275.1_3 Reverse -389 -399 8.33817 0.0602
NP_440275.1_3 Reverse -301 -311 8.04317 0.0602
NP_440091.1_1 Reverse -299 -311 8.88877 0.0567
NP_441902.1_3 Forward -31 -21 12.3986 0.253
NP_441902.1_3 Reverse -289 -299 11.8156 0.288
NP_443010.1_7 Reverse -368 -387 10.9134 0.278
NP_442451.1_2 Forward -320 -301 -7.37537 0.234
NP_440175.1_7 Forward -198 -180 8.97275 0.282
NP_442234.1_1 Reverse -90 -109 11.9958 0.248
NP_441105.1_3 Reverse -46 -65 -6.29373 0.232
NP_441105.1_3 Reverse -380 -399 -8.55534 0.274
NP_440216.1_1 Reverse -303 -317 8.06273 0.0068
NP_440216.1_1 Forward -400 -386 7.66941 0.00931
NP_440216.1_1 Forward -312 -298 -1.77037 0.0383
NP_440172.1_1 Reverse -303 -313 17.5813 0.00421
NP_440172.1_1 Forward -312 -302 15.0247 0.00945
NP_440172.1_1 Forward -400 -390 8.73149 0.0586
NP_440249.1_2 Forward -363 -353 13.9425 0.29
NP_442015.1_10 Reverse -387 -400 20.1771 0.00366
NP_442015.1_10 Reverse -299 -312 1.59258 0.204
NP_441226.1_7 Forward -399 -392 14.4934 0.0123
NP_441226.1_7 Reverse -392 -399 14.4934 0.0123
NP_441226.1_7 Forward -311 -304 14.4934 0.0123
NP_441226.1_7 Reverse -304 -311 14.4934 0.0123
NP_440198.1_2 Reverse -143 -162 14.4233 0.276
NP_441111.1_7 Forward -399 -391 18.7023 0.00294
NP_441111.1_7 Forward -311 -303 18.7023 0.00294
NP_441111.1_7 Reverse -392 -400 18.7023 0.00294
NP_441111.1_7 Reverse -304 -312 18.7023 0.00294
NP_441766.1_2 Forward -400 -391 17.5026 0.00297
NP_441766.1_2 Reverse -391 -400 17.5026 0.00297
NP_441766.1_2 Forward -312 -303 17.5026 0.00297
NP_441766.1_2 Reverse -303 -312 17.5026 0.00297
NP_441766.1_2 Reverse -269 -278 1.47469 0.289
NP_442417.1_5 Forward -400 -386 17.5025 0.0331
NP_440416.1_1 Forward -312 -293 -2.85214 0.116
NP_443052.1_8 Reverse -293 -312 -6.68705 0.145
NP_443052.1_8 Reverse -381 -400 -7.96535 0.166
NP_442403.1_1 Forward -96 -77 17.9932 0.145
NP_440261.1_5 Reverse -304 -317 4.8375 0.0516
NP_440261.1_5 Forward -399 -386 -0.964025 0.0655
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

GGCGATCGCCGAGGGGCAAAGGGAATTGGAGGCCATGCTCTAAAATTGGACTTATTGCATAGGAATATGAGATGACGAGTGCATTACAGGCGATCGCCAATTTACTGCCTCAATTGTCCGGGGGAGAGCGGGCACAGTTATTGCAGTGGGTGGCCCAGGATTTAGGTGATTTGGCTCCCGGTGTCGAAGTCCACCCCCTAGTCTGTGGTGGTGAGCCTTGCATTGTTCGCACTCGGATTCCTGTTTGGGTATTGGAGCAGGCCAGGCGGCAGGGCTTGAATGATGGGGAAATTTTGCGCTGTTATCCTAGTCTCCGGGCCGAAGATTTGGTTAATGCCTGGGCCTATGTCCGTCGTCATCGATCAGAAGTTGAGGGGCAAATCAACGAGAATGAAGCCCT

CDS

ATGAGTCGATTGTACGGTGACGAAAATTTTCCTATGCCTGTGGTGCAGGCTTTACGTGAACTAGGGCATGATGTACTGACTTGTTTGGATGCGGGGCAAGCCGATAAAGCTATTCCCGACGAGGATGTATTGGCTTTTGCTGTCGCTGAACAAAGGGCAGTGTTGACAATTAATCGTAAGGATTTTATTCGGCTTCATCTACAAAATGAATGCCATTGCGGTATCATTGTTTGTACTTTTAATGCAGATTTCTTAGCACAAGCAAAACAAATTGATGCGGCTTTGGAGCAGATAAGTGAACCCAGCAATCAGCTTATACGAATTAACCGCTTACAGGGATAG

Protein

No sequence available