Your browser is old and dusty. Try Google Chrome!

Details for sll7031

ORF sll7031
Accession NP_942319.1
Symbol
Category
Definition
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_441061.1_2 Reverse -290 -304 0.0979218 0.218
NP_440795.1_7 Forward -297 -290 14.6904 0.0123
NP_440795.1_7 Reverse -290 -297 14.6904 0.0123
NP_441418.1_6 Forward -298 -279 -18.8801 0.0839
NP_441418.1_6 Forward -229 -210 -29.2048 0.219
NP_442291.1_5 Forward -299 -283 0.255197 0.169
NP_442272.1_2 Forward -380 -361 12.1748 0.223
NP_441453.1_4 Forward -298 -290 16.539 0.00633
NP_441453.1_4 Reverse -289 -297 7.8859 0.0536
NP_441453.1_4 Forward -229 -221 4.24765 0.259
NP_441453.1_7 Forward -344 -337 12.9205 0.23
NP_441623.1_1 Forward -21 -3 -4.60241 0.274
NP_442151.1_6 Reverse -289 -303 16.0275 0.0187
NP_442151.1_6 Reverse -220 -234 13.4709 0.0512
NP_441818.1_1 Forward -297 -286 9.10461 0.255
NP_441818.1_1 Forward -20 -9 8.51463 0.288
NP_441818.1_9 Forward -373 -354 5.11266 0.153
NP_440226.1_1 Forward -298 -279 5.11266 0.166
NP_442173.1_1 Reverse -290 -298 15.4574 0.00633
NP_442173.1_1 Forward -297 -289 14.1791 0.0165
NP_442752.1_4 Forward -298 -291 13.8055 0.0199
NP_443027.1_4 Forward -300 -290 16.2046 0.0437
NP_443027.1_4 Reverse -287 -297 12.8614 0.0624
NP_439997.1_4 Forward -54 -35 14.3558 0.121
NP_441812.1_3 Reverse -288 -302 15.9292 0.0855
NP_441812.1_3 Forward -230 -216 11.0127 0.215
NP_442975.1_10 Reverse -285 -299 4.62054 0.241
NP_440784.1_7 Forward -297 -290 15.9687 0.0123
NP_440784.1_7 Reverse -290 -297 15.9687 0.0123
NP_440061.1_9 Reverse -264 -278 6.39049 0.248
NP_442062.1_8 Forward -298 -288 18.7612 0.00187
NP_441995.1_2 Reverse -278 -297 16.9124 0.199
NP_440304.1_4 Forward -300 -290 19.9412 0.00364
NP_442242.1_4 Forward -297 -290 14.3954 0.0124
NP_442242.1_4 Reverse -290 -297 14.3954 0.0124
NP_440044.1_8 Reverse -290 -309 -1.67217 0.248
NP_441781.1_7 Forward -357 -338 4.62101 0.186
NP_442602.1_3 Forward -38 -19 -0.787193 0.226
NP_439918.1_2 Forward -280 -261 4.52268 0.163
NP_439918.1_2 Forward -355 -336 0.982764 0.217
NP_440893.1_3 Forward -115 -96 4.22689 0.262
NP_441594.1_6 Reverse -9 -28 0.491109 0.285
NP_440370.1_10 Reverse -280 -299 7.7676 0.25
NP_442110.1_7 Reverse -283 -297 6.78443 0.134
NP_442110.1_7 Reverse -289 -303 4.03116 0.208
NP_440856.1_7 Forward -352 -333 -3.04881 0.194
NP_441083.1_5 Reverse -289 -299 1.94665 0.197
NP_441083.1_5 Forward -298 -288 1.65166 0.2
NP_441083.1_5 Reverse -220 -230 -0.511621 0.269
NP_441738.1_2 Reverse -291 -298 15.28 0.0102
NP_441738.1_2 Forward -296 -289 11.5435 0.084
NP_441738.1_2 Forward -400 -393 8.29857 0.176
NP_441738.1_2 Forward -25 -18 6.72528 0.236
NP_441558.1_5 Forward -300 -281 3.93269 0.294
NP_441955.1_8 Forward -304 -287 7.512 0.274
NP_440209.1_1 Forward -298 -290 18.1123 0.00295
NP_440209.1_1 Reverse -289 -297 8.47588 0.0457
NP_442889.1_8 Reverse -217 -231 3.93223 0.27
NP_441770.1_4 Forward -228 -209 -11.6036 0.29
NP_442706.1_5 Forward -100 -81 14.4971 0.245
NP_442570.1_3 Forward -353 -334 2.85105 0.18
NP_442570.1_3 Reverse -287 -306 -6.78538 0.259
NP_442570.1_3 Reverse -307 -326 -8.26035 0.283
NP_441598.1_3 Reverse -330 -349 13.1609 0.226
NP_442111.1_1 Forward -243 -224 19.2715 0.208
NP_442111.1_4 Forward -299 -285 14.8476 0.0269
NP_441387.1_7 Forward -294 -275 6.98095 0.209
NP_440906.1_5 Forward -297 -290 15.8704 0.0124
NP_440906.1_5 Reverse -290 -297 15.8704 0.0124
NP_440747.1_10 Forward -301 -289 -1.92764 0.0192
NP_440747.1_10 Reverse -286 -298 -2.51763 0.0509
NP_440747.1_10 Forward -232 -220 -4.58258 0.109
NP_441130.1_10 Forward -300 -286 13.3726 0.0684
NP_441130.1_10 Reverse -277 -291 4.42448 0.288
NP_441486.1_1 Reverse -217 -231 1.17956 0.117
NP_441486.1_1 Reverse -286 -300 0.88457 0.124
NP_441880.2_10 Forward -297 -279 13.4905 0.111
NP_442634.1_4 Reverse -287 -301 7.37441 0.0479
NP_442848.1_1 Reverse -283 -297 5.70279 0.0803
NP_442848.1_5 Reverse -324 -342 5.72234 0.249
NP_441012.1_4 Forward -296 -283 5.82081 0.29
NP_443018.1_3 Forward -297 -290 14.8871 0.0123
NP_443018.1_3 Reverse -290 -297 14.8871 0.0123
NP_443018.1_3 Forward -228 -221 12.5271 0.0523
NP_443018.1_3 Reverse -221 -228 12.5271 0.0523
NP_443018.1_3 Forward -20 -13 7.6106 0.156
NP_441316.1_7 Reverse -287 -302 -1.5934 0.238
NP_441634.1_8 Forward -231 -217 4.22782 0.132
NP_441634.1_8 Forward -300 -286 3.53951 0.148
NP_440376.1_1 Forward -298 -289 9.73449 0.0365
NP_440376.1_1 Reverse -289 -298 9.63616 0.0385
NP_441002.1_1 Reverse -73 -92 13.7658 0.1
NP_442687.1_7 Reverse -288 -298 6.17489 0.178
NP_442687.1_7 Reverse -213 -223 5.5849 0.194
NP_442485.1_3 Reverse -209 -228 -2.26216 0.262
NP_441846.1_10 Reverse -1 -20 -14.9469 0.241
NP_440360.1_4 Reverse -323 -342 6.88262 0.246
NP_442658.1_1 Reverse -287 -297 15.2208 0.0156
NP_442658.1_1 Forward -300 -290 13.0576 0.04
NP_440184.1_5 Forward -298 -279 7.47261 0.224
NP_440607.1_5 Forward -301 -282 -1.67217 0.3
NP_442937.1_5 Forward -234 -215 7.96426 0.237
NP_442937.1_5 Reverse -7 -26 5.80098 0.3
NP_441958.1_5 Forward -299 -289 12.0747 0.00222
NP_441958.1_5 Reverse -288 -298 2.43831 0.0422
NP_440203.1_5 Reverse -292 -302 12.5659 0.146
NP_439990.1_5 Forward -234 -221 8.57408 0.168
NP_442911.1_2 Forward -308 -289 5.60432 0.0325
NP_442911.1_2 Reverse -279 -298 -1.57384 0.0871
NP_440153.1_5 Forward -297 -283 15.9292 0.0551
NP_443055.1_6 Forward -243 -225 8.47483 0.142
NP_442210.1_9 Forward -279 -261 8.57394 0.27
NP_440138.1_6 Reverse -290 -309 6.48849 0.227
NP_443044.1_1 Forward -37 -18 5.211 0.279
NP_441294.1_7 Reverse -285 -299 12.7062 0.0876
NP_441646.1_1 Reverse -282 -301 7.86593 0.152
NP_442438.1_10 Reverse -284 -298 2.35953 0.178
NP_442438.1_10 Forward -356 -342 -0.393733 0.259
NP_441000.1_1 Reverse -74 -92 14.1693 0.184
NP_441000.1_6 Forward -299 -285 5.50613 0.0933
NP_441674.1_6 Reverse -326 -345 18.4857 0.0368
NP_440147.1_4 Forward -300 -287 0.707601 0.247
NP_440147.1_4 Reverse -287 -300 -0.0790467 0.271
NP_441550.1_8 Forward -300 -290 13.0576 0.0273
NP_441550.1_8 Reverse -287 -297 5.58445 0.242
NP_441916.1_7 Reverse -289 -299 10.6981 0.0261
NP_441916.1_7 Forward -298 -288 9.12481 0.0396
NP_440465.1_4 Reverse -288 -307 13.8641 0.184
NP_441041.1_4 Reverse -12 -31 -9.73531 0.222
NP_441041.1_4 Forward -298 -279 -11.8003 0.252
NP_441041.1_7 Reverse -286 -298 6.73736 0.195
NP_440016.1_7 Reverse -309 -328 19.5673 0.244
NP_442004.1_6 Reverse -342 -356 2.75286 0.257
NP_441725.1_5 Reverse -290 -300 11.1898 0.0247
NP_441725.1_5 Forward -297 -287 0.766681 0.149
NP_439966.1_7 Reverse -287 -297 15.4175 0.0152
NP_439966.1_7 Forward -300 -290 14.8275 0.0177
NP_439966.1_7 Reverse -346 -356 8.14104 0.14
NP_439966.1_7 Reverse -218 -228 5.78111 0.209
NP_439966.1_9 Reverse -287 -296 9.14451 0.253
NP_440736.1_3 Forward -300 -281 6.19431 0.223
NP_440202.1_8 Reverse -3 -22 9.70905 0.297
NP_440202.1_10 Forward -389 -370 13.8641 0.21
NP_442941.1_3 Reverse -290 -300 19.9412 0.00262
NP_442941.1_3 Forward -297 -287 1.35667 0.15
NP_440289.1_2 Reverse -217 -230 1.59258 0.122
NP_440289.1_2 Reverse -286 -299 -4.60227 0.29
NP_440983.1_5 Reverse -214 -233 -1.96717 0.231
NP_440260.1_8 Forward -279 -261 -7.15901 0.295
NP_441678.1_9 Reverse -1 -20 -3.73712 0.288
NP_442281.1_1 Forward -303 -289 14.4536 0.0183
NP_442281.1_1 Reverse -284 -298 3.04726 0.246
NP_441334.1_7 Reverse -287 -306 -20.3551 0.275
NP_442256.1_2 Reverse -287 -305 1.19912 0.109
NP_440647.1_9 Reverse -287 -305 7.4923 0.219
NP_442012.1_1 Forward -212 -193 2.94938 0.19
NP_442012.1_5 Forward -293 -274 -0.885524 0.288
NP_440498.1_1 Reverse -280 -298 6.01734 0.093
NP_443030.1_4 Reverse -237 -256 -4.42544 0.251
NP_441644.1_6 Reverse -220 -230 11.2876 0.0524
NP_441644.1_6 Reverse -289 -299 9.71433 0.0705
NP_441644.1_6 Forward -21 -11 8.73102 0.0944
NP_441644.1_6 Forward -298 -288 7.64939 0.121
NP_442215.1_2 Reverse -287 -303 0.55019 0.15
NP_440253.1_2 Forward -298 -280 -1.94747 0.254
NP_440929.1_8 Forward -298 -289 17.4043 0.00289
NP_440929.1_8 Reverse -289 -298 17.4043 0.00289
NP_442933.1_10 Forward -298 -289 9.04618 0.063
NP_442933.1_10 Reverse -289 -298 8.94785 0.0643
NP_441310.1_10 Forward -390 -380 14.332 0.289
NP_440382.1_2 Reverse -40 -59 7.57013 0.229
NP_441751.2_8 Reverse -290 -304 6.3911 0.0354
NP_442554.1_8 Reverse -290 -300 16.9913 0.0065
NP_442554.1_8 Reverse -221 -231 13.1564 0.0193
NP_442554.1_8 Forward -297 -287 10.7964 0.043
NP_442554.1_8 Forward -228 -218 2.14332 0.281
NP_442970.1_1 Forward -97 -83 10.8022 0.269
NP_441762.1_7 Forward -299 -287 -4.28759 0.168
NP_441762.1_7 Reverse -288 -300 -5.27089 0.195
NP_442142.1_4 Reverse -217 -230 17.0299 0.0264
NP_442142.1_4 Forward -232 -219 10.0485 0.0806
NP_442142.1_4 Forward -301 -288 8.2785 0.118
NP_442292.1_1 Reverse -290 -299 17.5026 0.00435
NP_442292.1_1 Forward -297 -288 9.04618 0.0226
NP_442292.1_1 Reverse -221 -230 5.80125 0.129
NP_442476.1_6 Forward -297 -283 8.94771 0.0978
NP_443009.1_5 Forward -299 -288 18.5443 0.00265
NP_442301.1_2 Reverse -321 -340 6.1935 0.263
NP_442408.2_1 Reverse -289 -308 -5.60541 0.274
NP_441715.1_4 Reverse -290 -300 14.238 0.0295
NP_441715.1_4 Forward -297 -287 9.7148 0.097
NP_441715.1_4 Reverse -116 -126 4.60159 0.261
NP_441198.1_8 Forward -300 -290 13.2713 0.108
NP_440379.1_5 Forward -328 -309 -7.96535 0.25
NP_440379.1_5 Forward -238 -219 -9.24366 0.262
NP_440464.1_3 Reverse -287 -306 8.25926 0.222
NP_441468.1_1 Forward -297 -290 15.8704 0.0124
NP_441468.1_1 Reverse -290 -297 15.8704 0.0124
NP_441468.1_1 Reverse -221 -228 3.97235 0.277
NP_441468.1_1 Forward -228 -221 3.97235 0.277
NP_441468.1_2 Reverse -260 -274 17.2075 0.252
NP_441020.2_7 Reverse -336 -355 8.25844 0.269
NP_441673.1_1 Forward -298 -289 11.1111 0.0121
NP_441673.1_1 Reverse -289 -298 11.0128 0.018
NP_441826.1_2 Reverse -283 -297 -1.47537 0.248
NP_441826.1_2 Forward -304 -290 -2.65535 0.273
NP_441330.1_1 Forward -303 -284 -13.2752 0.183
NP_442490.1_9 Forward -310 -291 -6.68705 0.273
NP_442490.1_10 Reverse -326 -344 11.3272 0.204
NP_442868.1_6 Reverse -287 -297 1.35667 0.205
NP_442868.1_6 Forward -300 -290 1.06167 0.205
NP_442361.1_3 Forward -304 -291 9.2624 0.276
NP_442808.1_1 Reverse -278 -288 15.6142 0.0219
NP_442808.1_1 Reverse -288 -298 9.81266 0.0481
NP_442808.1_1 Reverse -219 -229 7.0594 0.0892
NP_440145.1_3 Forward -239 -220 -4.52377 0.238
NP_442050.1_5 Forward -300 -290 18.0724 0.00365
NP_442050.1_5 Reverse -346 -356 9.51767 0.193
NP_440558.1_2 Forward -328 -309 -6.29373 0.273
NP_440558.1_2 Reverse -217 -236 -7.67036 0.298
NP_441878.1_6 Forward -299 -289 0.766681 0.134
NP_441878.1_6 Forward -230 -220 0.668351 0.139
NP_441878.1_6 Reverse -288 -298 0.57002 0.14
NP_441878.1_6 Reverse -219 -229 0.57002 0.14
NP_441036.1_3 Reverse -91 -110 0.294447 0.177
NP_441036.1_8 Reverse -288 -298 16.7946 0.00239
NP_441036.1_8 Forward -299 -289 6.07655 0.242
NP_441557.1_5 Reverse -289 -298 17.4043 0.0023
NP_441557.1_5 Forward -298 -289 10.8161 0.00464
NP_441520.1_5 Reverse -103 -122 14.9458 0.148
NP_441433.1_8 Forward -257 -238 5.89931 0.175
NP_441308.1_8 Forward -300 -290 13.353 0.218
NP_441458.1_10 Forward -307 -288 3.14605 0.255
NP_442183.1_1 Forward -298 -284 10.816 0.0784
NP_439980.1_2 Reverse -273 -292 12.7825 0.28
NP_441549.1_9 Reverse -285 -303 -4.70074 0.198
NP_441238.1_10 Reverse -383 -397 12.3893 0.292
NP_442347.1_2 Forward -297 -288 8.75118 0.0772
NP_442347.1_2 Reverse -290 -299 3.34298 0.284
NP_442888.1_9 Reverse -208 -227 13.7658 0.235
NP_441037.1_4 Forward -300 -290 7.31769 0.237
NP_441037.1_4 Reverse -287 -297 5.85583 0.296
NP_442594.1_8 Reverse -10 -29 5.01433 0.254
NP_441633.1_3 Reverse -287 -300 7.29578 0.0481
NP_440136.1_2 Forward -297 -290 15.9687 0.0123
NP_440136.1_2 Reverse -290 -297 15.9687 0.0123
NP_442998.1_5 Reverse -102 -112 13.353 0.158
NP_442998.1_5 Reverse -1 -11 13.353 0.158
NP_442998.1_10 Reverse -291 -298 15.5754 0.0102
NP_442998.1_10 Forward -296 -289 5.84064 0.235
NP_440899.1_2 Forward -309 -290 10.6184 0.155
NP_440899.1_8 Forward -274 -255 -10.6203 0.281
NP_440299.1_1 Reverse -285 -298 14.2767 0.0259
NP_440299.1_1 Reverse -165 -178 3.65697 0.237
NP_440299.1_1 Forward -233 -220 2.96866 0.265
NP_441799.1_1 Forward -302 -288 15.8302 0.0163
NP_441007.1_10 Forward -303 -290 10.934 0.0646
NP_441007.1_10 Forward -336 -323 0.805932 0.216
NP_440256.1_1 Forward -301 -282 9.3409 0.0206
NP_440256.1_1 Forward -24 -5 -9.73531 0.287
NP_441090.1_6 Reverse -220 -234 9.5377 0.261
NP_440709.1_1 Reverse -173 -192 7.96345 0.109
NP_441559.1_8 Forward -293 -279 4.22782 0.127
NP_441559.1_8 Reverse -284 -298 2.45787 0.143
NP_440915.1_6 Reverse -285 -299 4.32615 0.097
NP_441179.1_9 Reverse -218 -228 16.1058 0.236
NP_442785.1_7 Forward -300 -286 16.1259 0.172
NP_441866.1_6 Reverse -154 -173 9.24175 0.248
NP_442866.1_1 Reverse -284 -303 -6.78538 0.26
NP_441464.1_8 Reverse -322 -336 10.7177 0.178
NP_441199.1_3 Reverse -382 -400 -0.472507 0.26
NP_441494.1_6 Reverse -278 -291 6.21414 0.289
NP_441494.1_6 Forward -303 -290 5.82081 0.292
NP_442993.1_1 Forward -229 -213 9.59664 0.0182
NP_442386.1_9 Reverse -288 -297 14.4539 0.0289
NP_442386.1_9 Reverse -219 -228 14.1589 0.0289
NP_442386.1_9 Forward -230 -221 10.324 0.132
NP_442386.1_9 Reverse -278 -287 10.2257 0.136
NP_442386.1_9 Forward -299 -290 6.39082 0.219
NP_441750.1_4 Reverse -285 -304 8.35759 0.159
NP_441340.1_5 Forward -297 -290 15.6737 0.0124
NP_441340.1_5 Reverse -290 -297 15.6737 0.0124
NP_441340.1_5 Reverse -221 -228 4.07068 0.239
NP_441340.1_5 Forward -228 -221 4.07068 0.239
NP_441340.1_9 Reverse -230 -240 8.15881 0.256
NP_440161.1_3 Reverse -287 -306 10.0292 0.235
NP_440586.1_1 Forward -341 -322 -2.16383 0.25
NP_440586.1_8 Forward -297 -290 13.2151 0.026
NP_440586.1_8 Reverse -290 -297 13.2151 0.026
NP_440586.1_8 Forward -228 -221 7.61025 0.227
NP_440586.1_8 Reverse -221 -228 7.61025 0.227
NP_442251.1_6 Forward -297 -290 15.2804 0.0124
NP_442251.1_6 Reverse -290 -297 15.2804 0.0124
NP_442959.1_5 Forward -58 -39 7.86593 0.23
NP_441262.1_3 Reverse -289 -296 14.8871 0.0223
NP_441262.1_3 Forward -298 -291 14.7888 0.0223
NP_440027.1_3 Reverse -279 -297 9.16315 0.187
NP_440027.1_3 Reverse -243 -261 2.37835 0.29
NP_443051.1_1 Forward -299 -290 19.5676 0.00335
NP_443051.1_1 Reverse -288 -297 8.35786 0.0371
NP_439937.1_9 Reverse -219 -236 -11.4665 0.256
NP_441740.2_1 Reverse -270 -289 15.7324 0.19
NP_440408.1_7 Reverse -289 -308 7.17762 0.291
NP_440439.1_1 Reverse -286 -299 9.55739 0.0454
NP_440439.1_1 Forward -301 -288 8.08242 0.0559
NP_440372.1_2 Forward -297 -290 16.3621 0.0124
NP_440372.1_2 Reverse -290 -297 16.3621 0.0124
NP_440171.1_3 Forward -340 -321 1.27776 0.294
NP_440316.1_10 Forward -230 -220 8.4365 0.239
NP_440316.1_10 Reverse -11 -21 7.84651 0.245
NP_441803.1_2 Forward -228 -209 1.57275 0.229
NP_441803.1_2 Forward -303 -284 -0.197208 0.269
NP_441572.1_7 Forward -304 -285 5.99764 0.0851
NP_442384.1_10 Forward -298 -285 11.0324 0.039
NP_442384.1_10 Reverse -289 -302 4.64084 0.151
NP_442114.1_4 Forward -298 -287 8.31847 0.208
NP_442121.1_4 Reverse -334 -353 -2.26216 0.226
NP_442790.1_4 Reverse -280 -299 -13.6686 0.266
NP_442262.1_10 Forward -297 -290 14.1988 0.0123
NP_442262.1_10 Reverse -290 -297 14.1988 0.0123
NP_442262.1_10 Forward -228 -221 10.4622 0.145
NP_442262.1_10 Reverse -221 -228 10.4622 0.145
NP_442262.1_10 Forward -20 -13 8.8889 0.219
NP_441689.1_5 Forward -300 -290 17.8758 0.0158
NP_442244.1_6 Forward -247 -228 -0.197208 0.291
NP_440163.1_10 Forward -226 -216 9.02648 0.25
NP_440344.1_10 Forward -28 -11 -10.5809 0.185
NP_440344.1_10 Reverse -248 -265 -12.1542 0.243
NP_440282.1_10 Forward -308 -289 -9.93197 0.29
NP_440531.1_6 Forward -306 -287 0.0977854 0.199
NP_442123.1_3 Reverse -289 -308 10.1275 0.294
NP_440487.1_1 Forward -171 -152 -4.22878 0.214
NP_441965.1_10 Reverse -217 -233 8.90832 0.123
NP_441965.1_10 Reverse -286 -302 8.515 0.125
NP_440297.1_9 Reverse -290 -300 9.22315 0.0917
NP_440297.1_9 Forward -228 -218 0.865012 0.282
NP_440297.1_9 Forward -297 -287 0.176696 0.282
NP_440297.1_9 Reverse -221 -231 -0.118297 0.282
NP_440350.1_5 Reverse -370 -389 -6.49039 0.296
NP_442280.1_10 Forward -239 -221 8.27904 0.263
NP_441896.1_3 Reverse -280 -299 13.0775 0.0692
NP_440894.1_10 Reverse -209 -228 4.52268 0.252
NP_441894.1_1 Forward -397 -378 4.52268 0.11
NP_440999.1_9 Reverse -285 -299 15.1426 0.0277
NP_440999.1_9 Reverse -216 -230 -0.885388 0.22
NP_440888.1_2 Forward -21 -7 8.06211 0.172
NP_440888.1_2 Forward -298 -284 6.58715 0.228
NP_442454.1_2 Reverse -136 -155 7.11373 0.291
NP_440600.1_4 Reverse -281 -299 -0.177514 0.147
NP_439969.1_1 Reverse -329 -348 -6.68705 0.288
NP_442948.1_2 Forward -299 -280 3.04771 0.296
NP_442033.1_10 Reverse -277 -296 5.50599 0.0765
NP_442033.1_10 Reverse -218 -237 -9.34199 0.213
NP_441543.1_2 Reverse -290 -299 15.9293 0.00518
NP_441543.1_2 Forward -297 -288 8.94785 0.0968
NP_441543.1_2 Reverse -221 -230 5.11294 0.209
NP_441543.1_3 Reverse -323 -337 6.29216 0.286
NP_442845.1_2 Forward -235 -221 10.0294 0.161
NP_442845.1_2 Forward -304 -290 7.27608 0.195
NP_442845.1_2 Reverse -214 -228 4.12949 0.267
NP_441551.1_5 Reverse -285 -301 12.1525 0.157
NP_441319.1_5 Forward -297 -278 10.5209 0.25
NP_441319.1_6 Reverse -287 -306 12.0942 0.284
NP_441469.1_8 Reverse -288 -297 16.5193 0.00797
NP_441469.1_8 Reverse -219 -228 12.9794 0.087
NP_441469.1_8 Forward -299 -290 6.5879 0.227
NP_442337.1_8 Forward -346 -327 0.884433 0.244
NP_442578.1_7 Forward -297 -290 14.5921 0.026
NP_442578.1_7 Reverse -290 -297 14.5921 0.026
NP_442286.1_7 Reverse -28 -47 12.6833 0.292
NP_441462.1_2 Reverse -289 -299 10.4031 0.011
NP_441462.1_2 Forward -298 -288 2.7333 0.0792
NP_441621.1_7 Reverse -287 -301 4.81781 0.0934
NP_443062.1_1 Reverse -289 -307 8.83844 0.145
NP_443062.1_1 Reverse -220 -238 4.35311 0.264
NP_441410.1_3 Forward -307 -288 10.8159 0.185
NP_441410.1_4 Forward -354 -335 9.04509 0.297
NP_442204.1_1 Forward -302 -291 9.40011 0.0786
NP_442204.1_1 Forward -292 -281 -0.0396598 0.285
NP_442204.1_1 Reverse -285 -296 -0.0396598 0.285
NP_442204.1_1 Forward -233 -222 -0.137991 0.286
NP_442204.1_2 Forward -308 -289 7.57094 0.276
NP_442204.1_5 Forward -308 -289 4.12936 0.178
NP_442204.1_6 Forward -349 -330 5.70265 0.269
NP_440516.1_2 Reverse -283 -301 5.42735 0.129
NP_440516.1_8 Forward -298 -289 9.53783 0.0136
NP_440516.1_8 Reverse -289 -298 7.07956 0.0867
NP_440516.1_8 Forward -288 -279 -0.393597 0.255
NP_440516.1_8 Reverse -12 -21 -0.491928 0.262
NP_440516.1_8 Forward -229 -220 -0.590259 0.283
NP_442428.1_5 Forward -297 -290 15.8704 0.0124
NP_442428.1_5 Reverse -290 -297 15.8704 0.0124
NP_442428.1_5 Forward -228 -221 4.36568 0.271
NP_442428.1_5 Reverse -221 -228 4.36568 0.271
NP_442120.1_1 Reverse -12 -31 17.9932 0.114
NP_441867.1_4 Reverse -83 -102 5.11266 0.256
NP_440673.1_3 Reverse -291 -298 12.4288 0.0426
NP_440673.1_3 Forward -19 -12 8.98723 0.203
NP_440673.1_3 Forward -296 -289 5.34899 0.298
NP_443048.1_9 Reverse -374 -388 17.5078 0.11
NP_441052.1_2 Reverse -220 -230 14.3364 0.0224
NP_441052.1_2 Reverse -289 -299 1.84832 0.225
NP_441052.1_2 Forward -298 -288 0.766681 0.256
NP_442219.1_8 Forward -31 -12 9.42334 0.23
NP_442219.1_9 Reverse -290 -299 8.25953 0.0681
NP_440436.1_4 Reverse -290 -299 9.24241 0.0871
NP_440436.1_4 Forward -297 -288 9.04574 0.092
NP_440436.1_4 Reverse -221 -230 4.7192 0.244
NP_441884.1_8 Forward -299 -280 -7.67036 0.254
NP_441719.1_4 Forward -297 -290 16.3621 0.0124
NP_441719.1_4 Reverse -290 -297 16.3621 0.0124
NP_441719.1_6 Forward -23 -4 8.55343 0.269
NP_441004.1_1 Forward -343 -324 -8.45701 0.2
NP_442366.1_3 Reverse -288 -306 11.2289 0.0386
NP_441115.1_4 Reverse -288 -306 12.0147 0.119
NP_442206.1_10 Forward -298 -283 8.33803 0.173
NP_442206.1_10 Reverse -289 -304 -0.315096 0.29
NP_440328.1_4 Reverse -283 -302 -0.197208 0.27
NP_441966.1_8 Forward -235 -217 -1.75081 0.198
NP_441851.1_10 Reverse -288 -298 14.4347 0.016
NP_441851.1_10 Reverse -341 -351 11.5831 0.0685
NP_441851.1_10 Forward -299 -289 8.33817 0.118
NP_442208.1_5 Forward -333 -314 -4.6221 0.258
YP_003858593.1_3 Forward -250 -231 24.9746 0.00646
NP_442814.1_2 Forward -281 -262 7.17762 0.252
NP_442622.1_1 Forward -299 -280 -11.8986 0.257
NP_442856.1_7 Reverse -280 -299 2.26107 0.161
NP_441349.1_10 Forward -308 -289 -8.55534 0.278
NP_441409.1_6 Forward -304 -285 -15.3402 0.29
NP_442843.1_1 Forward -297 -278 -2.45882 0.203
NP_439960.1_6 Reverse -266 -285 9.73422 0.221
NP_440474.1_8 Reverse -357 -371 4.12889 0.291
NP_440474.1_8 Reverse -290 -304 4.12889 0.291
NP_442450.1_5 Forward -300 -290 9.41981 0.115
NP_440588.1_2 Forward -238 -219 -0.983855 0.155
NP_440588.1_2 Forward -307 -288 -1.27885 0.155
NP_442006.1_2 Forward -394 -377 -18.5457 0.292
NP_441570.1_1 Forward -298 -280 -6.96235 0.0829
NP_441078.1_4 Forward -298 -289 9.93116 0.0203
NP_441078.1_4 Reverse -289 -298 9.83282 0.0226
NP_441078.1_4 Forward -229 -220 -1.6719 0.266
NP_441078.1_4 Reverse -220 -229 -1.77023 0.266
NP_442729.1_5 Forward -230 -220 8.33817 0.248
NP_440793.1_1 Reverse -373 -387 10.3237 0.291
NP_441432.1_8 Forward -299 -290 16.8143 0.00595
NP_441432.1_8 Reverse -11 -20 12.2911 0.0444
NP_441432.1_8 Forward -230 -221 6.19458 0.118
NP_441732.1_2 Forward -302 -286 -7.70961 0.0885
NP_442157.1_9 Reverse -327 -346 15.9291 0.242
NP_440685.1_8 Forward -241 -222 15.9291 0.23
NP_440760.1_1 Forward -298 -279 -20.5517 0.223
NP_442797.1_7 Forward -358 -340 18.407 0.0629
NP_442797.1_7 Reverse -335 -353 4.24738 0.232
NP_441131.1_5 Reverse -11 -30 6.09597 0.251
NP_442489.1_2 Reverse -209 -228 4.42435 0.22
NP_442489.1_7 Forward -298 -289 10.4228 0.0151
NP_442489.1_7 Reverse -289 -298 10.3245 0.0193
NP_442489.1_7 Forward -229 -220 -1.6719 0.235
NP_442489.1_7 Reverse -220 -229 -1.77023 0.247
NP_442079.1_6 Forward -306 -287 20.649 0.0492
NP_440559.1_1 Reverse -290 -299 8.65285 0.0586
NP_440559.1_1 Forward -297 -288 7.86621 0.0856
NP_441659.2_8 Reverse -289 -299 11.3864 0.0184
NP_441659.2_8 Forward -298 -288 8.63316 0.0405
NP_442913.1_10 Reverse -280 -299 7.37428 0.0546
NP_442913.1_10 Reverse -205 -224 -2.75381 0.192
NP_439956.1_7 Forward -362 -343 1.76941 0.28
NP_440442.1_3 Reverse -219 -233 14.8476 0.287
NP_441800.1_7 Reverse -320 -338 -1.25915 0.242
NP_442346.1_5 Forward -299 -289 15.0247 0.00889
NP_442346.1_5 Forward -230 -220 6.27322 0.208
NP_440352.1_5 Reverse -222 -241 13.0451 0.208
NP_440545.1_3 Forward -302 -285 6.13536 0.0568
NP_440545.1_3 Reverse -285 -302 3.28376 0.0859
NP_440545.1_3 Forward -233 -216 -4.38605 0.224
NP_440545.1_3 Reverse -311 -328 -6.84433 0.289
NP_441856.1_3 Reverse -286 -305 7.7676 0.101
NP_440743.1_8 Forward -20 -1 18.7798 0.215
NP_440486.1_6 Reverse -213 -232 11.6025 0.207
NP_441653.1_2 Reverse -1 -20 10.294 0.133
NP_441233.1_1 Reverse -13 -32 4.71934 0.28
NP_441888.1_7 Reverse -284 -298 21.5341 0.0174
NP_440449.1_6 Reverse -271 -289 6.60236 0.244
NP_441948.1_4 Forward -305 -287 -4.30741 0.225
NP_441833.1_4 Forward -297 -290 15.9687 0.0124
NP_441833.1_4 Reverse -290 -297 15.9687 0.0124
NP_441895.1_10 Reverse -99 -118 -18.4868 0.282
NP_442162.1_9 Forward -297 -290 16.2637 0.0124
NP_442162.1_9 Reverse -290 -297 16.2637 0.0124
NP_442162.1_9 Forward -269 -262 5.93897 0.214
NP_440671.1_4 Forward -229 -215 7.76774 0.208
NP_442140.1_3 Forward -297 -287 15.2213 0.0429
NP_442140.1_3 Reverse -221 -231 7.45319 0.14
NP_442140.1_3 Forward -228 -218 5.28991 0.216
NP_440875.1_9 Forward -296 -286 12.7522 0.104
NP_440875.1_9 Reverse -291 -301 8.27469 0.233
NP_441813.1_5 Reverse -287 -297 18.6629 0.00743
NP_441813.1_5 Forward -300 -290 15.9097 0.01
NP_442028.1_1 Forward -151 -138 8.17859 0.289
NP_440590.1_4 Forward -297 -284 5.23083 0.0585
NP_440590.1_4 Reverse -280 -293 -5.38892 0.277
NP_440567.1_1 Reverse -290 -304 12.7826 0.0216
NP_442497.1_10 Reverse -290 -299 17.601 0.00813
NP_442497.1_10 Forward -297 -288 8.55452 0.0294
NP_440821.1_4 Forward -300 -290 11.0914 0.0146
NP_440821.1_4 Reverse -287 -297 9.61647 0.0286
NP_441239.1_9 Reverse -287 -299 14.1986 0.0288
NP_441239.1_9 Reverse -218 -230 13.117 0.0389
NP_441239.1_9 Forward -300 -288 10.5604 0.076
NP_441892.1_1 Forward -307 -290 -3.20608 0.235
NP_440665.1_1 Reverse -214 -233 -15.1435 0.264
NP_440604.1_6 Reverse -289 -308 7.96426 0.0894
NP_442216.1_4 Forward -26 -18 15.3586 0.255
NP_440212.1_9 Reverse -137 -156 6.13556 0.169
NP_442138.1_9 Reverse -259 -278 7.4718 0.299
NP_442052.1_7 Forward -338 -324 16.7159 0.153
NP_440546.1_4 Forward -229 -219 10.8217 0.104
NP_443033.1_2 Reverse -353 -372 17.2065 0.236
NP_442041.1_2 Forward -236 -218 9.95058 0.283
NP_442041.1_5 Forward -246 -227 4.916 0.233
NP_440462.1_6 Forward -300 -290 16.893 0.00853
NP_440462.1_6 Reverse -287 -297 8.63316 0.0588
NP_440462.1_6 Reverse -277 -287 2.83163 0.272
NP_440868.1_4 Forward -302 -290 15.1819 0.0164
NP_440868.1_4 Reverse -285 -297 5.05386 0.107
NP_442479.1_9 Forward -153 -134 -8.35868 0.266
NP_442402.1_4 Reverse -205 -224 -1.37794 0.189
NP_441848.1_7 Forward -115 -96 -4.62285 0.296
NP_439942.1_2 Reverse -35 -54 12.7933 0.267
NP_440696.1_3 Reverse -285 -303 3.46073 0.206
NP_442039.1_4 Forward -297 -290 15.1821 0.0124
NP_442039.1_4 Reverse -290 -297 15.1821 0.0124
NP_442837.1_3 Forward -297 -290 15.7721 0.0124
NP_442837.1_3 Reverse -290 -297 15.7721 0.0124
NP_442053.1_1 Forward -298 -289 9.34117 0.0666
NP_442053.1_1 Reverse -289 -298 8.84951 0.072
NP_440505.1_3 Forward -300 -290 15.123 0.014
NP_440505.1_3 Reverse -287 -297 6.07655 0.197
NP_440505.1_3 Reverse -10 -20 6.07655 0.197
NP_441102.1_1 Reverse -290 -309 4.52268 0.267
NP_441252.1_6 Reverse -101 -108 11.6422 0.288
NP_441203.1_1 Reverse -290 -309 15.8307 0.00607
NP_442532.1_7 Forward -298 -284 14.8476 0.0644
NP_440914.1_1 Reverse -12 -22 9.00547 0.186
NP_440914.1_1 Reverse -342 -352 7.44401 0.237
NP_440914.1_1 Reverse -289 -299 7.24882 0.242
NP_440914.1_1 Forward -298 -288 6.3705 0.283
NP_441011.1_8 Reverse -290 -299 16.6177 0.00602
NP_441011.1_8 Forward -297 -288 9.24284 0.131
NP_442533.1_1 Forward -354 -335 -11.1119 0.236
NP_442533.1_6 Forward -298 -289 7.86621 0.0862
NP_442533.1_6 Reverse -289 -298 7.37455 0.0898
NP_442533.1_6 Forward -229 -220 7.17789 0.0948
NP_442533.1_6 Reverse -220 -229 6.68623 0.105
NP_442232.1_3 Forward -306 -287 -15.4385 0.291
NP_441482.1_7 Forward -304 -290 -1.67204 0.0787
NP_441482.1_7 Reverse -283 -297 -2.75368 0.0997
NP_441108.1_1 Forward -393 -374 21.5339 0.0375
NP_439944.1_9 Reverse -290 -300 17.6796 0.00347
NP_442269.1_10 Forward -356 -337 2.26107 0.28
NP_440116.1_8 Forward -297 -278 -3.63879 0.157
NP_441527.1_4 Forward -392 -373 -8.83343 0.251
NP_440115.1_6 Forward -301 -291 7.45319 0.147
NP_440007.1_9 Forward -302 -288 9.83269 0.166
NP_440007.1_9 Reverse -338 -352 3.73617 0.267
NP_439965.1_1 Forward -307 -288 -9.44032 0.288
NP_441059.1_10 Forward -389 -376 12.8023 0.226
NP_441106.1_1 Forward -299 -290 18.486 0.0028
NP_441106.1_1 Reverse -288 -297 9.04618 0.0371
NP_440429.1_2 Forward -228 -209 7.27595 0.289
NP_441286.1_1 Reverse -288 -300 3.57889 0.0467
NP_441286.1_1 Forward -230 -218 -6.05754 0.245
NP_441286.1_1 Forward -352 -340 -6.45087 0.265
NP_440670.1_8 Forward -298 -289 16.3227 0.00291
NP_440670.1_8 Reverse -289 -298 15.1427 0.00768
NP_441705.1_9 Forward -96 -77 18.4773 0.176
NP_441930.1_3 Reverse -36 -55 7.57817 0.263
NP_440886.1_7 Reverse -288 -298 8.92768 0.0805
NP_440886.1_7 Reverse -219 -229 7.74772 0.0843
NP_442717.1_2 Forward -177 -158 -8.94866 0.29
NP_442072.1_9 Forward -289 -271 -16.3038 0.199
NP_441069.1_5 Reverse -337 -355 10.3439 0.12
NP_441069.1_5 Reverse -261 -279 3.75572 0.212
NP_441808.1_8 Reverse -214 -233 5.80098 0.295
NP_440907.2_8 Reverse -290 -300 9.51767 0.103
NP_440907.2_8 Forward -297 -287 6.0761 0.179
NP_442264.1_2 Forward -239 -222 6.62702 0.251
NP_441021.1_1 Forward -297 -278 -10.1286 0.229
NP_441626.1_2 Forward -297 -290 15.7721 0.0124
NP_441626.1_2 Reverse -290 -297 15.7721 0.0124
NP_442365.1_7 Forward -302 -283 4.52268 0.144
NP_442794.1_1 Forward -233 -221 10.0687 0.0734
NP_442615.1_1 Forward -307 -289 -0.177514 0.112
NP_441962.1_4 Reverse -221 -240 -9.63698 0.218
NP_441962.1_4 Reverse -342 -361 -10.7186 0.232
NP_440387.1_1 Forward -298 -282 5.86006 0.0304
NP_440387.1_1 Reverse -289 -305 -5.34967 0.227
NP_440855.1_1 Forward -174 -155 1.67108 0.225
NP_441431.1_2 Reverse -217 -231 5.50552 0.298
NP_441488.1_8 Forward -234 -220 11.4053 0.146
NP_440114.1_10 Forward -357 -343 9.04604 0.186
NP_440114.1_10 Forward -229 -215 6.6861 0.26
NP_442323.1_7 Reverse -284 -303 3.04693 0.252
NP_440293.1_3 Forward -237 -218 -2.16383 0.239
NP_440766.1_4 Reverse -285 -299 1.37622 0.236
NP_441311.1_2 Forward -304 -290 13.9619 0.229
NP_439910.1_2 Reverse -212 -229 -21.889 0.195
NP_442867.1_8 Reverse -377 -396 3.73603 0.297
NP_440457.1_1 Reverse -285 -297 5.34885 0.141
NP_440457.1_1 Forward -302 -290 1.31728 0.241
NP_440798.1_6 Reverse -290 -303 1.9859 0.188
NP_442680.1_5 Forward -390 -371 -0.220842 0.278
NP_440142.1_7 Forward -339 -320 11.1109 0.202
NP_442040.1_4 Forward -174 -155 6.68596 0.224
NP_441436.1_8 Forward -293 -274 7.66927 0.293
NP_440473.1_1 Forward -301 -282 15.3065 0.124
NP_442509.1_9 Forward -298 -288 12.4676 0.09
NP_442439.1_3 Reverse -234 -253 5.30933 0.298
NP_442439.1_8 Reverse -219 -238 13.8641 0.153
NP_442514.1_5 Forward -332 -313 -6.3928 0.265
NP_442514.1_5 Reverse -328 -347 -7.17944 0.275
NP_440554.1_4 Forward -297 -287 17.7779 0.0152
NP_440554.1_4 Reverse -290 -300 16.1063 0.0189
NP_441885.1_5 Forward -298 -288 2.33998 0.0799
NP_441885.1_5 Reverse -289 -299 1.55333 0.109
NP_440628.1_1 Forward -383 -373 14.356 0.279
NP_442341.1_9 Reverse -287 -301 15.6336 0.0435
NP_441173.1_9 Forward -95 -87 10.9338 0.242
NP_443000.1_7 Forward -300 -290 17.4829 0.00719
NP_443000.1_7 Reverse -287 -297 2.53664 0.226
NP_441842.1_1 Reverse -199 -212 11.7201 0.245
NP_441842.1_10 Forward -305 -291 9.73436 0.182
NP_440275.1_3 Reverse -287 -297 15.5163 0.0178
NP_440275.1_3 Forward -300 -290 9.12481 0.055
NP_440091.1_1 Reverse -285 -297 0.432302 0.25
NP_440679.1_10 Reverse -291 -310 -16.1268 0.251
NP_442451.1_2 Reverse -281 -300 -5.50708 0.224
NP_442451.1_7 Forward -69 -50 13.5691 0.113
NP_439962.1_4 Reverse -323 -342 -0.39387 0.199
NP_440149.1_8 Reverse -289 -308 -6.98204 0.268
NP_441875.1_10 Forward -396 -382 17.6992 0.167
NP_441105.1_3 Forward -240 -221 -1.96717 0.154
NP_441105.1_3 Reverse -7 -26 -5.9004 0.225
NP_440216.1_1 Forward -298 -284 -1.18038 0.0301
NP_440216.1_1 Reverse -289 -303 -2.55701 0.0521
NP_440216.1_9 Reverse -222 -231 7.37455 0.286
NP_440216.1_9 Reverse -228 -237 6.39124 0.289
NP_440172.1_1 Reverse -289 -299 7.74818 0.0738
NP_440172.1_1 Forward -298 -288 2.14332 0.283
NP_442015.1_10 Reverse -285 -298 24.1104 0.00329
NP_442015.1_10 Reverse -262 -275 0.707601 0.221
NP_441226.1_7 Forward -297 -290 14.4934 0.0123
NP_441226.1_7 Reverse -290 -297 14.4934 0.0123
NP_441111.1_7 Reverse -290 -298 18.7023 0.00294
NP_441111.1_7 Forward -297 -289 8.96754 0.0463
NP_441766.1_2 Reverse -289 -298 16.2243 0.0047
NP_441766.1_2 Forward -298 -289 9.14451 0.0337
NP_442417.1_5 Forward -298 -284 9.43936 0.132
NP_440416.1_9 Forward -305 -286 3.93269 0.0355
NP_440416.1_9 Reverse -308 -327 -9.53865 0.133
NP_440416.1_9 Reverse -242 -261 -13.5702 0.168
NP_440416.1_9 Reverse -324 -343 -18.0934 0.251
NP_440416.1_9 Forward -358 -339 -18.3884 0.256
NP_440416.1_9 Forward -22 -3 -19.9617 0.281
NP_443052.1_9 Reverse -324 -343 -4.22878 0.255
NP_443052.1_9 Reverse -327 -346 -6.68705 0.287
NP_442154.1_1 Forward -342 -324 -13.6489 0.217
NP_442154.1_1 Forward -339 -321 -15.7138 0.224
NP_442564.1_10 Forward -346 -332 12.291 0.244
NP_440261.1_5 Reverse -290 -303 8.27909 0.0273
NP_440988.1_10 Reverse -218 -232 9.83628 0.193
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

AAATCCCCCCGAAGCGGAAAAAGAAGAATTGATGATGTTATTGCGGGATTGGGTTCCCCCTGGGGTGGATGAGGCGGCCTATGTCAAAGCAGGATTCCTCAAGGCGATCGCAGGCGTTCCGGGCTGGTCTTCCGATTGGGCTTCCGTTTGCAGTGCAGACAATGTTTCCTTGGCCATGGCGGTTAACCTCGGGTAGGCATCCTTGACTTTTAACTCTATGTCAAATATCGACAAAGATTACGGTGGAACAAATATTGCTTTATTTGCATAGCATCCACTGCTCTCTACCAATTTGCACCATTCATTTCTCCAAAAAGTCCATAAGGTTCACAGATTATGTACGGTAAATTGCCGTATATTTTGGTAGCATGGTCTCATTCCCCATTGCCAGTTTTGTCCC

CDS

ATGACCCAGATCACCAAGTCCAAAGCCCTGGCTAGGCTGGAAGCCCGGATTAGTCCAGAAACAAAAGCGTTGATGCAAAAGGCGGCGGCCCTGGAGGGCAGATCATTAACTGATTTTGTCGTCGCCAGTGCCCAAGCGGCCGCATTGAAGGTGATTGAACAGCATCAAACTCTCCAATTAACCATTGCCGACAGTCAAGCTTTTGTTGATGCGCTACTACGGCCATCGGAGCCAAATAGTAAGTTAAAAAAAGCCGCCTTGCGTCACCAACAAATAATAGAGATTGATGGTGTTAAAAATTGA

Protein

No sequence available