Your browser is old and dusty. Try Google Chrome!

Details for sll7028

ORF sll7028
Accession NP_942316.1
Symbol
Category
Definition
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_441061.1_2 Reverse -205 -219 -1.47537 0.262
NP_440795.1_7 Reverse -181 -188 10.2655 0.154
NP_441623.1_1 Reverse -76 -94 -4.8974 0.28
NP_440120.1_4 Forward -269 -255 13.3726 0.29
NP_440150.1_6 Forward -92 -73 5.99764 0.229
NP_441225.1_2 Reverse -199 -218 4.916 0.217
NP_440061.1_9 Reverse -79 -93 9.43874 0.145
NP_440061.1_9 Reverse -261 -275 4.91554 0.3
NP_440110.1_8 Forward -368 -349 -1.86883 0.252
NP_441476.1_5 Reverse -89 -108 -4.6221 0.254
NP_440878.1_9 Reverse -188 -207 5.89931 0.174
NP_440878.1_9 Reverse -84 -103 0.884433 0.187
NP_441995.1_6 Forward -353 -334 15.4374 0.286
NP_440304.1_4 Forward -105 -95 5.78156 0.19
NP_440044.1_8 Reverse -181 -200 5.30933 0.103
NP_440916.1_1 Forward -369 -355 11.6026 0.206
NP_442110.1_7 Forward -301 -287 -0.590395 0.295
NP_442726.1_7 Reverse -353 -371 -1.06249 0.29
NP_441772.1_9 Forward -169 -151 20.3737 0.0481
NP_441713.1_4 Reverse -205 -224 9.14423 0.295
NP_442111.1_4 Reverse -13 -27 3.34284 0.248
NP_441163.1_1 Reverse -86 -103 6.92128 0.254
NP_440747.1_10 Forward -106 -94 -12.1541 0.227
NP_442848.1_1 Forward -16 -2 -2.45868 0.263
NP_441012.1_4 Forward -187 -174 14.3756 0.202
NP_443018.1_3 Reverse -181 -188 4.36568 0.254
NP_443018.1_3 Forward -188 -181 4.07068 0.299
NP_441634.1_8 Reverse -178 -192 3.34284 0.154
NP_440376.1_1 Forward -274 -265 -0.68859 0.291
NP_441846.1_10 Forward -207 -188 -23.4033 0.285
NP_440642.1_10 Forward -168 -154 3.14559 0.277
NP_441013.1_2 Reverse -347 -365 -3.02911 0.288
NP_441013.1_2 Forward -190 -172 -4.20908 0.298
NP_441013.1_3 Reverse -381 -400 7.37428 0.266
NP_440533.1_6 Reverse -376 -395 10.8159 0.274
NP_440667.1_2 Reverse -216 -235 1.57275 0.204
NP_442296.1_9 Reverse -88 -107 -5.60541 0.288
NP_440360.1_10 Forward -393 -379 3.73617 0.227
NP_442658.1_1 Reverse -197 -207 5.97777 0.242
NP_442658.1_1 Reverse -92 -102 5.78111 0.25
NP_442658.1_1 Forward -105 -95 5.19112 0.28
NP_442658.1_1 Reverse -178 -188 5.09279 0.284
NP_440656.1_8 Forward -200 -181 3.24438 0.111
NP_441256.1_1 Reverse -201 -220 -2.75381 0.233
NP_442937.1_5 Forward -74 -55 7.96426 0.237
NP_442376.1_2 Forward -94 -75 -10.4236 0.286
NP_442690.1_1 Reverse -36 -55 -9.44032 0.197
NP_440858.1_1 Forward -69 -50 -5.40875 0.281
NP_442536.1_4 Reverse -64 -82 6.214 0.3
NP_440993.1_4 Reverse -204 -221 5.05372 0.263
NP_442002.1_9 Forward -104 -97 11.3472 0.185
NP_441292.1_2 Reverse -174 -193 -7.37537 0.259
NP_441000.1_1 Reverse -367 -385 11.7454 0.242
NP_441041.1_4 Forward -357 -338 -10.1286 0.228
NP_441041.1_7 Forward -106 -94 10.1386 0.102
NP_441041.1_7 Reverse -91 -103 7.80631 0.159
NP_441725.1_5 Reverse -95 -105 0.668351 0.156
NP_439966.1_7 Reverse -202 -212 6.27276 0.185
NP_439966.1_7 Reverse -92 -102 4.50281 0.269
NP_439966.1_9 Reverse -92 -101 7.07956 0.253
NP_442281.1_1 Forward -400 -386 5.80051 0.146
NP_440479.1_9 Reverse -332 -350 10.8356 0.297
NP_442500.1_8 Forward -57 -43 18.5657 0.103
NP_441457.1_2 Forward -235 -216 15.9291 0.111
NP_440723.1_4 Reverse -57 -76 -10.227 0.272
NP_441556.1_4 Reverse -201 -220 12.7045 0.212
NP_441644.1_6 Forward -89 -79 3.42118 0.282
NP_442215.1_2 Reverse -378 -394 -6.52964 0.273
NP_442029.1_1 Reverse -55 -74 -15.0452 0.272
NP_442029.1_6 Forward -113 -94 6.4893 0.238
NP_442933.1_2 Forward -54 -36 13.7528 0.227
NP_441751.2_8 Reverse -95 -109 -5.70361 0.231
NP_442554.1_8 Reverse -181 -191 5.28991 0.153
NP_442863.1_10 Forward -290 -271 13.5691 0.233
NP_441762.1_7 Forward -104 -92 3.48056 0.0676
NP_442142.1_4 Reverse -57 -70 2.96866 0.269
NP_442292.1_5 Reverse -218 -237 10.1275 0.138
NP_443009.1_5 Forward -104 -93 6.94134 0.144
NP_441448.1_1 Reverse -375 -394 5.99764 0.259
NP_441468.1_1 Forward -212 -205 6.72562 0.126
NP_441468.1_1 Reverse -181 -188 4.46401 0.224
NP_441020.2_6 Forward -352 -335 6.13536 0.275
NP_441015.1_10 Reverse -381 -400 -11.4069 0.296
NP_441876.1_9 Reverse -172 -182 13.1559 0.267
NP_441826.1_2 Reverse -88 -102 9.93102 0.0532
NP_442868.1_6 Forward -105 -95 5.48657 0.147
NP_442719.1_2 Forward -123 -105 -11.3879 0.291
NP_441612.1_2 Reverse -245 -255 13.2931 0.21
NP_442820.1_2 Reverse -303 -322 16.4719 0.248
NP_442820.1_4 Reverse -89 -106 11.1502 0.265
NP_442542.1_2 Reverse -92 -105 11.6223 0.114
NP_442050.1_1 Forward -104 -85 10.7175 0.239
NP_442050.1_1 Reverse -87 -106 7.17762 0.275
NP_442903.1_2 Forward -61 -42 6.54077 0.179
NP_442903.1_2 Forward -55 -36 3.77151 0.24
NP_440346.1_6 Reverse -272 -282 13.7586 0.291
NP_441114.1_3 Forward -74 -65 14.5527 0.193
NP_440558.1_2 Forward -211 -192 7.57094 0.119
NP_440558.1_2 Reverse -195 -214 3.73603 0.153
NP_440558.1_2 Forward -79 -60 2.65439 0.166
NP_440558.1_2 Reverse -91 -110 -5.40875 0.258
NP_441518.1_3 Forward -199 -180 -15.5368 0.296
NP_441878.1_6 Forward -104 -94 -6.90313 0.198
NP_442066.2_4 Forward -103 -84 -4.52377 0.232
NP_442962.1_5 Forward -290 -271 4.32602 0.275
NP_442241.1_6 Reverse -238 -257 16.1257 0.183
NP_441458.1_10 Reverse -171 -190 1.96607 0.277
NP_442830.1_5 Reverse -93 -107 -1.86927 0.3
NP_442166.1_7 Forward -88 -74 11.406 0.19
NP_442166.1_7 Reverse -349 -363 8.84938 0.215
NP_441459.1_6 Forward -393 -375 23.6186 0.0207
NP_441574.1_1 Forward -350 -331 -4.6221 0.253
NP_440540.1_8 Forward -102 -83 8.75091 0.249
NP_441238.1_10 Reverse -235 -249 16.2242 0.207
NP_442888.1_8 Reverse -182 -201 9.73422 0.275
NP_441633.1_3 Forward -105 -92 -7.06055 0.288
NP_442590.1_9 Forward -76 -57 4.22769 0.273
NP_442998.1_10 Reverse -191 -198 3.97235 0.297
NP_440299.1_1 Reverse -344 -357 4.83694 0.197
NP_441799.1_1 Forward -107 -93 5.1122 0.223
NP_442333.2_1 Reverse -92 -111 -0.787193 0.113
NP_440256.1_1 Reverse -206 -225 -4.32711 0.152
NP_440087.1_1 Forward -207 -188 -3.83545 0.239
NP_441559.1_8 Reverse -90 -104 -4.03198 0.215
NP_441559.1_8 Reverse -194 -208 -4.4253 0.223
NP_441559.1_8 Reverse -89 -103 -7.57189 0.295
NP_440915.1_6 Reverse -76 -90 -2.65535 0.278
NP_442158.1_4 Forward -281 -271 13.4514 0.234
NP_441296.1_9 Reverse -338 -351 9.65513 0.277
NP_440717.1_1 Reverse -222 -241 9.83255 0.24
NP_442866.1_1 Reverse -381 -400 -1.27885 0.203
NP_440748.1_1 Reverse -181 -200 12.8808 0.266
NP_441199.1_3 Reverse -174 -192 -2.73412 0.274
NP_440570.1_5 Reverse -206 -225 6.19431 0.185
NP_441291.1_2 Reverse -330 -349 13.3725 0.123
NP_441340.1_5 Forward -188 -181 3.97235 0.274
NP_443028.1_4 Forward -56 -37 12.8642 0.252
NP_440161.1_3 Reverse -92 -111 7.86593 0.285
NP_440586.1_1 Forward -354 -335 -2.55715 0.254
NP_440192.1_4 Forward -210 -191 10.4648 0.237
NP_440027.1_8 Reverse -195 -214 4.22689 0.292
NP_439937.1_9 Reverse -197 -214 -14.3181 0.287
NP_439937.1_9 Forward -209 -192 -15.1047 0.287
NP_442294.1_3 Reverse -184 -198 11.897 0.297
NP_441595.1_3 Reverse -332 -342 16.7946 0.202
NP_440171.1_3 Reverse -221 -240 4.12936 0.284
NP_441138.1_5 Reverse -43 -56 7.51014 0.258
NP_441789.1_7 Reverse -89 -108 -2.36125 0.257
NP_441789.1_7 Reverse -194 -213 -4.62285 0.284
NP_440316.1_10 Forward -104 -94 6.96153 0.251
NP_439977.1_5 Reverse -198 -217 -0.590531 0.229
NP_440139.1_1 Forward -109 -90 2.6536 0.225
NP_441572.1_7 Reverse -88 -107 8.94757 0.074
NP_442790.1_4 Forward -103 -84 -14.7502 0.281
NP_442458.1_7 Reverse -283 -302 18.6823 0.0663
NP_440297.1_9 Forward -395 -385 4.20827 0.238
NP_442280.1_10 Forward -222 -204 6.33103 0.279
NP_440999.1_2 Forward -188 -169 10.2259 0.263
NP_440999.1_9 Reverse -90 -104 9.04604 0.0683
NP_440999.1_9 Reverse -76 -90 0.0979218 0.193
NP_440888.1_2 Forward -225 -211 5.21053 0.288
NP_440888.1_2 Reverse -198 -212 5.1122 0.293
NP_440052.1_5 Reverse -337 -356 -2.26216 0.212
NP_442225.1_10 Forward -229 -210 5.99684 0.287
NP_439969.1_3 Reverse -89 -108 0.884433 0.263
NP_441469.1_8 Reverse -179 -188 13.5694 0.073
NP_441469.1_8 Reverse -203 -212 5.60459 0.258
NP_442315.1_2 Forward -279 -267 9.38042 0.291
NP_443064.1_7 Forward -152 -133 21.0609 0.163
NP_441621.1_7 Forward -105 -91 -2.95034 0.188
NP_441621.1_7 Forward -191 -177 -3.34366 0.188
NP_442204.1_1 Reverse -76 -87 0.157002 0.283
NP_440544.1_2 Forward -372 -353 8.35759 0.207
NP_441351.1_8 Reverse -58 -77 6.4893 0.202
NP_440516.1_6 Reverse -263 -277 7.47213 0.273
NP_440516.1_8 Forward -103 -94 -0.590259 0.283
NP_442428.1_5 Reverse -181 -188 4.759 0.223
NP_440783.1_3 Reverse -339 -358 3.04771 0.264
NP_440783.1_5 Forward -103 -84 1.67108 0.19
NP_442120.1_2 Forward -42 -23 14.2574 0.299
NP_442823.1_8 Forward -350 -331 10.2259 0.297
NP_440673.1_2 Forward -199 -180 10.6822 0.198
NP_440865.1_9 Forward -109 -90 -9.44032 0.29
NP_441052.1_2 Reverse -60 -70 2.04498 0.22
NP_441884.1_9 Forward -78 -59 -24.0916 0.284
NP_440314.1_9 Reverse -277 -296 -7.37537 0.24
NP_440746.1_3 Reverse -78 -97 -0.0988766 0.287
NP_441004.1_1 Reverse -204 -223 -8.85033 0.204
NP_441004.1_1 Forward -109 -90 -15.0452 0.271
NP_441004.1_2 Forward -187 -168 -2.36049 0.264
NP_442206.1_10 Reverse -204 -219 0.963207 0.241
NP_443054.1_2 Forward -105 -91 1.86788 0.245
NP_442430.1_10 Reverse -84 -103 18.3865 0.0596
NP_442814.1_2 Reverse -198 -217 6.4893 0.252
NP_441157.1_1 Forward -51 -37 6.58715 0.197
NP_441683.1_7 Forward -144 -125 -6.09707 0.264
NP_441982.1_6 Forward -61 -52 11.5304 0.288
NP_440338.1_4 Forward -45 -26 11.6017 0.156
NP_442314.1_1 Forward -97 -79 -5.19239 0.272
NP_440389.1_3 Forward -106 -87 15.0441 0.195
NP_442843.1_1 Reverse -228 -247 -5.80207 0.244
NP_442843.1_1 Forward -356 -337 -7.67036 0.25
NP_442843.1_1 Reverse -181 -200 -11.8986 0.295
NP_440474.1_8 Reverse -181 -195 16.6169 0.0481
NP_441596.1_10 Reverse -58 -77 11.2092 0.224
NP_441031.1_6 Forward -217 -198 4.12936 0.194
NP_442237.1_4 Forward -54 -36 15.8434 0.162
NP_441003.1_9 Reverse -85 -104 7.7676 0.227
NP_440483.1_1 Reverse -209 -228 -8.94866 0.297
NP_442443.1_1 Forward -212 -193 -2.55715 0.258
NP_442443.1_1 Forward -110 -91 -5.50708 0.282
NP_442443.1_4 Forward -63 -53 14.3359 0.227
NP_441432.1_9 Reverse -42 -55 13.931 0.157
NP_441333.1_1 Reverse -34 -44 11.9712 0.241
NP_441333.1_1 Reverse -45 -55 11.8759 0.241
NP_442797.1_7 Reverse -197 -215 5.62401 0.216
NP_442489.1_2 Reverse -303 -322 1.27776 0.293
NP_442489.1_7 Forward -103 -94 -1.86856 0.259
NP_442489.1_7 Reverse -94 -103 -1.96689 0.28
NP_441452.1_1 Reverse -340 -359 17.6007 0.121
NP_440559.1_1 Reverse -95 -104 4.22796 0.292
NP_441800.1_3 Forward -218 -200 5.91901 0.286
NP_440545.1_3 Forward -193 -176 5.84037 0.059
NP_440831.1_1 Forward -344 -325 11.4058 0.277
NP_441629.1_3 Forward -396 -377 -1.27961 0.262
NP_441786.1_3 Forward -28 -9 6.68596 0.287
NP_440004.1_5 Forward -194 -175 15.8307 0.243
NP_440459.1_2 Forward -359 -342 14.4935 0.119
NP_440459.1_2 Forward -105 -88 8.20031 0.267
NP_441653.1_3 Forward -216 -202 12.0943 0.279
NP_442311.1_5 Forward -210 -191 6.39097 0.245
NP_442828.1_5 Reverse -161 -180 11.7983 0.289
NP_441888.1_7 Reverse -175 -189 1.17956 0.263
NP_441047.1_2 Forward -119 -100 1.86774 0.239
NP_440671.1_4 Forward -103 -89 10.6193 0.154
NP_440671.1_4 Forward -363 -349 6.6861 0.239
NP_440671.1_4 Reverse -174 -188 5.89945 0.27
NP_441973.1_1 Reverse -54 -69 0.373221 0.235
NP_442045.1_5 Reverse -195 -214 -0.39387 0.269
NP_442199.1_6 Reverse -376 -395 9.93088 0.274
NP_442140.1_3 Reverse -211 -221 3.81494 0.278
NP_441671.1_10 Forward -248 -229 1.0811 0.273
NP_441813.1_5 Reverse -178 -188 -0.511621 0.247
NP_442497.1_10 Reverse -95 -104 0.29472 0.199
NP_441239.1_9 Reverse -92 -104 8.39711 0.134
NP_441239.1_9 Forward -191 -179 4.36554 0.253
NP_441951.1_7 Reverse -372 -386 17.8771 0.239
NP_440400.1_1 Reverse -85 -104 -2.65624 0.285
NP_440665.1_1 Reverse -204 -223 -5.01543 0.191
NP_440740.1_8 Forward -67 -48 19.57 0.0563
NP_441017.1_8 Forward -288 -273 10.0097 0.203
NP_440354.1_5 Forward -119 -100 6.4893 0.175
NP_442809.1_6 Reverse -198 -217 1.47442 0.272
NP_440546.1_4 Forward -116 -106 6.74945 0.282
NP_441230.1_5 Forward -242 -223 10.9142 0.0951
NP_441656.1_6 Forward -225 -206 6.88262 0.252
NP_440462.1_4 Forward -220 -206 14.1593 0.169
NP_442402.1_4 Forward -398 -379 2.75194 0.154
NP_441843.2_2 Reverse -346 -365 15.0432 0.219
NP_442039.1_7 Reverse -354 -364 11.1898 0.257
NP_442039.1_7 Forward -82 -72 8.53483 0.263
NP_442380.1_10 Forward -333 -315 7.98396 0.266
NP_441926.1_5 Forward -161 -147 22.2612 0.0126
NP_440505.1_3 Forward -105 -95 4.89658 0.257
NP_442659.1_3 Reverse -206 -225 10.7175 0.274
NP_441252.1_6 Forward -319 -312 14.1004 0.25
NP_440914.1_4 Reverse -196 -212 10.1859 0.274
NP_442533.1_1 Forward -216 -197 -16.1268 0.263
NP_442533.1_6 Forward -89 -80 6.98123 0.0992
NP_441089.1_8 Forward -393 -374 12.7816 0.278
NP_442232.1_3 Forward -111 -92 -8.06369 0.219
NP_442322.1_9 Reverse -338 -356 12.4081 0.251
NP_441482.1_7 Forward -109 -95 -11.1118 0.237
NP_441028.1_6 Reverse -52 -62 7.15773 0.23
NP_441527.1_4 Forward -55 -36 -6.92359 0.227
NP_441527.1_4 Forward -57 -38 -11.8892 0.284
NP_441347.1_5 Forward -109 -95 8.16044 0.298
NP_441602.1_3 Reverse -381 -400 -3.24547 0.243
NP_441972.1_5 Reverse -169 -188 9.0459 0.0678
NP_439903.1_7 Forward -88 -69 3.93269 0.281
NP_440886.1_7 Reverse -93 -103 5.38779 0.185
NP_440886.1_7 Reverse -104 -114 4.60114 0.227
NP_442072.1_9 Forward -104 -86 -22.7936 0.259
NP_441808.1_8 Forward -210 -191 9.53756 0.259
NP_440907.2_4 Reverse -47 -66 7.69039 0.299
NP_441021.1_4 Forward -248 -229 12.9791 0.241
NP_442893.1_4 Reverse -36 -55 8.84842 0.125
NP_442615.1_1 Forward -98 -80 -7.25734 0.283
NP_441962.1_4 Forward -108 -89 -10.1286 0.224
NP_440855.1_1 Reverse -168 -187 -1.86883 0.297
NP_441488.1_8 Forward -74 -60 7.3738 0.252
NP_441993.1_1 Forward -103 -84 9.93819 0.135
NP_440287.1_5 Reverse -137 -156 8.75009 0.286
NP_441677.1_8 Forward -212 -198 19.5675 0.226
NP_442743.1_1 Reverse -338 -357 8.75009 0.264
NP_441531.1_6 Reverse -207 -220 15.2606 0.128
NP_440457.1_1 Forward -206 -194 5.84051 0.135
NP_440457.1_1 Forward -107 -95 0.628964 0.25
NP_440457.1_1 Reverse -176 -188 -0.0593532 0.25
NP_442680.1_5 Forward -61 -42 -0.318533 0.281
NP_440801.1_10 Forward -107 -88 7.57094 0.272
NP_440142.1_7 Forward -356 -337 9.24257 0.214
NP_441984.1_3 Reverse -341 -359 6.214 0.273
NP_442582.1_8 Reverse -42 -60 5.23069 0.28
NP_441496.1_1 Forward -130 -116 13.9534 0.271
NP_442439.1_8 Forward -67 -48 13.8641 0.153
NP_440554.1_4 Forward -188 -178 5.28991 0.153
NP_440554.1_4 Reverse -349 -359 3.12662 0.242
NP_442228.1_10 Reverse -350 -369 11.9958 0.255
NP_441756.1_5 Forward -93 -74 0.0977854 0.242
NP_441756.1_5 Reverse -90 -109 -4.13045 0.292
NP_442395.2_4 Reverse -93 -112 3.63691 0.198
NP_440423.1_6 Forward -197 -178 -20.1584 0.252
NP_440275.1_3 Forward -191 -181 7.94484 0.0641
NP_443046.1_9 Forward -62 -44 3.06666 0.278
NP_441359.1_5 Forward -106 -87 1.86774 0.285
NP_442451.1_2 Reverse -181 -200 -8.94866 0.258
NP_439962.1_4 Reverse -86 -105 1.57275 0.197
NP_439962.1_4 Forward -365 -346 -2.45882 0.23
NP_439962.1_4 Forward -226 -207 -8.35868 0.293
NP_440149.1_10 Forward -103 -84 -9.73531 0.263
NP_441105.1_3 Forward -114 -95 -5.60541 0.222
NP_440216.1_1 Reverse -94 -108 -12.6851 0.296
NP_440216.1_9 Reverse -159 -168 13.6677 0.189
NP_440172.1_1 Forward -89 -79 4.60159 0.178
NP_440172.1_1 Forward -103 -93 3.42162 0.228
NP_442015.1_10 Reverse -176 -189 1.9859 0.204
NP_441766.1_2 Forward -89 -80 1.47469 0.289
NP_442417.1_5 Forward -189 -175 6.98109 0.197
NP_440416.1_9 Reverse -197 -216 -18.8801 0.266
NP_440416.1_9 Reverse -341 -360 -21.1417 0.291
NP_443052.1_9 Reverse -191 -210 -0.688862 0.216
NP_443052.1_9 Forward -247 -228 -4.91709 0.262
NP_443052.1_9 Reverse -194 -213 -4.91709 0.262
NP_442046.1_8 Reverse -205 -224 10.2259 0.293
NP_440261.1_5 Reverse -95 -108 -12.1738 0.272
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

CCATAGCCAATGGACTCCACCAAGTCAACTTAGATGTGTCCCCAGCGGTGGGAGAAGGATGCGCCGCTGAATTCAGTGCCTTTGTGCAACTCTATAAAGACCTACCGGATTTGGAAGCTATTTTTCGGGGACAGGGACAGAATATTGGTTTTCCCACCGAACCGTCCAGTGGTTACGCCTCCACCATTGGGCTGGCAGTGCGGGCGAAAGATGCCACCGCAGGGGTTAATGCTTTTCATTGGTTAACGGATAAAGCGGATAGTGAGTGGGTACAGTTATTTGTTACCGATATGGCCGGGCAATTGCGGCGGGCCGGTCACTTGGGAGCATTGTCCATCATGGCGAAAAAAGAACCAAAACTTAAACAGTTCATGCAGGGTTATCAGGAGTTGCTAGCGAT

CDS

ATGAGCGATGATTGCCAAGCTCTGCTCAGTGCTACCCGATTGCGGCTACGGATGCAGTCTCCCTTTTTTGCTACCCTCGCTCTGTTTGCCCGTTATTACGTCACTGAAGCAATACCTACCGCTGGTACAGAGGGTAAAAATATCTATTTCAATCCCCATTATCTTGCCCAGCTTACCCCCGCCGAAAGGGACGGGCTATTTCTCCATGAGTTGTTGCACGGAGCATTGTTACACCAAAGCCGTCGGGCCAGTCGTCTGCCGGAGTTGTGGAATATAGCGGCGGATATTGTGGTTAATGGCATGATTGTGGCGGAGGGAAAATTTGTTATTCCCAAGGGGGGTTTACGGGAACCGGAATTAGAAAAATATAGTGTGGAGGAGGTCTATGAGTTACTGATTAAACGGGAAAGTCCCCCGGCTTTACCGATAGCGGATCTGTTGCAGGAAATTCCCAATCTAACTACCCAAAGTGATAGTAATAATAATGACAATGACCTAAATAGTAATGACAGTGAGCCTAATGGTGGGCAATCTTCAGCGAATTCCAGCAAAATCCATAGCCATTCACAGGATGATCAAGAAATCCACCGTAATCGTTTAGAAAGTCCTCGCCACCAGGAGGAGCAGTTGGCTGTCCATTGGCGGAATGCGATCCAACAGGCTACCGTTGTGGCCCGTAGTCAGTTCCAGGGCAATTTACCGGAAGGCTTAGAACGACACTTGGGGGAAATTGGCCAGCCTCAGTTGGATTGGCGCACCTATCTCTGGCGATTTTTAGTCCATACTCCCAATGATTTTCAGGGGTACGATCGCCGTTTTATCCATCAAGGTCTGTATCTGGAAGCTTTGGTGGGGGAAAGTGTTGAAGTTTTTTGTTGCATTGACACCAGTGGTTCGGTGGGGGACGAGGAGATGGGAATTTTCTTGAGTGAGCTGAGGGGTATTTTCGGTTCCTATCCCCAAATAAAATGTTGGCTCTGGTATGCTGATGCGGACTGCTATGGCCCCTATGAGCTAGATAATTTAAACGCAGTACCCAAACCCCAGGGGGGCGGTGGCACGGATTTTCGTCCCTTTTTTACGGCGGTGGATGAAAAGTGGAGCAGGGAAAAACAGGCAGTTATCTGTTACCTCACCGATGGTTATGGCAGTTTTCCCGACCAGGCCCCACCATTGGATACCCTCTGGGTAGTATCACCAGGGGGTAAGAATAGTGACGGTTTTCCCTTTGGGGAGGTGGTACGGTTAAGATCCTAA

Protein

No sequence available