Your browser is old and dusty. Try Google Chrome!

Details for sll7003

ORF sll7003
Accession NP_942291.1
Symbol
Category Other
Definition plasmid stability protein
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_440557.1_1 Forward -360 -341 -0.688862 0.27
NP_441418.1_6 Forward -179 -160 -28.7132 0.208
NP_441418.1_6 Forward -222 -203 -29.9915 0.249
NP_441418.1_6 Forward -68 -49 -30.0898 0.256
NP_442151.1_6 Forward -167 -153 7.27608 0.205
NP_443027.1_4 Reverse -128 -138 5.87989 0.294
NP_442975.1_10 Reverse -203 -217 5.80051 0.208
NP_440110.1_7 Forward -222 -203 16.3224 0.212
NP_441054.1_5 Forward -234 -215 15.7324 0.169
NP_441054.1_6 Forward -64 -45 18.1907 0.246
NP_441900.1_2 Reverse -108 -126 -6.07808 0.293
NP_441781.1_7 Reverse -200 -219 0.294447 0.246
NP_439918.1_3 Forward -170 -151 6.98095 0.264
NP_441594.1_6 Reverse -43 -62 3.14605 0.236
NP_442110.1_5 Forward -298 -279 17.8957 0.12
NP_441925.1_4 Reverse -154 -173 -4.62285 0.177
NP_440014.1_3 Reverse -211 -225 16.5458 0.261
NP_441402.1_9 Forward -141 -122 17.3048 0.255
NP_441083.1_5 Forward -47 -37 2.83163 0.191
NP_440178.1_7 Reverse -157 -176 -12.6852 0.123
NP_442570.1_3 Reverse -56 -75 -8.752 0.292
NP_440538.1_10 Forward -51 -32 9.83255 0.296
NP_440906.1_5 Reverse -254 -261 5.64398 0.292
NP_440906.1_9 Reverse -206 -225 17.6982 0.13
NP_441486.1_1 Reverse -265 -279 -5.70361 0.254
NP_442634.1_4 Reverse -251 -265 -4.62196 0.211
NP_441014.1_5 Forward -66 -48 12.1139 0.251
NP_441014.1_8 Reverse -159 -178 -8.06369 0.282
NP_442848.1_1 Forward -173 -159 -3.44199 0.267
NP_441012.1_4 Reverse -160 -173 7.29578 0.272
NP_441182.1_1 Reverse -156 -172 7.92501 0.297
NP_441588.1_4 Forward -207 -197 8.1415 0.154
NP_442687.1_7 Reverse -157 -167 4.99491 0.225
NP_441682.1_6 Forward -178 -159 14.5524 0.291
NP_442296.1_9 Reverse -201 -220 1.0811 0.197
NP_442198.1_1 Reverse -141 -160 13.9625 0.29
NP_442544.1_2 Reverse -30 -44 -0.787057 0.25
NP_440607.1_8 Forward -172 -153 3.24438 0.229
NP_440607.1_8 Forward -224 -205 0.0977854 0.28
NP_442937.1_5 Forward -172 -153 12.6841 0.103
NP_442937.1_5 Forward -175 -156 11.5042 0.136
NP_442321.1_4 Reverse -149 -168 -4.22878 0.284
NP_442486.1_6 Reverse -152 -171 19.5673 0.0289
NP_440203.1_5 Reverse -25 -35 11.091 0.205
NP_439905.1_1 Forward -40 -27 11.819 0.204
NP_440984.1_7 Reverse -68 -82 4.52282 0.299
NP_442911.1_2 Reverse -148 -167 -7.86702 0.221
NP_440153.1_8 Reverse -158 -171 6.70579 0.17
NP_440369.1_5 Forward -386 -367 12.3892 0.209
NP_440200.1_3 Forward -230 -211 5.211 0.298
NP_440200.1_7 Reverse -325 -344 6.32247 0.204
NP_443055.1_6 Reverse -125 -143 -0.866561 0.268
NP_443055.1_6 Forward -75 -57 -2.34152 0.294
NP_442002.1_9 Forward -13 -6 10.3639 0.231
NP_440411.1_2 Reverse -221 -240 3.7233 0.263
NP_441646.1_1 Reverse -52 -71 10.1275 0.121
NP_442438.1_10 Forward -172 -158 4.03116 0.152
NP_442431.1_10 Forward -173 -155 13.8838 0.0747
NP_440465.1_9 Forward -140 -122 3.26407 0.24
NP_441041.1_4 Forward -173 -154 0.58944 0.085
NP_441547.1_2 Forward -227 -209 13.6872 0.0948
NP_442004.1_1 Forward -174 -155 18.9826 0.135
NP_439966.1_7 Reverse -211 -221 7.25606 0.15
NP_439966.1_7 Reverse -139 -149 4.30615 0.279
NP_440736.1_3 Forward -70 -51 -1.67217 0.294
NP_440202.1_10 Forward -295 -276 11.5042 0.264
NP_440983.1_5 Reverse -47 -66 -4.52377 0.257
NP_440983.1_5 Forward -115 -96 -4.81876 0.261
NP_440260.1_8 Reverse -143 -161 -2.24246 0.243
NP_442281.1_1 Reverse -195 -209 8.84875 0.075
NP_442847.1_3 Reverse -277 -296 7.07848 0.235
NP_442500.1_2 Forward -175 -156 6.39097 0.283
NP_442671.1_2 Reverse -312 -331 1.18675 0.242
NP_442142.1_4 Reverse -161 -174 9.75346 0.0873
NP_442292.1_1 Forward -114 -105 3.14632 0.205
NP_440895.1_10 Reverse -160 -177 3.38209 0.149
NP_440895.1_10 Reverse -140 -157 -5.66436 0.29
NP_443009.1_5 Reverse -21 -32 4.38475 0.249
NP_442301.1_2 Reverse -203 -222 6.58682 0.263
NP_442301.1_2 Reverse -157 -176 5.30853 0.265
NP_442741.1_8 Forward -174 -156 13.8838 0.285
NP_441015.1_10 Reverse -47 -66 2.16274 0.152
NP_441015.1_10 Forward -172 -153 -1.67217 0.174
NP_441015.1_10 Forward -166 -147 -8.85033 0.277
NP_441015.1_10 Forward -178 -159 -10.9153 0.289
NP_441426.1_7 Reverse -106 -123 18.1317 0.264
NP_441764.1_4 Reverse -179 -196 13.8013 0.154
NP_442719.1_2 Reverse -330 -348 -10.9946 0.286
NP_442808.1_1 Forward -76 -66 16.5975 0.01
NP_441849.1_2 Forward -194 -175 -0.0481691 0.277
NP_440145.1_3 Forward -177 -158 -1.86883 0.156
NP_441906.1_2 Forward -280 -261 0.785326 0.295
NP_441114.1_3 Reverse -24 -33 8.25953 0.231
NP_441878.1_6 Reverse -157 -167 -0.0199663 0.163
NP_441878.1_6 Forward -168 -158 -7.29646 0.217
NP_441878.1_6 Forward -32 -22 -7.49312 0.231
NP_441557.1_1 Reverse -154 -173 19.2723 0.218
NP_441590.1_4 Reverse -160 -179 9.14342 0.249
NP_442777.1_3 Reverse -123 -141 3.55831 0.274
NP_441574.1_1 Forward -173 -154 -4.03212 0.249
NP_442594.1_8 Forward -221 -202 5.99764 0.236
NP_441633.1_3 Reverse -1 -14 -5.58558 0.236
NP_442590.1_9 Reverse -30 -49 4.32602 0.273
NP_440299.1_1 Reverse -160 -173 3.46031 0.243
NP_440299.1_1 Forward -88 -75 2.47701 0.288
NP_441007.1_10 Forward -178 -165 -0.0790467 0.26
NP_441007.1_10 Forward -172 -159 -0.37404 0.277
NP_441090.1_6 Reverse -88 -102 8.65272 0.262
NP_441559.1_8 Reverse -18 -32 -5.60527 0.267
NP_441270.1_5 Forward -226 -207 13.775 0.211
NP_440915.1_6 Forward -60 -46 -0.787057 0.209
NP_440997.1_4 Reverse -156 -175 17.6007 0.19
NP_441464.1_10 Forward -229 -215 8.75105 0.27
NP_440677.1_1 Forward -259 -240 9.73422 0.181
NP_440570.1_5 Reverse -30 -49 -2.95047 0.283
NP_441750.1_1 Forward -161 -142 -6.78538 0.243
NP_440586.1_8 Reverse -185 -192 8.98688 0.188
NP_440192.1_4 Forward -136 -117 10.8529 0.232
NP_442959.1_1 Forward -178 -159 4.52268 0.274
NP_439937.1_8 Forward -172 -153 -4.81876 0.286
NP_442239.1_8 Forward -159 -140 4.81767 0.292
NP_440171.1_2 Reverse -260 -274 16.4456 0.258
NP_440316.1_10 Reverse -65 -75 6.56821 0.257
NP_441803.1_2 Reverse -153 -172 2.85105 0.203
NP_442384.1_10 Forward -167 -154 4.8375 0.145
NP_442384.1_10 Forward -250 -237 0.215946 0.297
NP_440531.1_6 Forward -76 -57 6.68596 0.104
NP_440531.1_6 Forward -39 -20 0.58944 0.19
NP_440531.1_6 Reverse -260 -279 -1.47551 0.232
NP_442910.1_6 Forward -67 -53 8.75105 0.24
NP_442556.1_10 Forward -64 -45 10.2632 0.273
NP_440297.1_9 Forward -166 -156 -0.511621 0.289
NP_440350.1_5 Forward -331 -312 -7.27704 0.299
NP_442280.1_10 Reverse -142 -160 8.76604 0.249
NP_440894.1_2 Reverse -159 -178 2.75272 0.174
NP_440894.1_10 Reverse -104 -123 8.06259 0.185
NP_442553.1_4 Reverse -46 -65 9.93088 0.235
NP_440999.1_9 Reverse -358 -372 0.196253 0.191
NP_440888.1_2 Reverse -158 -172 7.3738 0.198
NP_441543.1_2 Forward -270 -261 8.94785 0.0968
NP_442845.1_2 Forward -215 -201 3.34284 0.294
NP_441469.1_8 Forward -32 -23 6.39124 0.227
NP_443064.1_6 Reverse -352 -362 9.85209 0.193
NP_440710.1_1 Forward -76 -58 0.707465 0.159
NP_441621.1_7 Reverse -159 -173 -6.49025 0.295
NP_440454.1_1 Forward -335 -316 8.9237 0.27
NP_440516.1_8 Reverse -66 -75 -0.393597 0.255
NP_440673.1_3 Reverse -24 -31 6.72562 0.277
NP_440865.1_9 Forward -179 -160 -8.26035 0.263
NP_441052.1_2 Reverse -158 -168 4.3066 0.161
NP_440436.1_2 Reverse -24 -43 15.7394 0.292
NP_442907.1_9 Reverse -159 -178 -6.39206 0.289
NP_441004.1_1 Forward -179 -160 -17.6018 0.292
NP_441004.1_5 Forward -15 -1 6.6861 0.298
NP_439949.1_10 Reverse -18 -37 15.0281 0.253
NP_442873.1_5 Reverse -160 -179 13.175 0.189
NP_441228.1_7 Forward -63 -45 15.9174 0.296
NP_442622.1_8 Reverse -106 -124 -19.3521 0.296
NP_441668.1_4 Reverse -50 -69 -2.45882 0.288
NP_442515.1_1 Reverse -157 -171 0.88457 0.178
NP_441409.1_6 Reverse -118 -137 -15.5368 0.297
NP_440431.1_4 Reverse -314 -333 -9.69285 0.288
NP_440588.1_2 Reverse -232 -251 -1.27885 0.155
NP_440588.1_2 Reverse -149 -168 -1.86883 0.157
NP_442006.1_3 Forward -160 -142 -5.38906 0.298
NP_441003.1_9 Reverse -91 -110 5.99764 0.255
NP_441003.1_9 Reverse -226 -245 5.211 0.266
NP_441078.1_4 Forward -167 -158 -1.86856 0.272
NP_442729.1_4 Reverse -146 -165 14.6499 0.297
NP_442729.1_5 Forward -63 -53 13.353 0.231
NP_441432.1_8 Forward -32 -23 3.53964 0.244
NP_441732.1_2 Reverse -154 -170 -17.346 0.253
NP_440760.1_1 Reverse -158 -177 -15.0452 0.14
NP_440131.1_2 Forward -140 -121 5.211 0.281
NP_440578.1_4 Forward -43 -24 10.4225 0.248
NP_440461.1_3 Forward -168 -149 14.4541 0.281
NP_440913.1_3 Reverse -158 -171 14.1789 0.248
NP_442407.1_2 Reverse -173 -192 11.11 0.206
NP_442400.1_10 Reverse -179 -192 8.0831 0.279
NP_442489.1_7 Forward -167 -158 -1.37691 0.195
NP_440757.1_7 Forward -172 -154 11.1305 0.156
NP_442079.1_6 Reverse -150 -169 12.9791 0.283
NP_441659.2_8 Reverse -158 -168 3.42162 0.161
NP_440786.1_5 Forward -164 -145 20.2556 0.101
NP_441800.1_3 Forward -166 -148 11.9172 0.266
NP_442346.1_5 Forward -32 -22 10.5998 0.0917
NP_442346.1_5 Reverse -157 -167 9.61647 0.118
NP_442346.1_5 Forward -251 -241 4.50326 0.286
NP_442346.1_10 Reverse -136 -155 -3.54046 0.294
NP_440545.1_3 Forward -171 -154 1.31714 0.121
NP_441629.1_3 Forward -75 -56 -3.14789 0.277
NP_440010.1_4 Forward -177 -158 5.80018 0.199
NP_442551.1_4 Reverse -20 -35 -0.905081 0.245
NP_442551.1_4 Forward -169 -154 -3.65835 0.292
NP_442311.1_5 Forward -136 -117 6.78429 0.245
NP_440751.1_3 Reverse -132 -151 6.88182 0.287
NP_441112.1_6 Forward -125 -106 1.0811 0.263
NP_441112.1_6 Forward -78 -59 -0.983855 0.295
NP_441671.1_6 Forward -284 -265 8.35759 0.179
NP_442254.1_1 Forward -43 -24 -5.70374 0.287
NP_440590.1_9 Forward -161 -143 6.11567 0.262
NP_442568.1_8 Reverse -311 -325 8.16106 0.292
NP_442643.1_5 Forward -358 -339 0.982764 0.25
NP_441769.1_3 Reverse -169 -188 -0.39464 0.221
NP_441230.1_5 Forward -178 -159 2.75272 0.209
NP_440462.1_4 Forward -216 -202 5.50613 0.29
NP_442499.1_1 Forward -138 -119 3.83436 0.247
NP_441249.1_8 Forward -227 -208 0.982764 0.284
NP_441474.1_1 Reverse -202 -221 1.57197 0.247
NP_442402.1_4 Forward -64 -45 -1.08295 0.189
NP_442402.1_10 Forward -80 -70 11.9759 0.23
NP_441811.1_8 Forward -173 -159 8.55439 0.235
NP_440914.1_1 Reverse -352 -362 6.76087 0.267
NP_442533.1_1 Forward -225 -206 -17.1101 0.281
NP_442533.1_6 Reverse -158 -167 5.60459 0.137
NP_442533.1_6 Forward -167 -158 3.7363 0.204
NP_442533.1_6 Forward -31 -22 3.04799 0.228
NP_440263.1_1 Forward -188 -175 16.5324 0.239
NP_441527.1_4 Reverse -311 -330 -5.77769 0.208
NP_441527.1_4 Reverse -306 -325 -8.83343 0.251
NP_439903.1_6 Forward -71 -52 2.6536 0.222
NP_441286.1_1 Forward -168 -156 -5.07423 0.188
NP_442674.1_10 Reverse -256 -275 11.7008 0.21
NP_442881.1_3 Reverse -159 -178 14.6499 0.258
NP_440886.1_7 Reverse -160 -170 6.66608 0.115
NP_440886.1_7 Reverse -157 -167 6.17443 0.141
NP_440886.1_7 Reverse -206 -216 5.09279 0.201
NP_440828.1_4 Reverse -151 -170 -4.22953 0.246
NP_442614.1_2 Forward -167 -153 6.09611 0.293
NP_440404.1_9 Reverse -316 -335 15.4215 0.142
NP_441463.1_3 Reverse -174 -193 -0.0988766 0.132
NP_442842.1_4 Reverse -88 -107 8.94757 0.223
NP_440107.1_5 Reverse -154 -173 -7.57203 0.3
NP_440387.1_1 Reverse -200 -216 -4.75968 0.198
NP_441510.2_7 Reverse -53 -67 11.012 0.28
NP_440293.1_10 Forward -176 -157 10.6192 0.143
NP_440293.1_10 Forward -179 -160 -0.590531 0.254
NP_441133.1_1 Forward -227 -208 13.0775 0.243
NP_441984.1_1 Forward -173 -155 8.18062 0.262
NP_441984.1_3 Reverse -48 -66 8.86894 0.218
NP_441332.1_6 Reverse -139 -149 12.3244 0.234
NP_441889.1_1 Forward -178 -159 11.0125 0.225
NP_442703.1_4 Forward -250 -231 4.32522 0.283
NP_442341.1_7 Reverse -157 -171 6.98109 0.113
NP_440423.1_6 Reverse -58 -77 -12.0953 0.184
NP_442275.1_1 Reverse -49 -68 4.12936 0.274
NP_439962.1_4 Reverse -139 -158 -1.96717 0.224
NP_442495.1_5 Reverse -153 -172 6.29264 0.291
NP_441105.1_3 Reverse -230 -249 -7.27704 0.25
NP_441105.1_3 Reverse -41 -60 -9.63698 0.292
NP_440172.1_1 Forward -31 -21 9.7148 0.0586
NP_443052.1_9 Reverse -163 -182 -0.197208 0.207
NP_443052.1_9 Reverse -203 -222 -6.39206 0.282
NP_442154.1_1 Forward -172 -154 -14.5338 0.218
NP_442154.1_6 Forward -174 -155 4.81767 0.234
NP_440261.1_5 Forward -166 -153 -4.60227 0.158
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

TGATGTAGTTAACCTGAAAAGTTAAATGTGAGGGTTACAGGTGATTCTCAAGGGTGTAATTTGTACTAGCTTGATTTTATTTTCTTGTTGGATTCGTTCATACACAAGCAGGGCAGGCAAATGATCAAGCGCTATCAATGCTATCATTTGAGTAATGACCAAGACCAAGAGTTTGTTTTGGGCTGGAGGTAGTGGATGGCTAATTTAATTGTTCGCAATATTGATGAAGCGGTGGTGGTGGCCCTGAAAAAGCGGGCGGGGCAACATGGCATTAGTGCCGAAGCAGAACATCGCAAAATCCTAGAGCAGGCCCTATTACGACTTCCCCGAAAGCCCTTTGCCGAGGTGCTCCGCCAGATTCCCAATGTGGGCAATGACTCAGATTTTGAGCGAATACAGG

CDS

ATGACAGAGCCAGTCAAATATTTGATTGATACCAACGTTATTAGTGAGCTACGGAAACAAGATAGGGCCGACCCCGGTGTACTAGCATTTTTTCAGCAAGCTCAGCATCTCTATTTGAGTGTGATTACCATTGGGGAATTGCGGCGGGGTGTGGAATTAATCAGGCATCGGGGAGATGTTCAACAAGCCAATTTACTGGAGGAGTGGTTGGAAATTGTAATTGCTGATTACGCTGACCACATCCTAGATTTCACCATCTTCGAGGCTCAAGTTTTGGGAAAGTTGCGGGTTCCTAATCCCCATAACGCCCTAGATAAACAAATTGCCGCCACTGCCCTTAGTTATGGACTGACCCTAGTTACTCGCAATGTCAAGGATTTTGCCGACACAGGAGTTTGTTTGCTTAATCCTTTCACCGGCAATCAATAA

Protein

No sequence available